Next Article in Journal
The Role of the Innate Immune Response in Oral Mucositis Pathogenesis
Next Article in Special Issue
Impact of Bariatric Surgery on Subtilisin/Kexin Type 9 (PCSK9) Gene Expression and Inflammation in the Adipose Tissue of Obese Diabetic Rats
Previous Article in Journal
Comparative Genomic Analysis of Asian Cultivated Rice and Its Wild Progenitor (Oryza rufipogon) Has Revealed Evolutionary Innovation of the Pentatricopeptide Repeat Gene Family through Gene Duplication
Previous Article in Special Issue
NXC736 Attenuates Radiation-Induced Lung Fibrosis via Regulating NLRP3/IL-1β Signaling Pathway
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis

1
College of Plant Protection, Shenyang Agricultural University, Shenyang 110866, China
2
Department of Entomology, University of Kentucky, Lexington, KY 40546, USA
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2023, 24(22), 16311; https://doi.org/10.3390/ijms242216311
Submission received: 9 October 2023 / Revised: 6 November 2023 / Accepted: 10 November 2023 / Published: 14 November 2023
(This article belongs to the Collection Feature Papers in “Molecular Biology”)

Abstract

:
Oogenesis in insects is a carefully orchestrated process, facilitating the formation of female gametes, which is regulated by multiple extrinsic and intrinsic factors, including ovary serine protease (Osp). As a member of the serine protease family, Osp is a homolog of Nudel, a maternally required protease defining embryonic dorsoventral polarity in Drosophila. In this study, we used CRISPR/Cas9-mediated mutagenesis to functionally characterize Osp in the Asian corn borer, Ostrinia furnacalis, a devastating maize pest throughout Asia and Australia. Building on previous knowledge, we hypothesized that knockout of Osp would disrupt embryonic development in O. furnacalis females. To examine this overarching hypothesis, we (1) cloned and characterized Osp from O. furnacalis, (2) designed target sites on exons 1 and 4 to construct a CRISPR/Cas9 mutagenesis system, and (3) documented phenotypic impacts among O. furnacalis Osp mutants. As a result, we (1) examined the temporal-spatial expression profiles of OfOsp, which has an open reading frame of 5648 bp in length and encodes a protein of 1873 amino acids; (2) established O. furnacalis Osp mutants; and (3) documented recessive, female-specific sterility among OfOspF mutants, including absent or deformed oviducts and reduced fertility in female but not male mutants. Overall, the combined results support our initial hypothesis that Osp is required for embryonic development, specifically ovarian maturation, in O. furnacalis females. Given its substantial impacts on female sterility, Osp provides a potential target for the Sterile Insect Technique (SIT) to manage Lepidoptera pests in general and the species complex Ostrinia in particular.

1. Introduction

The Asian corn borer, Ostrinia furnacalis (Guenée) (Lepidoptera: Pyralidae), is an important corn pest that significantly threatens crop yields and quality [1]. The geographic range of O. furnacalis extends throughout Asia, the Western Pacific, and Australia [2,3]. The larvae of O. furnacalis mostly infest the ears and leaves of corn and bore tunnels in corn stems, resulting in crop losses of up to 30% in cases of severe infestation. Damage caused by O. furnacalis can lead to fungal contamination, which further influences the quality of fresh corn [4]. In addition to corn, O. furnacalis infects a variety of other hosts including soybeans, wheat, cotton, sorghum, and millet [5,6]. Control of O. furnacalis relies on chemical pesticides and some biological control agents, such as parasitic wasps [7] and the insecticidal Bt toxin [8,9]. However, overuse of pesticides is associated with the development of resistance and environmental concerns [10,11]. Thus, an alternative strategy to control O. furnacalis, the most destructive pest of corn, is urgently needed.
Successful application of the Sterile Insect Technique (SIT) is dependent on the release of sterile insects into the field, which mate with wildtype insects and either produce abnormal offspring or eliminate offspring altogether, thereby controlling the target insect [12,13]. The SIT includes radiation-based (rSIT), microbe-mediated (mSIT), and genetic-based (gSIT) methods [14,15,16]. Specifically, rSIT involves the release of radio-sterilized males into the wild as an environmentally friendly means of suppressing or eradicating insect pests [5,17,18]. mSIT has been most successful as a means of inducing cytoplasmic incompatibility via wolbachia and gut microbiota [19,20]. gSIT utilizes genome editing tools such as the CRISPR/Cas9 system to induce adult sterility [16,21,22,23,24].
Serine proteases work as proteolytic enzymes that modulate a variety of physiological processes, such as digestion, signal transduction, and defense reactions [25,26], and are also involved in sperm differentiation and function in mammals [27,28]. In insects, serine proteases are required for post-mating responses in female D. melanogaster [29]. Recent studies in lepidopteran insects have also verified the vital role of serine proteases in male sterility and female reproductivity [30,31]. Ovarian serine protease (Osp) is homologous to Nudel in D. melanogaster [32]. Osp is expressed by ovarian follicular cells during mid and late vitellogenesis in Bombyx mori [31]. Nudel protein is expressed as an extracellular matrix-like molecule that may be anchored in the vitelline membrane [33]. Nudel is responsible for specifying embryonic dorsoventral polarity, development of embryogenesis, and oogenesis in D. melanogaster, as well as increasing the structural integrity of the egg [33]. Mutations in Nudel have weakened the structural integrity of eggs, hindered development, and ultimately led to embryonic death, resulting in female infertility [34]. In B. mori, Osp protein shares 65% of its identity with the homologous Drosophila Nudel protein, and mutagenesis of Osp leads to abnormal oogenesis and female sterility that can be inherited by offspring, indicating the conserved function of Osp protein in lepidopteran insects [31].
In this study, we aimed to functionally characterize the role of O. furnacalis Osp, OfOsp, in ovarian development and reproduction. We hypothesized that OfOsp disrupts embryonic development in O. furnacalis females. To examine this hypothesis, we (1) cloned and characterized OfOsp, (2) knocked out OfOsp in O. furnacalis using the CRISPR/Cas9-mediated gene-editing system, and (3) documented the morphological and physiological consequences caused by OfOsp mutagenesis.

2. Results

2.1. Cloning and Characterization of OfOsp

2.1.1. Cloning of OfOsp

The coding sequence of OfOsp (XM_028323031) was obtained by checking BLAST B. mori Osp (GenBank: NM_001043703.1) against the O. furnacalis genome [35]. As a result, a homologous Osp protein (XP_028178832.1) that shares 70.61% of its identity with B. mori Osp (NP_001037168.1) was identified. OfOsp is 5648 bp in length and encodes 1873 amino acids. Primers were designed to amplify approximately 1500–2500 bp fragments, and the full-length Osp open reading frame (ORF) was assembled from the resulting sequencing data (Table 1). After sequencing, the full length OfOsp ORF was obtained and was used to design sgRNAs.

