ZIP Genes Are Involved in the Retransfer of Zinc Ions during the Senescence of Zinc-Deficient Rice Leaves
Abstract
:1. Introduction
2. Results
2.1. Zn Deficiency Inhibits Rice Seedling Shoot Growth and Development
2.2. Zn Deficiency Affects the Growth of the Fourth Rice Leaf
2.3. Zn Deficiency Alters the Root Architecture of Rice Seedlings
2.4. Zn Deficiency Affects Zn Ion Transfer during Senescence in the Fourth Rice Seedling Leaf
2.5. Transcriptome Response to Zn Deficiency
2.6. Biological Pathway Involvement in Zn Deficiency Treatment
2.7. Zn Ion Transport Genes Are Regulated Differently under Different Conditions
3. Discussion
4. Materials and Methods
4.1. Plant Material and Growth Conditions
4.2. Ion Analysis
4.3. Quantitative RT-PCR
4.4. RNA Sequencing
4.5. Data Analysis
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Thiébaut, N.; Hanikenne, M. Zinc deficiency responses: Bridging the gap between Arabidopsis and dicotyledonous crops. J. Exp. Bot. 2022, 73, 1699–1716. [Google Scholar] [CrossRef]
- Huang, S.; Yamaji, N.; Feng Ma, J. Zinc transport in rice: How to balance optimal plant requirements and human nutrition. J. Exp. Bot. 2022, 73, 1800–1808. [Google Scholar] [CrossRef]
- Skalny, A.V.; Aschner, M.; Tinkov, A.A. Zinc. Adv. Food Nutr. Res. 2021, 96, 251–310. [Google Scholar]
- Hussain, A.; Jiang, W.; Wang, X.; Shahid, S.; Saba, N.; Ahmad, M.; Dar, A.; Masood, S.U.; Imran, M.; Mustafa, A. Mechanistic impact of zinc deficiency in human development. Front. Nutr. 2022, 9, 717064. [Google Scholar] [CrossRef]
- Natasha, N.; Shahid, M.; Bibi, I.; Iqbal, J.; Khalid, S.; Murtaza, B.; Bakhat, H.F.; Farooq, A.B.U.; Amjad, M.; Hammad, H.M.; et al. Zinc in soil-plant-human system: A data-analysis review. Sci. Total Environ. 2022, 808, 152024. [Google Scholar] [CrossRef]
- Noulas, C.; Tziouvalekas, M.; Karyotis, T. Zinc in soils, water and food crops. J. Trace Elem. Med. Biol. 2018, 49, 252–260. [Google Scholar] [CrossRef]
- Shaoxia, W.; Meng, L.; Xiaoyuan, Z.; Peiwen, F.; Yanlong, C.; Jianglan, S.; Xiaohong, T. Impact of foliar and root application of phosphorus on zinc concentration of winter wheat grown in China. Crop Pasture Sci. 2019, 70, 499–508. [Google Scholar] [CrossRef]
- Read, T.L.; Doolette, C.L.; Li, C.; Schjoerring, J.K.; Kopittke, P.M.; Donner, E.; Lombi, E. Optimising the foliar uptake of zinc oxide nanoparticles: Do leaf surface properties and particle coating affect absorption? Physiol. Plant. 2020, 170, 384–397. [Google Scholar] [CrossRef]
- Tan, L.; Qu, M.; Zhu, Y.; Peng, C.; Wang, J.; Gao, D.; Chen, C. ZINC TRANSPORTER5 and ZINC TRANSPORTER9 function synergistically in zinc/cadmium uptake. Plant Physiol. 2020, 183, 1235–1249. [Google Scholar] [CrossRef]
- Palmgren, M.G.; Clemens, S.; Williams, L.E.; Krämer, U.; Borg, S.; Schjørring, J.K.; Sanders, D. Zinc biofortification of cereals: Problems and solutions. Trends Plant Sci. 2008, 13, 464–473. [Google Scholar] [CrossRef]
