RETRACTED: Beta-Caryophyllene, a Plant-Derived CB2 Receptor Agonist, Protects SH-SY5Y Cells from Cadmium-Induced Toxicity
Abstract
:1. Introduction
2. Results
2.1. BCP Treatment Does Not Influence SH-SY5Y Cell Viability
2.2. BCP Protects SH-SY5Y Cells from the Damage Induced by CdCl2
2.3. BCP Reduces Intracellular ROS Production
2.4. BCP Treatment Inhibits Cell Death and Reduces Pro-Inflammatory Cytokines Expression following CdCl2 Stimulation
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. Cell Treatment
4.3. MTT Assay
4.4. Hematoxylin/Eosin Staining
4.5. Evaluation of Apoptosis with Terminal Deoxynucleotidyl Transferase dUTP Nick End Labeling (TUNEL) Assay
4.6. Morphometric Evaluation
4.7. Measurement of ROS Production
4.8. RNA Isolation, cDNA Synthesis, and Real-Time Quantitative PCR Amplification
4.9. Western Blot Analysis
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jaishankar, M.; Tseten, T.; Anbalagan, N.; Mathew, B.B.; Beeregowda, K.N. Toxicity, mechanism and health effects of some heavy metals. Interdiscip. Toxicol. 2014, 7, 60–72. [Google Scholar] [CrossRef]
- Tchounwou, P.B.; Yedjou, C.G.; Patlolla, A.K.; Sutton, D.J. Heavy metal toxicity and the environment. Exp. Suppl. 2012, 101, 133–164. [Google Scholar] [PubMed]
- World Health Organization; International Atomic Energy Agency & Food; Agriculture Organization of the United Nations. Trace Elements in Human Nutrition and Health. World Health Organization. 1996. Available online: https://apps.who.int/iris/handle/10665/37931 (accessed on 17 October 2023).
- Chang, L.W.; Magos, L.; Suzuki, T. (Eds.) Toxicology of Metals; CRC Press: Boca Raton, FL, USA, 1996. [Google Scholar]
- Jiale, C.; Chao, Z.; Jinzhao, R.; Chunhua, Z.; Ying, G. Cadmium Bioavailability and Accumulation in Rice Grain are Controlled by pH and Ca in Paddy Soils with High Geological Background of Transportation and Deposition. Bull. Environ. Contam. Toxicol. 2021, 106, 92–98. [Google Scholar] [CrossRef] [PubMed]
- Genchi, G.; Sinicropi, M.S.; Lauria, G.; Carocci, A.; Catalano, A. The Effects of Cadmium Toxicity. Int. J. Environ. Res. Public Health 2020, 17, 3782. [Google Scholar] [CrossRef]
- Tallkvist, J.; Bowlus, C.L.; Lonnerdal, B. DMT1 gene expression and cadmium absorption in human absorptive enterocytes. Toxicol. Lett. 2001, 122, 171–177. [Google Scholar] [CrossRef] [PubMed]
- Amzal, B.; Julin, B.; Vahter, M.; Wolk, A.; Johanson, G.; Akesson, A. Population toxicokinetic modeling of cadmium for health risk assessment. Environ. Health Perspect. 2009, 117, 1293–1301. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Wu, W.; Gong, B.; Hou, L.; Dong, X.; Xu, C.; Zhao, R.; Yu, Q.; Zhou, Z.; Huang, S.; et al. Metformin attenuates cadmium-induced neuronal apoptosis in vitro via blocking ROS-dependent PP5/AMPK-JNK signaling pathway. Neuropharmacology 2020, 175, 108065. [Google Scholar] [CrossRef]