2.1.2. Phylogenetic Analysis

We analyzed the homologous sequences of Osp proteins selected from 10 different insect species to determine their evolutionary conservation against O. furnacalis, including the lepidopterans silkworm, B. mori; the cotton bollworm, Helicoverpa armigera; the diamondback moth, Plutella xylostella; and the fall armyworm, Spodoptera frugiperda, as well as other non-lepidopterans fruit flies, D. melanogaster; parasitic wood wasps, Orussus abietinus; wheat stem sawflies, Cephus cinctus; burying beetles, Nicrophorus vespilloides; red flour beetles, Tribolium castaneum; and green peach aphids, Myzus persicae. Not surprisingly, OfOsp shared the closest relationship with fellow lepidopterans, including B. mori, P. xyllostella, S. frugiperta, and H. armigera. Osp in B. mori (NP_001037168.1) encodes 1801 amino acids with a 6273 bp ORF, while the length of Osp in H. armigera (XP_021187246.1) is 6447 bp, and it encodes 2149 amino acids; the length of Osp in P. xylostella (XP_011552048.1) is 5982 bp, and it encodes 1994 amino acids; and the length of Osp in S. frugiperda is 6362 bp, and it encodes 2034 amino acids (Figure S1).

2.1.3. Temporal–Spatial Distribution of OfOsp

In S. litura, Osp exhibits relatively high expression in female pupae and adults, with tissue-specific expression in the ovaries [31]. In O. furnacalis, the transcript levels of OfOsp in fourth-instar larvae, fifth-instar larvae, female pupae, and female adults were significantly higher compared to those in the early 12 h old eggs post-laying (p < 0.05). The highest transcript level of OfOsp was observed in adult females, which was about 46-fold higher than that in the egg stage, and this was followed by female pupae (Figure 1A), suggesting that OfOsp plays an important role in the formation of ovaries in pupae and adults. As for the spatial distribution, the transcript level of OfOsp was approximately 23-fold higher in the ovaries of adult females than in adult heads (Figure 1B). These temporal and spatial expression patterns support the potential role of OfOsp in ovarian development during the pupal and adult stages (Figure 1).

2.2. Mutagenesis of OfOsp Using CRISPR/Cas9

OfOsp contains 22 exons and 21 introns (Figure 2A). CRISPR/Cas9-mediated mutagenesis was used to investigate the functionality of OfOsp in O. furnacalis. Two sgRNAs targeting two different positions on exons 1 and 4 of OfOsp were designed, and the positions of the sgRNAs on these exons are illustrated in Figure 2A. We injected 347 eggs with Cas9 protein and the two sgRNAs and obtained a 61.64% hatching rate and a 28.42% mutation rate in the treated eggs. All insertions or deletions resulted in premature stop codons, leading to truncation or loss of function of the OfOsp protein. The female mutants had a 989 bp fragment missing from exons 1 to 4, whereas male mutants showed a deletion of 976 bp from exons 1 to 4, producing an N-terminal truncated OfOsp protein (Figure 2B). DNA from molted OfOsp mutants and wildtype individuals was extracted and sequenced, demonstrating that OfOsp was successfully mutated (Figure 2C). Using primers flanking the two target sites at exons 1 and 4 in mutant and WT adults, the resultant banding pattern further indicated that OfOsp was successfully mutated (Figure 2D).

2.3. Phenotypic and Physiological Impacts Experienced by OfOsp Mutants

2.3.1. Phenotypic Impacts on Internal Genitalia

The genitalia of wildtype and OfOsp mutant O. furnacalis adults were dissected to observe the phenotypic changes associated with mutagenesis. The ovaries and testes of mutant O. furnacalis adults, together with those from wildtype groups, were dissected on the third day post-eclosion (Figure 3). Wildtype females possessed ovaries supplemented with four pairs of oviducts that were localized on two sides (Figure 3A). As expected, female OfOspF mutants had severe malformations of the ovaries, having one oviduct missing on one side, leaving seven oviducts remaining (Figure 3B), with a closeup view of the oviducts shown in Figure 3D. Additionally, we observed only two pairs of oviducts that were shortened relative to the wildtype females and generated fewer or smaller eggs within the oviducts of OfOspF compared to the wildtypes (Figure 3C). The ovaries of OfOspF mutants also showed fused and shortened oviducts that either produced fewer eggs or failed to develop normally (Figure 3C). Male OfOsp mutants presented normal phenotypes with no phenotypic changes observed compared to the wildtypes (Figure 3E,F).

2.3.2. Effects of OfOsp Mutagenesis on Fertility and Fecundity

Ovary development is important for the fertility and fecundity of female adults. To investigate if OfOsp mutagenesis leads to adult sterility, the fecundity and hatching rates of both mutant and wildtype O. furnacalis were recorded continuously for ten days after pairing individuals with wildtype individuals of the opposite sex. In wildtype pairings, females laid an average of 483 ± 34 eggs within the ten-day period. OfOspF mutants laid an average of 113 ± 16 eggs within the ten-day period, which is significantly decreased compared to wildtype females. Wildtype females paired with OfOsp mutant males laid 340 ± 65 eggs within the ten-day period, which was not significantly different from pure wildtype pairings (Figure 4A). The hatching rate of eggs laid by OfOsp female and male mutants showed no significant differences in comparison to the wildtypes (Figure 4B).

2.4. Pleiotropic Effects of OfOsp Mutagenesis

Given that Vitellogenin (Vg) and Vitellogenin receptor (VgR) are associated with the process of vitellogenesis in insects [36], we examined the relative transcript levels of Vg and VgR in the ovaries of O. furnacalis after OfOsp mutagenesis. The relative transcript level of pipe was also examined in OfOsp mutants, where pipe was significantly upregulated in OfOspF mutants by 3.08-fold compared to the wildtypes (Figure 5A). The results showed that Vg was upregulated by 2.72-fold when normalized to the wildtypes after OfOsp mutagenesis (Figure 5B). The relative transcript level of VgR was not changed (Figure 5C). In Drosophila, Pipe together with Nudel are required for embryonic dorsal–ventral polarity [37]. We also further verified the transcript levels of OfOsp in the ovaries of OfOspF mutants, which were significantly decreased compared to the wildtypes (Figure 5D).

