Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis
Abstract
:1. Introduction
2. Results
2.1. Cloning and Characterization of OfOsp
2.1.1. Cloning of OfOsp
2.1.2. Phylogenetic Analysis
2.1.3. Temporal–Spatial Distribution of OfOsp
2.2. Mutagenesis of OfOsp Using CRISPR/Cas9
2.3. Phenotypic and Physiological Impacts Experienced by OfOsp Mutants
2.3.1. Phenotypic Impacts on Internal Genitalia
2.3.2. Effects of OfOsp Mutagenesis on Fertility and Fecundity
2.4. Pleiotropic Effects of OfOsp Mutagenesis
3. Discussion
3.1. Identification and Characterization of OfOsp
3.2. Mutagenesis of OfOsp Using CRISPR/Cas9 Gene Editing System
3.3. Phenotypic Impacts among OfOsp Mutants
4. Materials and Methods
4.1. Insect Rearing and Sexing
4.2. Cloning and Characterization of OfOsp
4.2.1. Cloning of OfOsp
4.2.2. Phylogenetic Analysis of OfOsp
4.3. CRISPR/Cas9-Mediated Mutagenesis
4.3.1. Synthesis of OfOsp sgRNA In Vitro
4.3.2. Microinjection of sgRNAs and Detection of OfOsp Mutagenesis
4.4. Phenotypic Observation after Mutagenesis
4.5. Real-Time Quantitative PCR (RT-qPCR)
4.6. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Nafus, D.M.; Schreiner, I.H. Review of the biology and control of the Asian corn borer, Ostrinia furnacalis (Lep: Pyralidae). Trop. Pest Manag. 1991, 37, 41–56. [Google Scholar] [CrossRef]
- Mutuura, A.; Munroe, E. Taxonomy and distribution of the European corn borer and allied species: Genus Ostrinia (Lepidoptera: Pyralidae). Mem. Entomol. Soc. Canada 1970, 102, 1–112. [Google Scholar] [CrossRef]
- Afidchao, M.M.; Musters, C.J.; de Snoo, G.R. Asian corn borer (ACB) and non-ACB pests in GM corn (Zea mays L.) in the Philippines. Pest Manag. Sci. 2013, 69, 792–801. [Google Scholar] [CrossRef] [PubMed]
- Chen, R.Z.; Klein, M.G.; Li, Q.Y.; Li, L.B.; Li, P.P.; Sheng, C.F. Do second generation Asia corn borer (Lepidoptera: Crambidae) immigrate to corn fields from alternate habitats? J. Asia-Pacific. Entomol. 2015, 18, 687–693. [Google Scholar] [CrossRef]
- Chen, C.; Aldridge, R.L.; Gibson, S.; Kline, J.; Aryaprema, V.; Qualls, W.; Xue, R.D.; Boardman, L.; Linthicum, K.J.; Hahn, D.A. Developing the radiation-based sterile insect technique (SIT) for controlling Aedes aegypti: Identification of a sterilizing dose. Pest Manag Sci. 2023, 79, 1175–1183. [Google Scholar] [CrossRef]
- Shen, X.J.; Guo, J.L.; Yang, X.M.; Wei, S.J.; Wu, K.M. Stable Isotopes Indicate Seasonal Changes in Natal Geographic Origins and Host Plants of Ostrinia furnacalis (Guenee) Migrants Across the Bohai Strait in China. J. Econo. Entomol. 2023, 116, 136–143. [Google Scholar] [CrossRef]
- Myint, Y.Y.; Bai, S.X.; Zhang, T.T.; Babendreier, D.; He, K.L.; Wang, Z.Y. Selection of the Most Effective Trichogramma Strains (Hymenoptera:Trichogrammatidae) From Myanmar to Control Asian Corn Borer, Ostrinia furnacalis (Lepidoptera: Crambidae). J. Economic. Entomol. 2022, 115, 81–92. [Google Scholar] [CrossRef]