- Chen, L.; Xu, B.; Liu, L.; Luo, Y.; Zhou, H.; Chen, W.; Shen, T.; Han, X.; Kontos, C.D.; Huang, S. Cadmium induction of reactive oxygen species activates the mTOR pathway, leading to neuronal cell death. Free Radic. Biol. Med. 2011, 50, 624–632. [Google Scholar] [CrossRef]
- Chin-Chan, M.; Navarro-Yepes, J.; Quintanilla-Vega, B. Environmental pollutants as risk factors for neurodegenerative disorders: Alzheimer and Parkinson diseases. Front. Cell. Neurosci. 2015, 9, 124. [Google Scholar] [CrossRef]
- Tönnies, E.; Trushina, E. Oxidative Stress, Synaptic Dysfunction, and Alzheimer’s Disease. J. Alzheimers Dis. 2017, 57, 1105–1121. [Google Scholar] [CrossRef]
- Li, X.; Lv, Y.; Yu, S.; Zhao, H.; Yao, L. The effect of cadmium on Abeta levels in APP/PS1 transgenic mice. Exp. Ther. Med. 2012, 4, 125–130. [Google Scholar] [CrossRef] [PubMed]
- Stohs, S.J.; Bagchi, D. Oxidative mechanisms in the toxicity of metal ions. Free Radic. Biol. Med. 1995, 18, 321–336. [Google Scholar] [CrossRef] [PubMed]
- Mitra, R.S. Protein synthesis in Escherichia coli during recovery from exposure to low levels of Cd2+. Appl. Environ. Microbiol. 1984, 47, 1012–1016. [Google Scholar] [CrossRef] [PubMed]
- Belyaeva, E.A.; Dymkowska, D.; Wieckowski, M.R.; Wotczak, L. Reactive oxygen species produced by the mitochondrial respiratory chain are involved in Cd2+-induced injury of rat ascites hepatoma AS-30D cells. Biochim. Biophys. Acta 2006, 1757, 1568–1574. [Google Scholar] [CrossRef] [PubMed]
- Chatterjee, S.; Kundu, S.; Bhattacharyya, A. Mechanism of cadmium induced apoptosis in the immunocyte. Toxicol. Lett. 2008, 177, 83–89. [Google Scholar] [CrossRef] [PubMed]
- Nemmiche, S.; Chabane-Sari, D.; Guiraud, P. Role of alpha-tocopherol in cadmium-induced oxidative stress in Wistar rat’s blood, liver and brain. Chem. Biol. Interact. 2007, 170, 221–230. [Google Scholar] [CrossRef]
- Abdel Moneim, A.E.; Bauomy, A.A.; Diab, M.M.; Shata, M.T.; Al-Olayan, E.M.; El-Khadragy, M.F. The protective effect of Physalis peruviana L. against cadmium-induced neurotoxicity in rats. Biol. Trace Elem. Res. 2014, 160, 392–399. [Google Scholar] [CrossRef]
- Rafati Rahimzadeh, M.; Rafati Rahimzadeh, M.; Kazemi, S.; Moghadamnia, A.A. Cadmium toxicity and treatment: An update. Casp. J. Intern. Med. 2017, 8, 135–145. [Google Scholar]
- Atalay, S.; Jarocka-Karpowicz, I.; Skrzydlewska, E. Antioxidative and Anti-Inflammatory Properties of Cannabidiol. Antioxidants 2019, 9, 21. [Google Scholar] [CrossRef]
- Lutz, B. Neurobiology of cannabinoid receptor signaling. Dialogues Clin. Neurosci. 2020, 22, 207–222. [Google Scholar] [CrossRef]
- Irrera, N.; D’Ascola, A.; Pallio, G.; Bitto, A.; Mazzon, E.; Mannino, F.; Squadrito, V.; Arcoraci, V.; Minutoli, L.; Campo, G.M.; et al. β-Caryophyllene Mitigates Collagen Antibody Induced Arthritis (CAIA) in Mice Through a Cross-Talk between CB2 and PPAR-γ Receptors. Biomolecules 2019, 9, 326. [Google Scholar] [CrossRef] [PubMed]