3. Discussion

3.1. Identification and Characterization of OfOsp

Nudel is expressed during oogenesis and is essential for egg development after fertilization [33]. In lepidopterans, Osp was first analyzed as a homolog to Drosophila Nudel in B. mori and S. litura [31]. Mutagenesis of OSP in these two species causes abnormal development in the ovaries and female sterility [31] (Figure S1). Using the published O. furnacalis genome [35], we identified a homologous Osp protein that shares 70.61% of its identity with the B. mori Osp, and phylogenetic analysis supports that Osp is highly conserved among lepidopteran insects (Figure S1).
Osp is highly expressed in the ovaries of female pupae and adults in lepidopteran insects [31]. In our study, temporal, and spatial expression patterns of OfOsp were analyzed to show its increased expression in the ovarian tissues of female adults, supporting its essential role in germ line formation and oogenesis during embryonic development (Figure 1A). Temporal expression verified the expression level of OfOsp in different developmental stages, showing that OfOsp is highly expressed in the fourth- and fifth-instar larvae, female pupae, and female adults of O. furnacalis (Figure 1B).

3.2. Mutagenesis of OfOsp Using CRISPR/Cas9 Gene Editing System

The specificity and flexibility of the CRISPR/Cas9 system allows precise editing of genes that would benefit strategies for pest management. In the mosquito Anopheles gambiae, using CRISPR/Cas9 to function as a gene drive system, three putative female fertility-related genes were identified and targeted to successfully suppress mosquito populations that transmit malaria [32]. S. frugiperda was disrupted through embryonic microinjection of Cas9 protein and in vitro-transcribed sgRNAs targeting doublesex, leading to impaired ovaries and testes in adults and an inheritable reduction in fertility and fecundity [38]. Our results show that mutagenesis of OfOsp results in missing and malformed oviducts, with oviducts in some cases fusing together, disabling their ability to produce normal eggs (Figure 3). In B. mori, knockout of Osp leads to irregular oviducts and shorter and shrunken oviducts in mutants [31]. Our results have further verified the functional role of Osp in ovarian development and oogenesis in lepidopterans.

3.3. Phenotypic Impacts among OfOsp Mutants

Regulating and disrupting the secretion of proteins from insect reproductive glands as a means of pest control has become a new strategy in the field of insect infertility technology. Gligorov and colleagues discovered that the absence of Abd-B in D. melanogaster resulted in disruption of the ability of females to re-mate with males and to lay eggs when mating with mutated male individuals [39]. Similarly, knockout of Abd-A and Ubx leads to defects in wing formation and reduced reproductivity in O. furnacalis [40]. Other potential targets for SIT to control O. furnacalis are Masc and doublesex, the mutagenesis of which leads to reduced fecundity and fertility [24]. Our results have identified an additional target to control O. furnacalis via the release of mutant males that carry a mutated OfOsp to mate with females in the wild. In this study, we observed the development of abnormal ovaries in female OfOsp mutants and normal testes in males (Figure 3). As a result, the fertility of female, not male, mutants is significantly decreased after OfOsp knockdown (Figure 4), indicating the functional role of OfOsp in ovarian development and oogenesis. This result is inconsistent with the results for B. mori and S. litura, in which knockdown of Osp significantly reduces fertility [31].
Insect oogenesis requires expression of a variety of genes. Pipe is required in the somatic tissue of Drosophila egg chambers and defines embryonic dorsal–ventral polarity [37]. We first examined the relative expression of OfOsp in the dissected ovaries in OfOsp mutants and found that knockout of OfOsp significantly decreases the expression of OfOsp (Figure 5D). Since Osp and Pipe are products of dorsal-group genes that play key roles in spatially regulating the protease cascade involved in controlling embryonic patterning and polarity in Drosophila [41], we examined the relative transcript levels of pipe and found that they were upregulated in OfOspF mutants compared to the wildtypes (Figure 5A). Previous studies have reported that the Pipe gene is highly expressed in the ovaries of Drosophila [37]. Our results have further indicated its complementary role in oogenesis alongside Osp.
RNAi targeting Vg and VgR in Diaphorina citri Kuwayama leads to disturbed formation of eggs and suppresses oviposition by adults [42]. We examined the relative transcript levels of Vg and VgR in the dissected ovaries of OfOsp mutants. The transcript level of Vg was upregulated 3.04-fold in comparison to the wildtypes (Figure 5), indicating its role in ovary development as complementary to OfOsp. Our results are in accordance with the known role of Vg as being responsible for the formation of yolk proteins in insect eggs [43]. As Vg transcripts accumulated in the ovaries of Culex quinquefasciatus [44], the altered upregulation of Vg in our study has further verified its essential role in the ovarian development.

4. Materials and Methods

4.1. Insect Rearing and Sexing

The O. furnacalis strain used in this study was collected from corn in Qipanshan County, Shenyang City, Liaoning Province, China (123.471097,41.68383) and was kept in laboratory conditions at a temperature of 25 °C with a relative humidity of 70%, light intensity of 1000 lx, and a photoperiod of 16:8 h L:D. O. furnacalis larvae were fed with a standard lepidopteran artificial diet made with yeast extract, wheat bran, vitamin C, sucrose, and agar, as described previously, every two days [38]. Pupae were sexed for pairing post-eclosion, and adults were kept in rectangular-shaped metal rearing cages supplemented with cotton balls, which were soaked with 10% honey water to allow for mating and egg laying.

4.2. Cloning and Characterization of OfOsp

4.2.1. Cloning of OfOsp

To obtain the coding sequence of OfOsp (XM_028323031), we performed a BLAST search using B. mori Nudel (GenBank: NM_001043703.1) against the O. furnacalis genome in NCBI. Total RNA from a fifth-instar O. furnacalis larva was extracted using TRIeasy reagent (Yeasen, China) to amplify the full length of OfOsp. The extracted RNA was then reverse transcribed into cDNA using the PrimeScriptTM Reverse Transcription Kit (Takara, Japan) using 1µg of total RNA as a template. The full-length sequence of OfOsp was 5648 bp in length, encoding 1873 amino acids. Primers were designed to amplify 1500–2000 bp fragments of Osp ORF and the full-length sequence was assembled from the resulting sequencing data. After sequencing (Genewiz biotech company, Suzhou, China), the full-length sequence of OfOsp was constructed and verified before designing sgRNAs. All primers were designed using primer3 (https://primer3.ut.ee (accessed on 1 May 2000)).