- Yamaji, N.; Ma, J.F. Node-controlled allocation of mineral elements in Poaceae. Curr. Opin. Plant Biol. 2017, 39, 18–24. [Google Scholar] [CrossRef]
- Tan, L.; Zhu, Y.; Fan, T.; Peng, C.; Wang, J.; Sun, L.; Chen, C. OsZIP7 functions in xylem loading in roots and inter-vascular transfer in nodes to deliver Zn/Cd to grain in rice. Biochem. Biophys. Res. Commun. 2019, 512, 112–118. [Google Scholar] [CrossRef]
- Zhang, J.; Wang, S.; Song, S.; Xu, F.; Pan, Y.; Wang, H. Transcriptomic and proteomic analyses reveal new insight into chlorophyll synthesis and chloroplast structure of maize leaves under zinc deficiency stress. J. Proteom. 2019, 199, 123–134. [Google Scholar] [CrossRef]
- Buchanan-Wollaston, V.; Earl, S.; Harrison, E.; Mathas, E.; Navabpour, S.; Page, T.; Pink, D. The molecular analysis of leaf senescence—A genomics approach. Plant Biotechnol. J. 2003, 1, 3–22. [Google Scholar] [CrossRef]
- Dani, K.G.; Fineschi, S.; Michelozzi, M.; Loreto, F. Do cytokinins, volatile isoprenoids and carotenoids synergically delay leaf senescence? Plant Cell Environ. 2016, 39, 1103–1111. [Google Scholar] [CrossRef]
- Leng, Y.; Ye, G.; Zeng, D. Genetic dissection of leaf senescence in rice. Int. J. Mol. Sci. 2017, 18, 2686. [Google Scholar] [CrossRef]
- Lim, P.O.; Kim, H.J.; Nam, H.G. Leaf senescence. Annu. Rev. Plant Biol. 2007, 58, 115–136. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.; Woo, H.R.; Nam, H.G. Toward Systems Understanding of Leaf Senescence: An Integrated Multi-Omics Perspective on Leaf Senescence Research. Mol. Plant 2016, 9, 813–825. [Google Scholar] [CrossRef] [PubMed]
- Lim, P.O.; Woo, H.R.; Nam, H.G. Molecular genetics of leaf senescence in Arabidopsis. Trends Plant Sci. 2003, 8, 272–278. [Google Scholar] [CrossRef]
- Lee, S.; Masclaux-Daubresse, C. Current Understanding of Leaf Senescence in Rice. Int. J. Mol. Sci. 2021, 22, 4515. [Google Scholar] [CrossRef] [PubMed]
- Koyama, T. A hidden link between leaf development and senescence. Plant Sci. 2018, 276, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Yuan, X.; Xu, J.; Yu, J.; Zhu, D.; Li, H.; Zhao, Q. The NAC transcription factor ZmNAC132 regulates leaf senescence and male fertility in maize. Plant Sci. 2023, 334, 111774. [Google Scholar] [CrossRef] [PubMed]
- Sinclair, S.A.; Krämer, U. The zinc homeostasis network of land plants. Biochim. Biophys. Acta 2012, 1823, 1553–1567. [Google Scholar] [CrossRef]
- Ricachenevsky, F.K.; Menguer, P.K.; Sperotto, R.A.; Fett, J.P. Got to hide your Zn away: Molecular control of Zn accumulation and biotechnological applications. Plant Sci. 2015, 236, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Assunção, A.G.; Herrero, E.; Lin, Y.F.; Huettel, B.; Talukdar, S.; Smaczniak, C.; Immink, R.G.; Eldik, M.; Fiers, M.; Schat, H.; et al. Arabidopsis thaliana transcription factors bZIP19 and bZIP23 regulate the adaptation to zinc deficiency. Proc. Natl. Acad. Sci. USA 2010, 107, 10296–10301. [Google Scholar] [CrossRef]