- Machado, K.D.C.; Islam, M.T.; Ali, E.S.; Rouf, R.; Uddin, S.J.; Dev, S.; Shilpi, J.A.; Shill, M.C.; Reza, H.M.; Das, A.K.; et al. A systematic review on the neuroprotective perspectives of beta-caryophyllene. Phytother. Res. 2018, 32, 2376–2388. [Google Scholar] [CrossRef] [PubMed]
- Espinosa-Ahedo, B.A.; Madrigal-Bujaidar, E.; Sánchez-Gutiérrez, M.; Izquierdo-Vega, J.A.; Morales-González, J.A.; Madrigal-Santillán, E.O.; Álvarez-González, I. Potential protective effect of beta-caryophyllene against cadmium chloride-induced damage to the male reproductive system in mouse. Reprod. Toxicol. 2022, 110, 19–30. [Google Scholar] [CrossRef] [PubMed]
- Srivastava, S.; Pant, A.; Trivedi, S.; Pandey, R. Curcumin and β-caryophellene attenuate cadmium quantum dots induced oxidative stress and lethality in Caenorhabditis elegans model system. Environ. Toxicol. Pharmacol. 2016, 42, 55–62. [Google Scholar] [CrossRef]
- Mannino, F.; Pallio, G.; Corsaro, R.; Minutoli, L.; Altavilla, D.; Vermiglio, G.; Allegra, A.; Eid, A.H.; Bitto, A.; Squadrito, F.; et al. Beta-Caryophyllene Exhibits Anti-Proliferative Effects through Apoptosis Induction and Cell Cycle Modulation in Multiple Myeloma Cells. Cancers 2021, 13, 5741. [Google Scholar] [CrossRef] [PubMed]
- Min, J.; Min, K.B. Blood Cadmium chloride levels and Alzheimer’s disease mortality risk in older US adults. Environ. Health 2016, 15, 69. [Google Scholar] [CrossRef]
- Wang, B.; Du, Y. Cadmium chloride and its neurotoxic effects. Oxidative Med. Cell. Longev. 2013, 2013, 898034. [Google Scholar] [CrossRef]
- Yuan, Y.; Zhang, Y.; Zhao, S.; Chen, J.; Yang, J.; Wang, T.; Zou, H.; Wang, Y.; Gu, J.; Liu, X.; et al. Cadmium-induced apoptosis in neuronal cells is mediated by Fas/FasL-mediated mitochondrial apoptotic signaling pathway. Sci. Rep. 2018, 8, 8837. [Google Scholar] [CrossRef]
- Huang, Y.; Dai, Y.; Li, M.; Guo, L.; Cao, C.; Huang, Y.; Ma, R.; Qiu, S.; Su, X.; Zhong, K.; et al. Exposure to cadmium induces neuroinflammation and impairs ciliogenesis in hESC-derived 3D cerebral organoids. Sci. Total Environ. 2021, 797, 149043. [Google Scholar] [CrossRef]
- Branca, J.J.V.; Fiorillo, C.; Carrino, D.; Paternostro, F.; Taddei, N.; Gulisano, M.; Pacini, A.; Becatti, M. Cadmium-Induced oxidative stress: Focus on the central nervous system. Antioxidants 2020, 9, 492. [Google Scholar] [CrossRef]
- Javed, H.; Azimullah, S.; Haque, M.E.; Ojha, S.K. Cannabinoid Type 2 (CB2) Receptors Activation Protects against Oxidative Stress and Neuroinflammation Associated Dopaminergic Neurodegeneration in Rotenone Model of Parkinson’s Disease. Front. Neurosci. 2016, 10, 321. [Google Scholar] [CrossRef] [PubMed]
- Hashiesh, H.M.; Sharma, C.; Goyal, S.N.; Sadek, B.; Jha, N.K.; Kaabi, J.A.; Ojha, S. A focused review on CB2 receptor-selective pharmacological properties and therapeutic potential of β-caryophyllene, a dietary cannabinoid. Biomed. Pharmacother. 2021, 140, 111639. [Google Scholar] [CrossRef] [PubMed]