4.2.2. Phylogenetic Analysis of OfOsp

Osp ORFs used in the phylogenetic analysis included the OfOsp identified in this study, and other Osps from B. mori (NP_001037168.1), H. armigera (XP_021187246.1), P. xylostella (XP_011552048.1), S. frugiperda (XP_035438721.2), D. melanogaster (NM_079223.2), O. abietinus (XP_012280703.1), C. cinctus (XP_015603565.1), N. vespilloides (XP_017777496.1), T. castaneum (XP_015840900.1), and M. persicae (XP_022174293.1). Osp ORFs were aligned with ClustalW and the resultant phylogenetic tree was constructed using the neighbor-joining (N-J) method using MEGAX. In addition, p-distance model was selected for the substitution model. Finally, to assess the robustness of the tree, we carried out a bootstrap analysis with 1000 replicates [45,46].

4.3. CRISPR/Cas9-Mediated Mutagenesis

4.3.1. Synthesis of OfOsp sgRNA In Vitro

Two target sites were selected on exons 1 and 4 of OfOsp. The length of all sgRNA target sequences was 20 base pairs, and their specificity was confirmed through sequencing. sgRNA was subcloned and ligated into a pJET1.2 vector (ThermoFisher Scientific, USA), with the protospacer adjacent motif (PAM) sequence located upstream. sgRNA was synthesized in vitro using a MEGAScript T7 Kit (Ambion, Austin, TX, USA). TrueCutTM Cas9 protein (Invitrogen, Carlsbad, CA, USA) was purchased and stored at −80 °C.

4.3.2. Microinjection of sgRNAs and Detection of OfOsp Mutagenesis

To collect eggs for microinjection, the newly emerged O. furnacalis adults were sexed and paired in a plastic bag. Eggs were collected within 1 h of being laid for microinjection under a microscope (Olympus ZSX16, Tokyo, Japan). The microinjection system used in this study was FemtoJet-4i (Eppendorf, Hamburg, Germany) under a microscope (Olympus ZSX16, Tokyo, Japan). Borosilicate Glass Capillaries, with an inner diameter of 0.58 mm, an outer diameter of 1.0 mm, and a length of 10 cm (World Precision Instruments, Sarasota, FL, USA), were used as the needle to deliver a mixture of 300 ng/μL Cas9 protein and 300 ng/μL sgRNA. After injection, eggs were incubated at 28 °C for about 2 days until hatching and later transferred to sterilized containers supplemented with an artificial diet containing yeast extract, wheat bran, vitamin C, sucrose, and agar [38]. All insects were kept under the same rearing condition as described above.
To verify Osp knockout in O. furnacalis, pupal shells were collected for sequence analysis. Specifically, genomic DNA was extracted using the phenol –chloroform method and precipitated with sodium acetate isopropanol in conjunction with proteinase K (ThermoFisher Scientific, Waltham, MA, USA). Primers targeting the flanking regions of the two target sites were designed to detect gene knockout, and amplification was performed using Hieff Canace Gold High-Fidelity DNA Polymerase (Yeasen, China). Reaction conditions were as follows: pre-denaturation at 98 °C for 3 min; 35 cycles of denaturation at 98 °C for 10 s each, annealing at 55 °C for 20 s, and extension at 72 °C for 30 s; and final extension at 72 °C for 30 s. PCR products were then ligated into a pJET1.2 vector (ThermoFisher Scientific, Waltham, MA, USA) and sent for sequencing by the Genewiz Biotech Company (Suzhou, China).

4.4. Phenotypic Observation after Mutagenesis

The phenotypic impact of OfOsp knockout on the morphology of virgin adults was observed through dissection using a micro-imaging system (KEYENCE VHX7000, Osaka, Japan). The number of injected eggs, hatching rate of eggs, pupation rate, mutation rate, and sex ratio of eclosed adults were also recorded and are summarized in Table 2.
To investigate whether mutagenesis of Osp interferes with the fecundity and fertility of O. furnacalis, two-day old virgin OfOsp mutant adults were collected and paired with the opposite-sex wildtype adults. Specifically, wildtype females were paired with wildtype males, female OfOsp mutants were paired with wildtype males, and male OfOsp mutants were paired with wildtype females. Each O. furnacalis pair was placed in a transparent PVC bag to allow for mating and oviposition. During this period, eggs laid by each pair were observed and recorded on a daily basis for a 10-day assay period. The hatching rate was recorded for each pair as well. Experiments were performed in three replicates with 5–20 pairs per treatment.

4.5. Real-Time Quantitative PCR (RT-qPCR)

To study the expression levels of OfOsp across different developmental stages and body parts of O. furnacalis, total RNA was extracted from eggs, larvae at instars 1 to 5, female and male pupae, and female and male adults using Trizol reagent (Invitrogen, USA). For spatial expression analysis, tissue was collected from heads, thoraxes (with no legs and wings), legs, forewings, hindwings, abdominal epidermis, fat bodies, ovaries, and external genitalia, and total RNA was extracted. A PrimeScriptTM Reverse Transcription Kit (Takara, Japan) was used to synthesize cDNA from 2 μg of total RNA as the template. Quantitative real-time PCR using OfOsp gene-specific primers (Table 1) was performed to examine the spatiotemporal expression patterns of OfOsp, and OfRPS3 (GenBank: EU275206.2), a suitable reference gene for O. furnacalis, was used as the internal control [47]. The reaction conditions included pre-denaturation at 95 °C for 30 s, followed by 40 cycles of denaturation at 95 °C for 5 s each, annealing at 58 °C for 30 s, and extension at 72 °C for 30 s.
To investigate if OfOsp mutagenesis interferes with the transcript levels of other genes, including Pipe (GenBank: XM_028307755.1), Vg (GenBank: QIH04838.1), and VgR (GenBank: QIG55527.1), total RNA was extracted from wildtype O. furnacalis and mutant individuals using Trizol reagent (Invitrogen, Carlsbad, CA, USA). According to the manufacturer’s instructions, 2 μg of total RNA was used as the template, and cDNA was synthesized using a PrimeScriptTM Reverse Transcription Kit (Takara, Japan). The relative gene expression was calculated following the 2-ΔΔCq method [48].

4.6. Statistical Analysis

Statistical analysis of all data was performed using IBM SPSS statistics 22 using a two-tailed t-test. Data were represented as the means ± SEM in all cases. p < 0.05 was considered a significant difference between treatments and controls.

5. Conclusions

In this study, the functionality of OfOsp was characterized using CRISPR/Cas9-mediated mutagenesis. Our results support our hypothesis that OfOsp is vital for ovarian development and oogenesis in O. furnacalis. Given its role in reproduction and the female-specific nature of its mutagenesis, OfOsp represents a potential molecular target for future SIT-based control of this global maize pest.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/ijms242216311/s1: Figure S1: Phylogenetic analysis of Osp amino acid sequences in multiple insect species.