- Kavitha, P.G.; Kuruvilla, S.; Mathew, M.K. Functional characterization of a transition metal ion transporter, OsZIP6 from rice (Oryza sativa L.). Plant Physiol. Biochem. 2015, 97, 165–174. [Google Scholar]
- Huang, S.; Sasaki, A.; Yamaji, N.; Okada, H.; Mitani-Ueno, N.; Ma, J.F. The ZIP transporter family member OsZIP9 contributes to root zinc uptake in rice under zinc-limited conditions. Plant Physiol. 2020, 183, 1224–1234. [Google Scholar] [CrossRef]
- Ricachenevsky, F.K.; Sperotto, R.A.; Menguer, P.K.; Sperb, E.R.; Lopes, K.L.; Fett, J.P. ZINC-INDUCED FACILITATOR-LIKE family in plants: Lineage-specific expansion in monocotyledons and conserved genomic and expression features among rice (Oryza sativa) paralogs. BMC Plant Biol. 2011, 11, 20. [Google Scholar] [CrossRef]
- Li, Z.; Su, D.; Lei, B.; Wang, F.; Geng, W.; Pan, G.; Cheng, F. Transcriptional profile of genes involved in ascorbate glutathione cycle in senescing leaves for an early senescence leaf (esl) rice mutant. J. Plant Physiol. 2015, 176, 1–15. [Google Scholar] [CrossRef]
- Kim, T.; Kang, K.; Kim, S.H.; An, G.; Paek, N.C. OsWRKY5 promotes rice leaf senescence via senescence-associated NAC and abscisic acid biosynthesis pathway. Int. J. Mol. Sci. 2019, 20, 4437. [Google Scholar] [CrossRef]
- Roy, C.; Kumar, S.; Ranjan, R.D.; Kumhar, S.R.; Govindan, V. Genomic approaches for improving grain zinc and iron content in wheat. Front. Genet. 2022, 13, 1045955. [Google Scholar] [CrossRef]
- Kolár, J.; Senková, J. Reduction of mineral nutrient availability accelerates flowering of Arabidopsis thaliana. J. Plant Physiol. 2008, 165, 1601–1609. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Ludewig, U. Biomass increase under zinc deficiency caused by delay of early flowering in Arabidopsis. J. Exp. Bot. 2018, 69, 1269–1279. [Google Scholar] [CrossRef] [PubMed]
- Amini, S.; Arsova, B.; Gobert, S.; Carnol, M.; Bosman, B.; Motte, P.; Watt, M.; Hanikenne, M. Transcriptional regulation of ZIP genes is independent of local zinc status in Brachypodium shoots upon zinc deficiency and resupply. Plant Cell Environ. 2021, 44, 3376–3397. [Google Scholar] [CrossRef] [PubMed]
- Smith, D.D.; Sperry, J.S.; Adler, F.R. Convergence in leaf size versus twig leaf area scaling: Do plants optimize leaf area partitioning? Ann. Bot. 2017, 119, 447–456. [Google Scholar] [CrossRef]
- Wang, Q.; Zhu, Y.; Zou, X.; Li, F.; Zhang, J.; Kang, Z.; Li, X.; Yin, C.; Lin, Y. Nitrogen deficiency-induced decrease in cytokinins content promotes rice seminal root growth by promoting root meristem cell proliferation and cell elongation. Cells 2020, 9, 916. [Google Scholar] [CrossRef]
- Wang, S.J.; Ho, C.H.; Chen, H.W. Rice develop wavy seminal roots in response to light stimulus. Plant Cell Rep. 2011, 30, 1747–1758. [Google Scholar] [CrossRef]
- Liu, Z.; Giehl, R.F.H.; Hartmann, A.; Hajirezaei, M.R.; Carpentier, S.; von Wirén, N. Seminal and nodal roots of barley differ in anatomy, proteome and nitrate uptake capacity. Plant Cell Physiol. 2020, 61, 1297–1308. [Google Scholar] [CrossRef]