- Murphy, M.P. Mitochondrial dysfunction indirectly elevates ROS production by the endoplasmic reticulum. Cell Metab. 2013, 18, 145–146. [Google Scholar] [CrossRef]
- Ghosh, A.P.; Klocke, B.J.; Ballestas, M.E.; Roth, K.A. CHOP Potentially Co-Operates with FOXO3a in neuronal cells to regulate PUMA and BIM expression in response to ER stress. PLoS ONE 2012, 7, e39586. [Google Scholar] [CrossRef] [PubMed]
- Klegeris, A.; Bissonnette, C.J.; McGeer, P.L. Reduction of human monocytic cell neurotoxicity and cytokine secretion by ligands of the cannabinoid-type CB2 receptor. Br. J. Pharmacol. 2003, 139, 775–786. [Google Scholar] [CrossRef] [PubMed]
- Vrechi, T.A.M.; Leão, A.H.F.F.; Morais, I.B.M.; Abílio, V.C.; Zuardi, A.W.; Hallak, J.E.C.; Crippa, J.A.; Bincoletto, C.; Ureshino, R.P.; Smaili, S.S.; et al. Cannabidiol induces autophagy via ERK1/2 activation in neural cells. Sci. Rep. 2021, 11, 5434. [Google Scholar] [CrossRef]
- Viscomi, M.T.; Oddi, S.; Latini, L.; Bisicchia, E.; Maccarrone, M.; Molinari, M. The endocannabinoid system: A new entry in remote cell death mechanisms. Exp. Neurol. 2010, 224, 56–65. [Google Scholar] [CrossRef]
- Al Olayan, E.M.; Aloufi, A.S.; AlAmri, O.D.; El-Habit, O.H.; Abdel Moneim, A.E. Protocatechuic acid mitigates cadmium-induced neurotoxicity in rats: Role of oxidative stress, inflammation and apoptosis. Sci. Total Environ. 2020, 723, 137969. [Google Scholar] [CrossRef] [PubMed]
- Namgyal, D.; Ali, S.; Mehta, R.; Sarwat, M. The neuroprotective effect of curcumin against Cd-induced neurotoxicity and hippocampal neurogenesis promotion through CREB-BDNF signaling pathway. Toxicology 2020, 442, 152542. [Google Scholar] [CrossRef]
- Almeer, R.S.; Kassab, R.B.; AlBasher, G.I.; Alarifi, S.; Alkahtani, S.; Ali, D.; Abdel Moneim, A.E. Royal jelly mitigates cadmium-induced neuronal damage in mouse cortex. Mol. Biol. Rep. 2019, 46, 119–131. [Google Scholar] [CrossRef] [PubMed]
- Alnahdi, H.S.; Sharaf, I.A. Possible prophylactic effect of omega-3 fatty acids on cadmium-induced neurotoxicity in rats’ brains. Environ. Sci. Pollut. Res. Int. 2019, 26, 31254–31262. [Google Scholar] [CrossRef] [PubMed]
- Elkhadragy, M.F.; Kassab, R.B.; Metwally, D.; Almeer, R.S.; Abdel-Gaber, R.; Al-Olayan, E.M.; Essawy, E.A.; Amin, H.K.; Abdel Moneim, A.E. Protective effects of Fragaria ananassa methanolic extract in a rat model of cadmium chloride-induced neurotoxicity. Biosci. Rep. 2018, 38, BSR20180861. [Google Scholar] [CrossRef] [PubMed]
- Branca, J.J.V.; Morucci, G.; Maresca, M.; Tenci, B.; Cascella, R.; Paternostro, F.; Ghelardini, C.; Gulisano, M.; Di Cesare Mannelli, L.; Pacini, A. Selenium and zinc: Two key players against cadmium-induced neuronal toxicity. Toxicol. In Vitro 2018, 48, 159–169. [Google Scholar] [CrossRef] [PubMed]
- Picciolo, G.; Mannino, F.; Irrera, N.; Altavilla, D.; Minutoli, L.; Vaccaro, M.; Arcoraci, V.; Squadrito, V.; Picciolo, G.; Squadrito, F.; et al. PDRN, a natural bioactive compound, blunts inflammation and positively reprograms healing genes in an “in vitro” model of oral mucositis. Biomed. Pharmacother. 2021, 138, 111538. [Google Scholar] [CrossRef]