Author Contributions

Conceptualization, Q.Z.; methodology, Z.J., J.G. and P.Z.; software, Z.J. and J.G.; validation. J.G. and Q.Z.; formal analysis, X.Z. and P.Z.; investigation, A.M.; resources, Q.Z.; data curation, A.M., Q.Z. and J.G; writing—original draft preparation, Q.Z.; writing—review and editing, A.M., Q.Z. and X.Z.; visualization, Q.Z. and J.G.; supervision, Q.Z. and X.Z.; project administration, Q.Z.; funding acquisition, Q.Z. and X.Z., who also oversaw the entire project and revised and edited manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by grants from the National Natural Science Foundation of China (32072482) and the Young Scholars’ Fund from the Department of Education of Liaoning Province (LSNQN202017) to Z.Q.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

All the data and resources generated for this study are included in the article and the Supplementary Materials.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Nafus, D.M.; Schreiner, I.H. Review of the biology and control of the Asian corn borer, Ostrinia furnacalis (Lep: Pyralidae). Trop. Pest Manag. 1991, 37, 41–56. [Google Scholar] [CrossRef]
  2. Mutuura, A.; Munroe, E. Taxonomy and distribution of the European corn borer and allied species: Genus Ostrinia (Lepidoptera: Pyralidae). Mem. Entomol. Soc. Canada 1970, 102, 1–112. [Google Scholar] [CrossRef]
  3. Afidchao, M.M.; Musters, C.J.; de Snoo, G.R. Asian corn borer (ACB) and non-ACB pests in GM corn (Zea mays L.) in the Philippines. Pest Manag. Sci. 2013, 69, 792–801. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, R.Z.; Klein, M.G.; Li, Q.Y.; Li, L.B.; Li, P.P.; Sheng, C.F. Do second generation Asia corn borer (Lepidoptera: Crambidae) immigrate to corn fields from alternate habitats? J. Asia-Pacific. Entomol. 2015, 18, 687–693. [Google Scholar] [CrossRef]
  5. Chen, C.; Aldridge, R.L.; Gibson, S.; Kline, J.; Aryaprema, V.; Qualls, W.; Xue, R.D.; Boardman, L.; Linthicum, K.J.; Hahn, D.A. Developing the radiation-based sterile insect technique (SIT) for controlling Aedes aegypti: Identification of a sterilizing dose. Pest Manag Sci. 2023, 79, 1175–1183. [Google Scholar] [CrossRef]
  6. Shen, X.J.; Guo, J.L.; Yang, X.M.; Wei, S.J.; Wu, K.M. Stable Isotopes Indicate Seasonal Changes in Natal Geographic Origins and Host Plants of Ostrinia furnacalis (Guenee) Migrants Across the Bohai Strait in China. J. Econo. Entomol. 2023, 116, 136–143. [Google Scholar] [CrossRef]
  7. Myint, Y.Y.; Bai, S.X.; Zhang, T.T.; Babendreier, D.; He, K.L.; Wang, Z.Y. Selection of the Most Effective Trichogramma Strains (Hymenoptera:Trichogrammatidae) From Myanmar to Control Asian Corn Borer, Ostrinia furnacalis (Lepidoptera: Crambidae). J. Economic. Entomol. 2022, 115, 81–92. [Google Scholar] [CrossRef]
  8. Munkvold, G.P.; Hellmich, R.L.; Rice, L.G. Comparison of Fumonisin Concentrations in Kernels of Transgenic Bt Maize Hybrids and Nontransgenic Hybrids. Plant Dis. 1999, 83, 130–138. [Google Scholar] [CrossRef]
  9. Shabbir, M.Z.; Zhang, T.T.; Wang, Z.Y.; He, K.L. Transcriptome and Proteome Alternation With Resistance to Bacillus thuringiensis Cry1Ah Toxin in Ostrinia furnacalis. Front. Physiol. 2019, 10, 27. [Google Scholar] [CrossRef]
  10. Jin, T.; Chang, X.; Gatehouse, A.M.; Wang, Z.; Edwards, M.G.; He, K. Downregulation and mutation of a cadherin gene associated with Cry1Ac resistance in the asian corn borer, Ostrinia furnacalis (guenee). Toxins 2014, 6, 2676–2693. [Google Scholar] [CrossRef]
  11. Zhang, T.T.; He, M.X.; Gatehouse, A.M.R.; Wang, Z.Y.; Edwards, M.G.; Li, Q.; He, K.L. Inheritance Patterns, Dominance and Cross-Resistance of Cry1Ab-and Cry1Ac-Selected Ostrinia furnacalis (Guenee). Toxins 2014, 6, 2694–2707. [Google Scholar] [CrossRef] [PubMed]
  12. Gilles, J.R.L.; Schetelig, M.F.; Scolari, F.; Marec, F.; Capurro, M.L.; Franz, G.; Bourtzis, K. Towards mosquito sterile insect technique programmes: Exploring genetic, molecular, mechanical and behavioural methods of sex separation in mosquitoes. Acta Tropica 2014, 132, S178–S187. [Google Scholar] [CrossRef] [PubMed]
  13. Papathanos, P.A.; Bossin, H.C.; Benedict, M.Q.; Catteruccia, F.; Malcolm, C.A.; Alphey, L.; Crisanti, A. Sex separation strategies: Past experience and new approaches. Malaria J. 2009, 8, S5. [Google Scholar] [CrossRef]
  14. Labbe, G.M.C.; Scaife, S.; Morgan, S.A.; Curtis, Z.H.; Alphey, L. Female-Specific Flightless (fsRIDL) Phenotype for Control of Aedes albopictus. PLoS Neglected Trop. Dis. 2012, 6, e1724. [Google Scholar] [CrossRef]
  15. Thomas, D.D.; Donnelly, C.A.; Wood, R.J.; Alphey, L.S. Insect population control using a dominat, repressible, lethal genetic system. Science 2000, 287, 2474–2476. [Google Scholar] [CrossRef] [PubMed]
  16. Alphey, L. Genetic control of mosquitoes. New Biotech. 2016, 33, S30. [Google Scholar] [CrossRef]
  17. Ahmadi, M.; Salehi, B.; Abd-Alla, A.M.M.; Babaie, M. Feasibility of using the radiation-based sterile insect technique (SIT) to control the olive fruit fly, Bactrocera oleae Gmelin (Diptera: Tephritidae) in Iran. Appl. Radiat. Isot. 2018, 139, 279–284. [Google Scholar] [CrossRef]
  18. Zhang, J.H.; Li, N.; Zhao, H.Y.; Wang, Y.Q.; Yang, X.Q.; Wu, K.M. Sterility of Cydia pomonella by X ray irradiation as an alternative to gamma radiation for the sterile insect technique. Bulletin. Entomol. Res. 2023, 113, 72–78. [Google Scholar] [CrossRef]