- Munkvold, G.P.; Hellmich, R.L.; Rice, L.G. Comparison of Fumonisin Concentrations in Kernels of Transgenic Bt Maize Hybrids and Nontransgenic Hybrids. Plant Dis. 1999, 83, 130–138. [Google Scholar] [CrossRef]
- Shabbir, M.Z.; Zhang, T.T.; Wang, Z.Y.; He, K.L. Transcriptome and Proteome Alternation With Resistance to Bacillus thuringiensis Cry1Ah Toxin in Ostrinia furnacalis. Front. Physiol. 2019, 10, 27. [Google Scholar] [CrossRef]
- Jin, T.; Chang, X.; Gatehouse, A.M.; Wang, Z.; Edwards, M.G.; He, K. Downregulation and mutation of a cadherin gene associated with Cry1Ac resistance in the asian corn borer, Ostrinia furnacalis (guenee). Toxins 2014, 6, 2676–2693. [Google Scholar] [CrossRef]
- Zhang, T.T.; He, M.X.; Gatehouse, A.M.R.; Wang, Z.Y.; Edwards, M.G.; Li, Q.; He, K.L. Inheritance Patterns, Dominance and Cross-Resistance of Cry1Ab-and Cry1Ac-Selected Ostrinia furnacalis (Guenee). Toxins 2014, 6, 2694–2707. [Google Scholar] [CrossRef] [PubMed]
- Gilles, J.R.L.; Schetelig, M.F.; Scolari, F.; Marec, F.; Capurro, M.L.; Franz, G.; Bourtzis, K. Towards mosquito sterile insect technique programmes: Exploring genetic, molecular, mechanical and behavioural methods of sex separation in mosquitoes. Acta Tropica 2014, 132, S178–S187. [Google Scholar] [CrossRef] [PubMed]
- Papathanos, P.A.; Bossin, H.C.; Benedict, M.Q.; Catteruccia, F.; Malcolm, C.A.; Alphey, L.; Crisanti, A. Sex separation strategies: Past experience and new approaches. Malaria J. 2009, 8, S5. [Google Scholar] [CrossRef]
- Labbe, G.M.C.; Scaife, S.; Morgan, S.A.; Curtis, Z.H.; Alphey, L. Female-Specific Flightless (fsRIDL) Phenotype for Control of Aedes albopictus. PLoS Neglected Trop. Dis. 2012, 6, e1724. [Google Scholar] [CrossRef]
- Thomas, D.D.; Donnelly, C.A.; Wood, R.J.; Alphey, L.S. Insect population control using a dominat, repressible, lethal genetic system. Science 2000, 287, 2474–2476. [Google Scholar] [CrossRef] [PubMed]
- Alphey, L. Genetic control of mosquitoes. New Biotech. 2016, 33, S30. [Google Scholar] [CrossRef]
- Ahmadi, M.; Salehi, B.; Abd-Alla, A.M.M.; Babaie, M. Feasibility of using the radiation-based sterile insect technique (SIT) to control the olive fruit fly, Bactrocera oleae Gmelin (Diptera: Tephritidae) in Iran. Appl. Radiat. Isot. 2018, 139, 279–284. [Google Scholar] [CrossRef]
- Zhang, J.H.; Li, N.; Zhao, H.Y.; Wang, Y.Q.; Yang, X.Q.; Wu, K.M. Sterility of Cydia pomonella by X ray irradiation as an alternative to gamma radiation for the sterile insect technique. Bulletin. Entomol. Res. 2023, 113, 72–78. [Google Scholar] [CrossRef]
- Deutscher, A.T.; Chapman, T.A.; Shuttleworth, L.A.; Riegler, M.; Reynolds, O.L. Tephritid-microbial interactions to enhance fruit fly performance in sterile insect technique programs. BMC Microbiol. 2019, 19 (Suppl. 1), 287. [Google Scholar] [CrossRef]
- Sicard, M.; Bonneau, M.; Weill, M. Wolbachia prevalence, diversity, and ability to induce cytoplasmic incompatibility in mosquitoes. Curr. Opin. Insect Sci. 2019, 34, 12–20. [Google Scholar] [CrossRef]