- Benvenga, S.; Marini, H.R.; Micali, A.; Freni, J.; Pallio, G.; Irrera, N.; Squadrito, F.; Altavilla, D.; Antonelli, A.; Ferrari, S.M.; et al. Protective Effects of Myo-Inositol and Selenium on Cadmium-Induced Thyroid Toxicity in Mice. Nutrients 2020, 12, 1222. [Google Scholar] [CrossRef]
- Mannino, F.; Imbesi, C.; Bitto, A.; Minutoli, L.; Squadrito, F.; D’Angelo, T.; Booz, C.; Pallio, G.; Irrera, N. Anti-oxidant and anti-inflammatory effects of ellagic and punicic acid in an in vitro model of cardiac fibrosis. Biomed. Pharmacother. 2023, 162, 114666. [Google Scholar] [CrossRef]
- Bitto, A.; Irrera, N.; Pizzino, G.; Pallio, G.; Mannino, F.; Vaccaro, M.; Arcoraci, V.; Aliquò, F.; Minutoli, L.; Colonna, M.R.; et al. Activation of the EPOR-β common receptor complex by cibinetide ameliorates impaired wound healing in mice with genetic diabetes. Biochim. Biophys. Acta Mol. Basis Dis. 2018, 1864, 632–639. [Google Scholar] [CrossRef]










| Gene | Sequence |
|---|---|
| β-Actin | Fw: 5′AGAGCTACGAGCTGCCTGAC3′ |
| Rw: 5′AGCACTGTGTTGGCGTACAG3′ | |
| IL-1β | Fw: 5′TGAGCTCGCCAGTGAAATGA3′ |
| Rw: 5′AGATTCGTAGCTGGATGCCG3′ | |
| TNF-α | Fw: 5′CAGAGGGCCTGTACCTCATC3′ |
| Rw: 5′GGAAGACCCCTCCCAGATAG3′ | |
| IL-6 | Fw: 5′TTCGGTCCAGTTGCCTTCTC3′ |
| Rw: 5′CAGCTCTGGCTTGTTCCTCA3′ |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mannino, F.; Pallio, G.; Imbesi, C.; Scarfone, A.; Puzzolo, D.; Micali, A.; Freni, J.; Squadrito, F.; Bitto, A.; Minutoli, L.; et al. RETRACTED: Beta-Caryophyllene, a Plant-Derived CB2 Receptor Agonist, Protects SH-SY5Y Cells from Cadmium-Induced Toxicity. Int. J. Mol. Sci. 2023, 24, 15487. https://doi.org/10.3390/ijms242015487
Mannino F, Pallio G, Imbesi C, Scarfone A, Puzzolo D, Micali A, Freni J, Squadrito F, Bitto A, Minutoli L, et al. RETRACTED: Beta-Caryophyllene, a Plant-Derived CB2 Receptor Agonist, Protects SH-SY5Y Cells from Cadmium-Induced Toxicity. International Journal of Molecular Sciences. 2023; 24(20):15487. https://doi.org/10.3390/ijms242015487
Chicago/Turabian StyleMannino, Federica, Giovanni Pallio, Chiara Imbesi, Alessandro Scarfone, Domenico Puzzolo, Antonio Micali, José Freni, Francesco Squadrito, Alessandra Bitto, Letteria Minutoli, and et al. 2023. "RETRACTED: Beta-Caryophyllene, a Plant-Derived CB2 Receptor Agonist, Protects SH-SY5Y Cells from Cadmium-Induced Toxicity" International Journal of Molecular Sciences 24, no. 20: 15487. https://doi.org/10.3390/ijms242015487
APA StyleMannino, F., Pallio, G., Imbesi, C., Scarfone, A., Puzzolo, D., Micali, A., Freni, J., Squadrito, F., Bitto, A., Minutoli, L., & Irrera, N. (2023). RETRACTED: Beta-Caryophyllene, a Plant-Derived CB2 Receptor Agonist, Protects SH-SY5Y Cells from Cadmium-Induced Toxicity. International Journal of Molecular Sciences, 24(20), 15487. https://doi.org/10.3390/ijms242015487