  19. Deutscher, A.T.; Chapman, T.A.; Shuttleworth, L.A.; Riegler, M.; Reynolds, O.L. Tephritid-microbial interactions to enhance fruit fly performance in sterile insect technique programs. BMC Microbiol. 2019, 19 (Suppl. 1), 287. [Google Scholar] [CrossRef]
  20. Sicard, M.; Bonneau, M.; Weill, M. Wolbachia prevalence, diversity, and ability to induce cytoplasmic incompatibility in mosquitoes. Curr. Opin. Insect Sci. 2019, 34, 12–20. [Google Scholar] [CrossRef]
  21. Tan, A.J.; Fu, G.L.; Jin, L.; Guo, Q.H.; Li, Z.Q.; Niu, B.L.; Meng, Z.Q.; Morrison, N.I.; Alphey, L.; Huang, Y.P. Transgene-based, female-specific lethality system for genetic sexing of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2013, 110, 6766–6770. [Google Scholar] [CrossRef] [PubMed]
  22. Chen, X.; Cao, Y.H.; Zhan, S.; Tan, A.J.; Palli, S.R.; Huang, Y.P. Disruption of sex-specific doublesex exons results in male- and female-specific defects in the black cutworm, Agrotis ipsilon. Pest Manag. Sci. 2019, 75, 1697–1706. [Google Scholar] [CrossRef]
  23. You, L.; Bi, H.L.; Wang, Y.H.; Li, X.W.; Chen, X.E.; Li, Z.Q. CRISPR/Cas9-based mutation reveals Argonaute 1 is essential for pigmentation in Ostrinia furnacalis. Insect Sci. 2019, 26, 1020–1028. [Google Scholar] [CrossRef]
  24. Bi, H.L.; Li, X.W.; Xu, X.; Wang, Y.H.; Zhou, S.T.; Huang, Y.P. Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis. Cells 2022, 11, 2161. [Google Scholar] [CrossRef] [PubMed]
  25. Page, M.J.; Di Cera, E. Serine peptidases: Classification, structure and function. Cell Mol. Life Sci. 2008, 65, 1220–1236. [Google Scholar] [CrossRef]
  26. Veillard, F.; Troxler, L.; Reichhart, J.M. Drosophila melanogaster clip-domain serine proteases: Structure, function and regulation. Biochimie 2016, 122, 255–269. [Google Scholar] [CrossRef]
  27. Salicioni, A.M.; Gervasi, M.G.; Sosnik, J.; Tourzani, D.A.; Nayyab, S.; Caraballo, D.A.; Visconti, P.E. Testis-specific serine kinase protein family in male fertility and as targets for non-hormonal male contraception. Biol. Reprod. 2020, 103, 264–274. [Google Scholar] [CrossRef] [PubMed]
  28. Scovell, J.M.; Bournat, J.C.; Szafran, A.T.; Solis, M.; Moore, J.; Rivera, A.; Chen, C.H.; Zhang, J.; Wilken, N.; Seth, A.; et al. PRSS50 is a testis protease responsible for proper sperm tail formation and function. Development 2021, 148, dev197558. [Google Scholar] [CrossRef] [PubMed]
  29. LaFlamme, B.A.; Ram, K.R.; Wolfner, M.F. The Drosophila melanogaster Seminal Fluid Protease “Seminase” Regulates Proteolytic and Post-Mating Reproductive Processes. PLoS Genet. 2012, 8, e1002435. [Google Scholar] [CrossRef]
  30. Bi, H.L.; Xu, X.; Li, X.W.; Wang, Y.H.; Zhou, S.T.; Huang, Y.P. CRISPR/Cas9-mediated Serine protease 2 disruption induces male sterility in Spodoptera litura. Front. Physiol. 2022, 13, 931824. [Google Scholar] [CrossRef]
  31. Xu, X.; Bi, H.L.; Wang, Y.H.; Li, X.W.; Xu, J.; Liu, Z.L.; He, L.; Li, K.; Huang, Y.P. Disruption of the ovarian serine protease (Osp) gene causes female sterility in Bombyx mori and Spodoptera litura. Pest Manag. Sci. 2020, 76, 1245–1255. [Google Scholar] [CrossRef] [PubMed]
  32. Hammond, A.; Galizi, R.; Kyrou, K.; Simoni, A.; Siniscalchi, C.; Katsanos, D.; Gribble, M.; Baker, D.; Marois, E.; Russell, S.; et al. A CRISPR-Cas9 gene drive system-targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nat. Biotechnol. 2016, 34, 78–83. [Google Scholar] [CrossRef] [PubMed]
  33. Hong, C.C.; Hashimoto, C. The maternal Nude1 protein of Drosophila has two distinct roles important for embryogenesis. Genetics 1996, 143, 1653–1661. [Google Scholar] [CrossRef] [PubMed]
  34. LeMosy, E.K.; Leclerc, C.L.; Hashimoto, C. Biochemical defects of mutant nudel alleles causing early developmental arrest or dorsalization of the Drosophila embryo. Genetics 2000, 154, 247–257. [Google Scholar] [CrossRef]
  35. Fang, G.; Zhang, Q.; Cao, Y.; Wang, Y.; Qi, M.; Wu, N.; Qian, L.; Zhu, C.; Huang, Y.; Zhan, S.; et al. The draft genome of the Asian corn borer yields insights into ecological adaptation of a devastating maize pest. Insect Biochem. Mol. Biol. 2021, 138, 103638. [Google Scholar] [CrossRef]
  36. Wu, H.; Jiang, F.-Z.; Guo, J.-X.; Yi, J.-Q.; Liu, J.-B.; Cao, Y.-S.; Lai, X.-S.; Zhang, G.-R. Molecular Characterization and Expression of Vitellogenin and Vitellogenin Receptor of Thitarodes pui (Lepidoptera: Hepialidae), an Insect on the Tibetan Plateau. J. Insect Sci. 2018, 18, 23. [Google Scholar] [CrossRef]
  37. Sen, J.; Goltz, J.S.; Stevens, L.; Stein, D. Spatially Restricted Expression of pipe in the Drosophila Egg Chamber Defines Embryonic Dorsal–Ventral Polarity. Cell 1998, 95, 471–481. [Google Scholar] [CrossRef]
  38. Gu, J.W.; Wang, J.Y.; Bi, H.L.; Li, X.H.; Merchant, A.; Zhang, P.R.; Zhang, Q.; Zhou, X.G. CRISPR/Cas9-Mediated Mutagenesis of Sex-Specific Doublesex Splicing Variants Leads to Sterility in Spodoptera frugiperda, a Global Invasive Pest. Cells 2022, 11, 3557. [Google Scholar] [CrossRef]
  39. Gligorov, D.; Sitnik, J.L.; Maeda, R.K.; Wolfner, M.F.; Karch, F. A novel function for the Hox gene Abd-B in the male accessory gland regulates the long-term female post-mating response in Drosophila. PLoS Genet. 2013, 9, e1003395. [Google Scholar] [CrossRef]