- Tan, A.J.; Fu, G.L.; Jin, L.; Guo, Q.H.; Li, Z.Q.; Niu, B.L.; Meng, Z.Q.; Morrison, N.I.; Alphey, L.; Huang, Y.P. Transgene-based, female-specific lethality system for genetic sexing of the silkworm, Bombyx mori. Proc. Natl. Acad. Sci. USA 2013, 110, 6766–6770. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Cao, Y.H.; Zhan, S.; Tan, A.J.; Palli, S.R.; Huang, Y.P. Disruption of sex-specific doublesex exons results in male- and female-specific defects in the black cutworm, Agrotis ipsilon. Pest Manag. Sci. 2019, 75, 1697–1706. [Google Scholar] [CrossRef]
- You, L.; Bi, H.L.; Wang, Y.H.; Li, X.W.; Chen, X.E.; Li, Z.Q. CRISPR/Cas9-based mutation reveals Argonaute 1 is essential for pigmentation in Ostrinia furnacalis. Insect Sci. 2019, 26, 1020–1028. [Google Scholar] [CrossRef]
- Bi, H.L.; Li, X.W.; Xu, X.; Wang, Y.H.; Zhou, S.T.; Huang, Y.P. Masculinizer and Doublesex as Key Factors Regulate Sexual Dimorphism in Ostrinia furnacalis. Cells 2022, 11, 2161. [Google Scholar] [CrossRef] [PubMed]
- Page, M.J.; Di Cera, E. Serine peptidases: Classification, structure and function. Cell Mol. Life Sci. 2008, 65, 1220–1236. [Google Scholar] [CrossRef]
- Veillard, F.; Troxler, L.; Reichhart, J.M. Drosophila melanogaster clip-domain serine proteases: Structure, function and regulation. Biochimie 2016, 122, 255–269. [Google Scholar] [CrossRef]
- Salicioni, A.M.; Gervasi, M.G.; Sosnik, J.; Tourzani, D.A.; Nayyab, S.; Caraballo, D.A.; Visconti, P.E. Testis-specific serine kinase protein family in male fertility and as targets for non-hormonal male contraception. Biol. Reprod. 2020, 103, 264–274. [Google Scholar] [CrossRef] [PubMed]
- Scovell, J.M.; Bournat, J.C.; Szafran, A.T.; Solis, M.; Moore, J.; Rivera, A.; Chen, C.H.; Zhang, J.; Wilken, N.; Seth, A.; et al. PRSS50 is a testis protease responsible for proper sperm tail formation and function. Development 2021, 148, dev197558. [Google Scholar] [CrossRef] [PubMed]
- LaFlamme, B.A.; Ram, K.R.; Wolfner, M.F. The Drosophila melanogaster Seminal Fluid Protease “Seminase” Regulates Proteolytic and Post-Mating Reproductive Processes. PLoS Genet. 2012, 8, e1002435. [Google Scholar] [CrossRef]
- Bi, H.L.; Xu, X.; Li, X.W.; Wang, Y.H.; Zhou, S.T.; Huang, Y.P. CRISPR/Cas9-mediated Serine protease 2 disruption induces male sterility in Spodoptera litura. Front. Physiol. 2022, 13, 931824. [Google Scholar] [CrossRef]
- Xu, X.; Bi, H.L.; Wang, Y.H.; Li, X.W.; Xu, J.; Liu, Z.L.; He, L.; Li, K.; Huang, Y.P. Disruption of the ovarian serine protease (Osp) gene causes female sterility in Bombyx mori and Spodoptera litura. Pest Manag. Sci. 2020, 76, 1245–1255. [Google Scholar] [CrossRef] [PubMed]
- Hammond, A.; Galizi, R.; Kyrou, K.; Simoni, A.; Siniscalchi, C.; Katsanos, D.; Gribble, M.; Baker, D.; Marois, E.; Russell, S.; et al. A CRISPR-Cas9 gene drive system-targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nat. Biotechnol. 2016, 34, 78–83. [Google Scholar] [CrossRef] [PubMed]
- Hong, C.C.; Hashimoto, C. The maternal Nude1 protein of Drosophila has two distinct roles important for embryogenesis. Genetics 1996, 143, 1653–1661. [Google Scholar] [CrossRef] [PubMed]