- Forde, B.G. Nitrogen signalling pathways shaping root system architecture: An update. Curr. Opin. Plant Biol. 2014, 21, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Subedi, S.R.; Sandhu, N.; Singh, V.K.; Sinha, P.; Kumar, S.; Singh, S.P.; Ghimire, S.K.; Pandey, M.; Yadaw, R.B.; Varshney, R.K.; et al. Genome-wide association study reveals significant genomic regions for improving yield, adaptability of rice under dry direct seeded cultivation condition. BMC Genom. 2019, 20, 471. [Google Scholar] [CrossRef] [PubMed]
- Woo, H.R.; Kim, H.J.; Lim, P.O.; Nam, H.G. Leaf senescence: Systems and dynamics aspects. Annu. Rev. Plant Biol. 2019, 70, 347–376. [Google Scholar] [CrossRef]
- Kim, J.; Kim, J.H.; Lyu, J.I.; Woo, H.R.; Lim, P.O. New insights into the regulation of leaf senescence in Arabidopsis. J. Exp. Bot. 2018, 69, 787–799. [Google Scholar] [CrossRef]
- Jan, S.; Abbas, N.; Ashraf, M.; Ahmad, P. Roles of potential plant hormones and transcription factors in controlling leaf senescence and drought tolerance. Protoplasma 2019, 256, 313–329. [Google Scholar] [CrossRef]
- Holland, V.; Koller, S.; Lukas, S.; Brüggemann, W. Drought- and frost-induced accumulation of soluble carbohydrates during accelerated senescence in Quercus pubescens. Trees 2016, 30, 215–226. [Google Scholar] [CrossRef]
- Zeng, H.; Zhang, X.; Ding, M.; Zhang, X.; Zhu, Y. Transcriptome profiles of soybean leaves and roots in response to zinc deficiency. Physiol. Plant. 2019, 167, 330–351. [Google Scholar] [CrossRef]
- Zhang, Q.; Xia, C.; Zhang, L.; Dong, C.; Liu, X.; Kong, X. Transcriptome analysis of a premature leaf senescence mutant of common wheat (Triticum aestivum L.). Int. J. Mol. Sci. 2018, 19, 782. [Google Scholar] [CrossRef]
- Abdallah, M.; Dubousset, L.; Meuriot, F.; Etienne, P.; Avice, J.C.; Ourry, A. Effect of mineral sulphur availability on nitrogen and sulphur uptake and remobilization during the vegetative growth of Brassica napus L. J. Exp. Bot. 2010, 61, 2635–2646. [Google Scholar] [CrossRef]
- Maillard, A.; Diquélou, S.; Billard, V.; Laîné, P.; Garnica, M.; Prudent, M.; Garcia-Mina, J.M.; Yvin, J.C.; Ourry, A. Leaf mineral nutrient remobilization during leaf senescence and modulation by nutrient deficiency. Front. Plant Sci. 2015, 6, 317. [Google Scholar] [CrossRef]
- Himelblau, E.; Amasino, R.M. Nutrients mobilized from leaves of Arabidopsis thaliana during leaf senescence. J. Plant Physiol. 2001, 158, 1317–1323. [Google Scholar] [CrossRef]
- Lilay, G.H.; Persson, D.P.; Castro, P.H.; Liao, F.; Alexander, R.D.; Aarts, M.G.M.; Assunção, A.G.L. Arabidopsis bZIP19 and bZIP23 act as zinc sensors to control plant zinc status. Nat. Plants 2021, 7, 137–143. [Google Scholar] [CrossRef]
- Lilay, G.H.; Castro, P.H.; Guedes, J.G.; Almeida, D.M.; Campilho, A.; Azevedo, H.; Aarts, M.G.M.; Saibo, N.J.M.; Assunção, A.G.L. Rice F-bZIP transcription factors regulate the zinc deficiency response. J. Exp. Bot. 2020, 71, 3664–3677. [Google Scholar] [CrossRef]