  40. Bi, H.L.; Merchant, A.; Gu, J.W.; Li, X.W.; Zhou, X.G.; Zhang, Q. CRISPR/Cas9-Mediated Mutagenesis of Abdominal-A and Ultrabithorax in the Asian Corn Borer, Ostrinia furnacalis. Insects 2022, 13, 384. [Google Scholar] [CrossRef]
  41. Shubha Govind, R.S. Dorsoventral pattern formation in Drosophila: Signal transduction and nuclear targeting. Trends Genet. 1991, 4, 119–125. [Google Scholar] [CrossRef]
  42. Li, H.L.; Mo, J.L.; Wang, X.Y.; Pan, B.Q.; Xu, S.; Li, S.R.; Zheng, X.L.; Lu, W. IPS (In-Plant System) Delivery of Double-Stranded Vitellogenin and Vitellogenin receptor via Hydroponics for Pest Control in Diaphorina citri Kuwayama (Hemiptera: Psyllidae). Int. J. Mol. Sci. 2023, 24, 9497. [Google Scholar] [CrossRef]
  43. Yang, C.; Lin, Y.; Shen, G.; Chen, E.; Wang, Y.; Luo, J.; Zhang, H.; Xing, R.; Xia, Q. Female qualities in males: Vitellogenin synthesis induced by ovary transplants into the male silkworm, Bombyx mori. Biochem. Biophys. Res. Commun. 2014, 453, 31–36. [Google Scholar] [CrossRef] [PubMed]
  44. Moura, A.S.; Costa-da-Silva, A.L.; Peixoto, P.S.; Maciel, C.; Cardoso, A.F. Vitellogenin genes are transcribed in Culex quinquefasciatus ovary. Memorias. Do. Instituto. Oswaldo. Cruz. 2023, 118, e220143. [Google Scholar] [CrossRef] [PubMed]
  45. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, D. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
  46. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
  47. Fan, Y.H.; Abbas, M.; Liu, X.J.; Wang, Y.L.; Song, H.F.; Li, T.; Ma, E.B.; Zhu, K.Y.; Zhang, J.Z. Increased RNAi Efficiency by dsEGFP-Induced Up-Regulation of Two Core RNAi Pathway Genes (OfDicer2 and OfAgo2) in the Asian Corn Borer (Ostrinia furnacalis). Insects 2022, 13, 274. [Google Scholar] [CrossRef] [PubMed]
  48. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Figure 1. The temporal and spatial distributions of OfOsp. Data are shown as the mean ± SEM (n = 3). (A) The temporal distribution of OfOsp in eggs at 12 h, 24 h, 48 h and 72 h, larvae at instars 1 to 5, female and male pupae, and female and male adults was examined. (B) The spatial expression analysis from tissues of heads, thoraxes (with no legs and wings), legs, forewings, hindwings, abdominal epidermis, fat bodies, ovaries, and external genitalia was examined. One-way ANOVA in SPSS statistics 22 was used for data analysis. “ns” stands for “not significant” (p > 0.05). The asterisks (* and ***) indicate significant differences (p < 0.05 and p < 0.001).
Figure 1. The temporal and spatial distributions of OfOsp. Data are shown as the mean ± SEM (n = 3). (A) The temporal distribution of OfOsp in eggs at 12 h, 24 h, 48 h and 72 h, larvae at instars 1 to 5, female and male pupae, and female and male adults was examined. (B) The spatial expression analysis from tissues of heads, thoraxes (with no legs and wings), legs, forewings, hindwings, abdominal epidermis, fat bodies, ovaries, and external genitalia was examined. One-way ANOVA in SPSS statistics 22 was used for data analysis. “ns” stands for “not significant” (p > 0.05). The asterisks (* and ***) indicate significant differences (p < 0.05 and p < 0.001).
Ijms 24 16311 g001
Figure 2. Design of sgRNAs and mutagenesis of OfOsp using CRISPR/Cas9 system. (A) The design of sgRNAs targeting exons 1 and 4 of OfOsp. (B) The number of base pairs deleted in the edited sequences (indicated in parentheses). PAM sequences are highlighted in red. “Δ989 bp” refers to the number of base pairs deleted after gene knockout. (C) Target sites of OfOsp using CRISPR/Cas9 system in male and female O. furnacalis (labeled with red arrows). (D) Fragments corresponding to Osp mutants and WT in genomic DNA amplified using PCR and resolved with agarose gel electrophoresis.
Figure 2. Design of sgRNAs and mutagenesis of OfOsp using CRISPR/Cas9 system. (A) The design of sgRNAs targeting exons 1 and 4 of OfOsp. (B) The number of base pairs deleted in the edited sequences (indicated in parentheses). PAM sequences are highlighted in red. “Δ989 bp” refers to the number of base pairs deleted after gene knockout. (C) Target sites of OfOsp using CRISPR/Cas9 system in male and female O. furnacalis (labeled with red arrows). (D) Fragments corresponding to Osp mutants and WT in genomic DNA amplified using PCR and resolved with agarose gel electrophoresis.
Ijms 24 16311 g002
Figure 3. Malformations of ovaries and testes in adult OfOsp mutants. The ovaries of wildtype O. furnacalis and OfOspF and OfOspM mutant individuals were dissected on the third day post-eclusion (PAE3). (A) Ovary dissected from female wildtype. (B) Ovary dissected from female OfOsp-1 mutant. (C) Ovary dissected from female OfOsp-2 mutant. (D) Enlargement of the oviducts from OfOsp-1 mutant. (E) Testes dissected from male wildtype. (F) Testes dissected from OfOsp-1 male mutant. White arrows indicate defects in the ovaries. Scale bar: 1 mm.
Figure 3. Malformations of ovaries and testes in adult OfOsp mutants. The ovaries of wildtype O. furnacalis and OfOspF and OfOspM mutant individuals were dissected on the third day post-eclusion (PAE3). (A) Ovary dissected from female wildtype. (B) Ovary dissected from female OfOsp-1 mutant. (C) Ovary dissected from female OfOsp-2 mutant. (D) Enlargement of the oviducts from OfOsp-1 mutant. (E) Testes dissected from male wildtype. (F) Testes dissected from OfOsp-1 male mutant. White arrows indicate defects in the ovaries. Scale bar: 1 mm.