- LeMosy, E.K.; Leclerc, C.L.; Hashimoto, C. Biochemical defects of mutant nudel alleles causing early developmental arrest or dorsalization of the Drosophila embryo. Genetics 2000, 154, 247–257. [Google Scholar] [CrossRef]
- Fang, G.; Zhang, Q.; Cao, Y.; Wang, Y.; Qi, M.; Wu, N.; Qian, L.; Zhu, C.; Huang, Y.; Zhan, S.; et al. The draft genome of the Asian corn borer yields insights into ecological adaptation of a devastating maize pest. Insect Biochem. Mol. Biol. 2021, 138, 103638. [Google Scholar] [CrossRef]
- Wu, H.; Jiang, F.-Z.; Guo, J.-X.; Yi, J.-Q.; Liu, J.-B.; Cao, Y.-S.; Lai, X.-S.; Zhang, G.-R. Molecular Characterization and Expression of Vitellogenin and Vitellogenin Receptor of Thitarodes pui (Lepidoptera: Hepialidae), an Insect on the Tibetan Plateau. J. Insect Sci. 2018, 18, 23. [Google Scholar] [CrossRef]
- Sen, J.; Goltz, J.S.; Stevens, L.; Stein, D. Spatially Restricted Expression of pipe in the Drosophila Egg Chamber Defines Embryonic Dorsal–Ventral Polarity. Cell 1998, 95, 471–481. [Google Scholar] [CrossRef]
- Gu, J.W.; Wang, J.Y.; Bi, H.L.; Li, X.H.; Merchant, A.; Zhang, P.R.; Zhang, Q.; Zhou, X.G. CRISPR/Cas9-Mediated Mutagenesis of Sex-Specific Doublesex Splicing Variants Leads to Sterility in Spodoptera frugiperda, a Global Invasive Pest. Cells 2022, 11, 3557. [Google Scholar] [CrossRef]
- Gligorov, D.; Sitnik, J.L.; Maeda, R.K.; Wolfner, M.F.; Karch, F. A novel function for the Hox gene Abd-B in the male accessory gland regulates the long-term female post-mating response in Drosophila. PLoS Genet. 2013, 9, e1003395. [Google Scholar] [CrossRef]
- Bi, H.L.; Merchant, A.; Gu, J.W.; Li, X.W.; Zhou, X.G.; Zhang, Q. CRISPR/Cas9-Mediated Mutagenesis of Abdominal-A and Ultrabithorax in the Asian Corn Borer, Ostrinia furnacalis. Insects 2022, 13, 384. [Google Scholar] [CrossRef]
- Shubha Govind, R.S. Dorsoventral pattern formation in Drosophila: Signal transduction and nuclear targeting. Trends Genet. 1991, 4, 119–125. [Google Scholar] [CrossRef]
- Li, H.L.; Mo, J.L.; Wang, X.Y.; Pan, B.Q.; Xu, S.; Li, S.R.; Zheng, X.L.; Lu, W. IPS (In-Plant System) Delivery of Double-Stranded Vitellogenin and Vitellogenin receptor via Hydroponics for Pest Control in Diaphorina citri Kuwayama (Hemiptera: Psyllidae). Int. J. Mol. Sci. 2023, 24, 9497. [Google Scholar] [CrossRef]
- Yang, C.; Lin, Y.; Shen, G.; Chen, E.; Wang, Y.; Luo, J.; Zhang, H.; Xing, R.; Xia, Q. Female qualities in males: Vitellogenin synthesis induced by ovary transplants into the male silkworm, Bombyx mori. Biochem. Biophys. Res. Commun. 2014, 453, 31–36. [Google Scholar] [CrossRef] [PubMed]
- Moura, A.S.; Costa-da-Silva, A.L.; Peixoto, P.S.; Maciel, C.; Cardoso, A.F. Vitellogenin genes are transcribed in Culex quinquefasciatus ovary. Memorias. Do. Instituto. Oswaldo. Cruz. 2023, 118, e220143. [Google Scholar] [CrossRef] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, D. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [PubMed]
- Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar] [CrossRef] [PubMed]
- Fan, Y.H.; Abbas, M.; Liu, X.J.; Wang, Y.L.; Song, H.F.; Li, T.; Ma, E.B.; Zhu, K.Y.; Zhang, J.Z. Increased RNAi Efficiency by dsEGFP-Induced Up-Regulation of Two Core RNAi Pathway Genes (OfDicer2 and OfAgo2) in the Asian Corn Borer (Ostrinia furnacalis). Insects 2022, 13, 274. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]





| Primer Name | Primer Sequence (5’-3’) |
|---|---|
| Preparation of sgRNA templates | |
| OSP_SITE1_F | TAATACGACTCACTATAGGATGCAATTGGATACGGTGGTTTTAGAGCTAGAAATAGCAA |
| OSP_SITE2_F | TAATACGACTCACTATAGGATACTTCGATTGCCCTTTGTTTTAGAGCTAGAAATAGCAA |
| R80 | AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA |
| Identification of mutations | |
| OFOSP-SITE1-checkF | TGACACTGGCTTTGTAATGA |
| OFOSP-SITE1-checkR | ATATCCTGTGTTTGGAGCAT |
| OFOSP-SITE2-checkF | TGGAAAGTGATATGAGCAGA |
| OFOSP-SITE2-checkR | TTACGGGATTATTGTGAAGG |
| OSP_FULL_checkF2 | AGGACAAGCCAAGCAAAG |
| OSP_FULL_checkR2 | TTCCAAGCGATCAAGAGT |
| RT-qPCR | |
| Osp_Q_F | TGGCTGATCTTCGTGGTCTT |
| Osp_Q_R | CCCGTCATGCTTATTGGCTC |
| OFVG1-F1 | CTTCTACCCCACCCACATGT |
| OFVG1-R1 | ACCATTTGTCTGCGGAGGTA |
| OFVgR-F1 | AGACGACTGTGTAATGGCCA |
| OFVgR-R1 | ATCGTCGCAGTCCTCATGAT |
| Pipe-F | AGACGCTGTTCTTCTGTGGA |
| Pipe-R | TGTGTTCAGCTCCTCCCAAT |
| Osf-RPS3-F1 | CTGTACGCTGAGAAAGTCGC |
| Osf-RPS3-R1 | AACTTCATCGACTTGGCACG |
| Cloning of OfOsp | |
| Osp-F1-225 | GCATCCTGTAGTGGTACCTGA |
| Osp-R1-1775 | CGGTGATTCTGCTCTTGTGG |
| Osp-F2-1413 | CGGAAGAAACAAGCGCTTTC |
| Osp-R2-3116 | ACATTGCTCTCACCAGTAATCT |
| Osp-F4-3094 | AATGTAGATGACGAGAGTG |
| Osp-R4-5402 | AAGCCCAATTCCCTGCAAA |
| Osp-F5-4056 | TCTATTGTACAGCCGAGCAGT |
| Osp-R5-5535 | CGTGGCTGTTTCTAAGTTTC |
| sgRNA | Injected | Hatched | Pupate (F/M) | Adult (F/M) | Mutant | Mutation Rate |
|---|---|---|---|---|---|---|
| OfOsp | 347 | 32 (61.64%) | 134 (59.82%) | 95 (38/57) | 27 | 28.42% |
| GFP | 431 | 384 (89.1%) | 147 (76/71) | 130 (67/63) | 0 | 0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, P.; Jialaliding, Z.; Gu, J.; Merchant, A.; Zhang, Q.; Zhou, X. Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. Int. J. Mol. Sci. 2023, 24, 16311. https://doi.org/10.3390/ijms242216311
Zhang P, Jialaliding Z, Gu J, Merchant A, Zhang Q, Zhou X. Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. International Journal of Molecular Sciences. 2023; 24(22):16311. https://doi.org/10.3390/ijms242216311
Chicago/Turabian StyleZhang, Porui, Zuerdong Jialaliding, Junwen Gu, Austin Merchant, Qi Zhang, and Xuguo Zhou. 2023. "Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis" International Journal of Molecular Sciences 24, no. 22: 16311. https://doi.org/10.3390/ijms242216311
APA StyleZhang, P., Jialaliding, Z., Gu, J., Merchant, A., Zhang, Q., & Zhou, X. (2023). Knockout of ovary serine protease Leads to Ovary Deformation and Female Sterility in the Asian Corn Borer, Ostrinia furnacalis. International Journal of Molecular Sciences, 24(22), 16311. https://doi.org/10.3390/ijms242216311