- Burman, N.; Bhatnagar, A.; Khurana, J.P. OsbZIP48, a HY5 transcription factor ortholog, exerts pleiotropic effects in light-regulated development. Plant Physiol. 2018, 176, 1262–1285. [Google Scholar] [CrossRef]
- Evens, N.P.; Buchner, P.; Williams, L.E.; Hawkesford, M.J. The role of ZIP transporters and group F bZIP transcription factors in the Zn-deficiency response of wheat (Triticum aestivum). Plant J. 2017, 92, 291–304. [Google Scholar] [CrossRef]
- Chen, W.R.; Feng, Y.; Chao, Y.E. Genomic analysis and expression pattern of OsZIP1, OsZIP3, and OsZIP4 in two rice (Oryza sativa L.) genotypes with different zinc efficiency. Russ. J. Plant Physiol. 2008, 55, 400–409. [Google Scholar] [CrossRef]
- Ishimaru, Y.; Suzuki, M.; Kobayashi, T.; Takahashi, M.; Nakanishi, H.; Mori, S.; Nishizawa, N.K. OsZIP4, a novel zinc-regulated zinc transporter in rice. J. Exp. Bot. 2005, 56, 3207–3214. [Google Scholar] [CrossRef]
- Sasaki, A.; Yamaji, N.; Mitani-Ueno, N.; Kashino, M.; Ma, J.F. A node-localized transporter OsZIP3 is responsible for the preferential distribution of Zn to developing tissues in rice. Plant J. 2015, 84, 374–384. [Google Scholar] [CrossRef]
- Bashir, K.; Ishimaru, Y.; Nishizawa, N.K. Molecular mechanisms of zinc uptake and translocation in rice. Plant Soil 2012, 361, 189–201. [Google Scholar] [CrossRef]
- Ramesh, S.A.; Shin, R.; Eide, D.J.; Schachtman, D.P. Differential metal selectivity and gene expression of two zinc transporters from rice. Plant Physiol. 2003, 133, 126–134. [Google Scholar] [CrossRef]
- Lee, S.; Jeong, H.J.; Kim, S.A.; Lee, J.; Guerinot, M.L.; An, G. OsZIP5 is a plasma membrane zinc transporter in rice. Plant Mol. Biol. 2010, 73, 507–517. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Li, Y.; Liu, Z.; Tian, J.; Liang, L.; Qiu, Y.; Wang, G.; Du, Q.; Cheng, D.; Cai, H.; et al. A high activity zinc transporter OsZIP9 mediates zinc uptake in rice. Plant J. 2020, 103, 1695–1709. [Google Scholar] [CrossRef] [PubMed]
- Zhan, J.; Zou, W.; Li, S.; Tang, J.; Lu, X.; Meng, L.; Ye, G. OsNAC15 regulates tolerance to zinc deficiency and cadmium by binding to OsZIP7 and OsZIP10 in rice. Int. J. Mol. Sci. 2022, 23, 11771. [Google Scholar] [CrossRef] [PubMed]
- Ishimaru, Y.; Suzuki, M.; Tsukamoto, T.; Suzuki, K.; Nakazono, M.; Kobayashi, T.; Wada, Y.; Watanabe, S.; Matsuhashi, S.; Takahashi, M.; et al. Rice plants take up iron as an Fe3+-phytosiderophore and as Fe2+. Plant J. 2006, 45, 335–346. [Google Scholar] [CrossRef]
- Gindri, R.G.; Navarro, B.B.; da Cruz Dias, P.V.; Tarouco, C.P.; Nicoloso, F.T.; Brunetto, G.; Berghetti, Á.L.P.; da Silva, L.O.S.; Fett, J.P.; Menguer, P.K.; et al. Physiological responses of rice (Oryza sativa L.) oszip7 loss-of-function plants exposed to varying Zn concentrations. Physiol. Mol. Biol. Plants 2020, 26, 1349–1359. [Google Scholar] [CrossRef] [PubMed]
- Nouet, C.; Charlier, J.B.; Carnol, M.; Bosman, B.; Farnir, F.; Motte, P.; Hanikenne, M. Functional analysis of the three HMA4 copies of the metal hyperaccumulator Arabidopsis halleri. J. Exp. Bot. 2015, 66, 5783–5795. [Google Scholar] [CrossRef] [PubMed]
Rice | |||
---|---|---|---|
Gene ID | Gene Description | Gene Name | Inclusion Contrast |
Os12g38300 | Metallothionein-like protein 4C | OsMT1c | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os05g39560 | Zinc transporter 5-like | OsZIP5 | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os12g0571000 | Metallothionein-like protein 4B | — | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os05g39540 | Zinc transporter 9-like | OsZIP9 | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os12g38051 | Metallothionein-like protein 4B | OsMT-I-4b | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os12g0567800 | Metallothionein-like protein 4C | — | C2_vs._C4; C2_vs._D4; C4_vs._D4 |
Os01g74110 | Zinc transporter 1-like | OsZIP1 | C2_vs._C4; C2_vs._D4 |
Os04g52310 | Zinc transporter 3-like | OsZIP3 | C2_vs._C4; C2_vs._D4 |
Os08g10630 | Zinc transporter 4-like | OsZIP4 | C2_vs._D4; C4_vs._D4 |
Os06g37010 | Zinc transporter 10 | OsZIP10 | C2_vs._D4; C4_vs._D4 |
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | Primer Efficiency |
---|---|---|---|
OsZIP1 | TGAGCAAAATGGTGGAAAGC | CAGTTGCAACCCCTGTATGA | 1.972 |
OsZIP3 | TTGCGGGCCTTGTTTCAATG | GCACCAACTAGTGGCCTGAT | 1.895 |
OsZIP4 | TCGGTGATCATCGGGGTTTC | AATCTGCAGCGAGGAGATCG | 1.985 |
OsZIP5 | TGGTGCACTCGCTCATCATC | GTCCCCTTCTCTGCACCTTG | 1.977 |
OsZIP9 | CACTAGGTGCATCCGAGAGC | GCTGATGATGAGCTGCAACC | 1.946 |
OsZIP10 | CCTATCGTTGGGCGTCTCTC | CACTTGAAGCCTTGGGTTGC | 1.821 |
EP | TGAGCAAAATGGTGGAAAGC | CAGTTGCAACCCCTGTATGA | 1.981 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, Y.; Wen, Y.; Wang, C.; Wu, Z.; Yuan, X.; Xiong, Y.; Chen, K.; He, L.; Zhang, Y.; Wang, Z.; et al. ZIP Genes Are Involved in the Retransfer of Zinc Ions during the Senescence of Zinc-Deficient Rice Leaves. Int. J. Mol. Sci. 2023, 24, 13989. https://doi.org/10.3390/ijms241813989
Ma Y, Wen Y, Wang C, Wu Z, Yuan X, Xiong Y, Chen K, He L, Zhang Y, Wang Z, et al. ZIP Genes Are Involved in the Retransfer of Zinc Ions during the Senescence of Zinc-Deficient Rice Leaves. International Journal of Molecular Sciences. 2023; 24(18):13989. https://doi.org/10.3390/ijms241813989
Chicago/Turabian StyleMa, Yangming, Yanfang Wen, Cheng Wang, Ziniu Wu, Xiaojuan Yuan, Ying Xiong, Kairui Chen, Limei He, Yue Zhang, Zhonglin Wang, and et al. 2023. "ZIP Genes Are Involved in the Retransfer of Zinc Ions during the Senescence of Zinc-Deficient Rice Leaves" International Journal of Molecular Sciences 24, no. 18: 13989. https://doi.org/10.3390/ijms241813989
APA StyleMa, Y., Wen, Y., Wang, C., Wu, Z., Yuan, X., Xiong, Y., Chen, K., He, L., Zhang, Y., Wang, Z., Li, L., Yang, Z., Sun, Y., Chen, Z., & Ma, J. (2023). ZIP Genes Are Involved in the Retransfer of Zinc Ions during the Senescence of Zinc-Deficient Rice Leaves. International Journal of Molecular Sciences, 24(18), 13989. https://doi.org/10.3390/ijms241813989