Ijms 24 16311 g003
Figure 4. Physiological impacts of OfOsp mutagenesis. (A) Fecundity of adult mutants of OfOsp paired with opposite gender of wildtype are shown. (B) The hatching rates of eggs laid by OfOsp female and OfOsp male comparing with wildtypes. Data are shown as the mean ± SEM (n = 5–20), and one-way ANOVA in SPSS statistics 22 was used for data analysis. “ns” stands for “not significant” (p > 0.05). The asterisks (***) indicate significant differences (p < 0.0001). The orange circles indicate the value of each replicate recorded for fecundity and hatching rate.
Figure 4. Physiological impacts of OfOsp mutagenesis. (A) Fecundity of adult mutants of OfOsp paired with opposite gender of wildtype are shown. (B) The hatching rates of eggs laid by OfOsp female and OfOsp male comparing with wildtypes. Data are shown as the mean ± SEM (n = 5–20), and one-way ANOVA in SPSS statistics 22 was used for data analysis. “ns” stands for “not significant” (p > 0.05). The asterisks (***) indicate significant differences (p < 0.0001). The orange circles indicate the value of each replicate recorded for fecundity and hatching rate.
Ijms 24 16311 g004
Figure 5. Relative expressions of Pipe, Vg, VgR, and OfOsp after OfOsp mutagenesis. The relative transcript levels of Pipe (A), Vg (B) and VgR (C), and OfOsp (D) were examined in ovaries of OfOsp female mutants comparing with that in the female ovaries of wildtype . Data are shown as the mean ± SEM (n = 4–5), and one-way ANOVA in SPSS statistics 22 was used for data analysis. The orange circles indicate values of relative expression of Pipe (A), Vg (B) and VgR (C), and OfOsp (D) normalized to OfRPS3, the internal reference gene calculated by 2-ΔΔCq method. “ns” stands for “not significant” (p > 0.05). The asterisks (*, ** and ***) indicate significant differences (p < 0.05, p < 0.01 and p < 0.001) between mutants and wildtypes.
Figure 5. Relative expressions of Pipe, Vg, VgR, and OfOsp after OfOsp mutagenesis. The relative transcript levels of Pipe (A), Vg (B) and VgR (C), and OfOsp (D) were examined in ovaries of OfOsp female mutants comparing with that in the female ovaries of wildtype . Data are shown as the mean ± SEM (n = 4–5), and one-way ANOVA in SPSS statistics 22 was used for data analysis. The orange circles indicate values of relative expression of Pipe (A), Vg (B) and VgR (C), and OfOsp (D) normalized to OfRPS3, the internal reference gene calculated by 2-ΔΔCq method. “ns” stands for “not significant” (p > 0.05). The asterisks (*, ** and ***) indicate significant differences (p < 0.05, p < 0.01 and p < 0.001) between mutants and wildtypes.
Ijms 24 16311 g005
Table 1. Primers used in this study.
Table 1. Primers used in this study.
Primer NamePrimer Sequence (5’-3’)
Preparation of sgRNA templates
OSP_SITE1_FTAATACGACTCACTATAGGATGCAATTGGATACGGTGGTTTTAGAGCTAGAAATAGCAA
OSP_SITE2_FTAATACGACTCACTATAGGATACTTCGATTGCCCTTTGTTTTAGAGCTAGAAATAGCAA
R80AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA
Identification of mutations
OFOSP-SITE1-checkFTGACACTGGCTTTGTAATGA
OFOSP-SITE1-checkRATATCCTGTGTTTGGAGCAT
OFOSP-SITE2-checkFTGGAAAGTGATATGAGCAGA
OFOSP-SITE2-checkRTTACGGGATTATTGTGAAGG
OSP_FULL_checkF2AGGACAAGCCAAGCAAAG
OSP_FULL_checkR2TTCCAAGCGATCAAGAGT
RT-qPCR
Osp_Q_FTGGCTGATCTTCGTGGTCTT
Osp_Q_RCCCGTCATGCTTATTGGCTC
OFVG1-F1CTTCTACCCCACCCACATGT
OFVG1-R1ACCATTTGTCTGCGGAGGTA
OFVgR-F1AGACGACTGTGTAATGGCCA
OFVgR-R1ATCGTCGCAGTCCTCATGAT
Pipe-FAGACGCTGTTCTTCTGTGGA
Pipe-RTGTGTTCAGCTCCTCCCAAT
Osf-RPS3-F1CTGTACGCTGAGAAAGTCGC
Osf-RPS3-R1AACTTCATCGACTTGGCACG
Cloning of OfOsp
Osp-F1-225GCATCCTGTAGTGGTACCTGA
Osp-R1-1775CGGTGATTCTGCTCTTGTGG
Osp-F2-1413CGGAAGAAACAAGCGCTTTC
Osp-R2-3116ACATTGCTCTCACCAGTAATCT
Osp-F4-3094AATGTAGATGACGAGAGTG
Osp-R4-5402AAGCCCAATTCCCTGCAAA
Osp-F5-4056TCTATTGTACAGCCGAGCAGT
Osp-R5-5535CGTGGCTGTTTCTAAGTTTC
Table 2. Statistics of Osp knockout in O. furnacalis.
Table 2. Statistics of Osp knockout in O. furnacalis.
sgRNAInjectedHatchedPupate (F/M)Adult (F/M)MutantMutation Rate
OfOsp34732 (61.64%)134 (59.82%)95 (38/57)2728.42%
GFP431384 (89.1%)147 (76/71)130 (67/63)00
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, P.; Jialaliding, Z.; Gu, J.; Merchant, A.; Zhang, Q.; Zhou, X. Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. Int. J. Mol. Sci. 2023, 24, 16311. https://doi.org/10.3390/ijms242216311

AMA Style

Zhang P, Jialaliding Z, Gu J, Merchant A, Zhang Q, Zhou X. Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. International Journal of Molecular Sciences. 2023; 24(22):16311. https://doi.org/10.3390/ijms242216311

Chicago/Turabian Style

Zhang, Porui, Zuerdong Jialaliding, Junwen Gu, Austin Merchant, Qi Zhang, and Xuguo Zhou. 2023. "Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis" International Journal of Molecular Sciences 24, no. 22: 16311. https://doi.org/10.3390/ijms242216311

APA Style

Zhang, P., Jialaliding, Z., Gu, J., Merchant, A., Zhang, Q., & Zhou, X. (2023). Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. International Journal of Molecular Sciences, 24(22), 16311. https://doi.org/10.3390/ijms242216311

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop