Regulatory Effects of ABA and GA on the Expression of Conglutin Genes and LAFL Network Genes in Yellow Lupine (Lupinus luteus L.) Seeds
Abstract
1. Introduction
2. Results
2.1. Identification of Homologs of Genes Encoding Conglutins and LAFL Genes
2.2. Expression of Genes from the LlLAFL Network in the Study of Transcriptomes
2.2.1. LlLEC2 Expression Level
2.2.2. LlABI3 Expression Level
2.2.3. LlFUS3 Expression Level
2.2.4. LlBETA Expression Level
2.2.5. LlDELTA2 Expression Level
2.3. Changes in the Level of Expression of LlLAFL Genes and Genes Encoding β- and δ-Conglutins under the Influence of ABA or GA3 Application
2.3.1. Relative Expression Level of LlLEC2
2.3.2. Relative Expression Level of LlABI3
2.3.3. Relative Expression Level of LlFUS3
2.3.4. Relative Expression Level of LlBETA
2.3.5. Relative Expression Level of LlDELTA2
2.4. Accumulation of Yellow Lupine Seed Storage Proteins (SSP)
2.4.1. Accumulation of β-Conglutins after ABA or GA Application
2.4.2. Accumulation of δ-Conglutins after ABA or GA3 Application
3. Discussion
3.1. The Role of GA and ABA in Controlling Seed-Filling Processes
3.2. Transcriptional Activity of the LlLAFL Gene Network in Yellow Lupin
3.3. Expression of Genes Encoding β- and δ-Conglutins and the Level of Their Accumulation in Yellow Lupin Seeds
3.4. Effect of GA3 on the Expression of LlLAFL and Genes Encoding β- and δ-Conglutins
3.5. Effect of ABA on the Expression of Identified Genes
4. Materials and Methods
4.1. Research Material Used in RNA-Seq Experiments
4.2. Research Material Used in the Experiments of the Impact of ABA and GA3 Applications
4.3. Identification and Expression of Selected Genes in Yellow Lupin Seeds
4.3.1. Isolation of Total RNA
4.3.2. NGS Sequencing of Transcriptomes
4.3.3. cDNA Identification of Selected Genes
4.3.4. Determination of Expression Levels of Selected Genes
4.3.5. Determination of the Expression of Selected Genes by RT-qPCR
4.4. Protein Profiling in Yellow Lupin Seeds
4.4.1. Protein Isolation
4.4.2. Reduction, Alkylation, Digestion, and TMT Labeling
4.4.3. Chromatographic Separation of Proteins by nanoLC-MS/MS Method
4.4.4. Protein Identification and Quantification
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Jimenez-Lopez, J.C. Narrow-leafed lupin (Lupinus angustifolius L.) β-conglutin: A multifunctional family of proteins with roles in plant defence, human health benefits, and potential uses as functional food. Legum. Sci. 2020, 2, e33. [Google Scholar] [CrossRef]
- Tahmasian, A.; Juhász, A.; Broadbent, J.A.; Nye-Wood, M.G.; Le, T.T.; Colgrave, M.L. Evaluation of the Major Seed Storage Proteins, the Conglutins, Across Genetically Diverse Narrow-Leafed Lupin Varieties. Front. Nutr. 2022, 9, 1038. [Google Scholar] [CrossRef] [PubMed]
- Bryant, L.; Rangan, A.; Grafenauer, S. Lupins and Health Outcomes: A Systematic Literature Review. Nutrients 2022, 14, 327. [Google Scholar] [CrossRef] [PubMed]
- Prusinski, J. White lupin (Lupinus albus L.)—Nutritional and health values in human nutrition—A review. Czech J. Food Sci. 2017, 35, 95–105. [Google Scholar] [CrossRef]
- Duranti, M.; Consonni, A.; Magni, C.; Sessa, F.; Scarafoni, A. The major proteins of lupin seed: Characterisation and molecular properties for use as functional and nutraceutical ingredients. Trends Food Sci. Technol. 2008, 19, 624–633. [Google Scholar] [CrossRef]
- Foley, R.C.; Gao, L.-L.; Spriggs, A.; Soo, L.Y.; Goggin, D.E.; Smith, P.M.; Atkins, C.A.; Singh, K.B. Identification and characterisation of seed storage protein transcripts from Lupinus angustifolius. BMC Plant Biol. 2011, 11, 59. [Google Scholar] [CrossRef]
- Foley, R.C.; Jimenez-Lopez, J.C.; Kamphuis, L.G.; Hane, J.K.; Melser, S.; Singh, K.B. Analysis of conglutin seed storage proteins across lupin species using transcriptomic, protein and comparative genomic approaches. BMC Plant Biol. 2015, 15, 106. [Google Scholar] [CrossRef]
- Verma, S.; Attuluri, V.P.S.; Robert, H.S. Transcriptional control of Arabidopsis seed development. Planta 2022, 255, 90. [Google Scholar] [CrossRef]
- Gacek, K.; Bartkowiak-Broda, I.; Batley, J. Genetic and molecular regulation of seed storage proteins (SSPs) to improve protein nutritional value of oilseed rape (Brassica napus L.) seeds. Front. Plant Sci. 2018, 9, 890. [Google Scholar] [CrossRef]
- Kagaya, Y.; Toyoshima, R.; Okuda, R.; Usui, H.; Yamamoto, A.; Hattori, T. LEAFY COTYLEDON1 controls seed storage protein genes through its regulation of FUSCA3 and ABSCISIC ACID INSENSITIVE3. Plant Cell Physiol. 2005, 46, 399–406. [Google Scholar] [CrossRef]
- Jia, H.; Suzuki, M.; Mccarty, D.R. Regulation of the seed to seedling developmental phase transition by the LAFL and VAL transcription factor networks. Wiley Interdiscip. Rev. Dev. Biol. 2014, 3, 135–145. [Google Scholar] [CrossRef]
- Lepiniec, L.; Devic, M.; Roscoe, T.J.; Bouyer, D.; Zhou, D.-X.; Boulard, C.; Baud, S.; Dubreucq, B. Molecular and epigenetic regulations and functions of the LAFL transcriptional regulators that control seed development. Plant Reprod. 2018, 31, 291–307. [Google Scholar] [CrossRef] [PubMed]
- Kwong, R.W.; Bui, A.Q.; Lee, H.; Kwong, L.W.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. LEAFY COTYLEDON1-LIKE Defines a Class of Regulators Essential for Embryo Development. Plant Cell 2003, 15, 5. [Google Scholar] [CrossRef] [PubMed]
- Fatihi, A.; Boulard, C.; Bouyer, D.; Baud, S.; Dubreucq, B.; Lepiniec, L. Deciphering and modifying LAFL transcriptional regulatory network in seed for improving yield and quality of storage compounds. Plant Sci. 2016, 250, 198–204. [Google Scholar] [CrossRef] [PubMed]
- Carbonero, P.; Iglesias-Fernández, R.; Vicente-Carbajosa, J. The AFL subfamily of B3 transcription factors: Evolution and function in angiosperm seeds. J. Exp. Bot. 2017, 68, 871–880. [Google Scholar] [CrossRef]
- Devic, M.; Roscoe, T. Seed maturation: Simplification of control networks in plants. Plant Sci. 2016, 252, 335–346. [Google Scholar] [CrossRef]
- Boulard, C.; Thévenin, J.; Tranquet, O.; Laporte, V.; Lepiniec, L.; Dubreucq, B. LEC1 (NF-YB9) directly interacts with LEC2 to control gene expression in seed. Biochim. Biophys. Acta-Gene Regul. Mech. 2018, 1861, 443–450. [Google Scholar] [CrossRef]
- Jia, H.; McCarty, D.R.; Suzuki, M. Distinct Roles of LAFL Network Genes in Promoting the Embryonic Seedling Fate in the Absence of VAL Repression. Plant Physiol. 2013, 163, 1293. [Google Scholar] [CrossRef]
- Jo, L.; Pelletier, J.M.; Harada, J.J. Central role of the LEAFY COTYLEDON1 transcription factor in seed development. J. Integr. Plant Biol. 2019, 61, 564–580. [Google Scholar] [CrossRef]
- Pelletier, J.M.; Kwong, R.W.; Park, S.; Le, B.H.; Baden, R.; Cagliari, A.; Hashimoto, M.; Munoz, M.D.; Fischer, R.L.; Goldberg, R.B.; et al. LEC1 sequentially regulates the transcription of genes involved in diverse developmental processes during seed development. Proc. Natl. Acad. Sci. USA 2017, 114, E6710–E6719. [Google Scholar] [CrossRef]
- Ogas, J.; Kaufmann, S.; Henderson, J.; Somerville, C. PICKLE is a CHD3 Chromatin-remodeling factor that regulates the transition from embryonic to vegetative development in arabidopsis. Proc. Natl. Acad. Sci. USA 1999, 96, 13839–13844. [Google Scholar] [CrossRef]
- Verdier, J.; Thompson, R.D. Transcriptional Regulation of Storage Protein Synthesis During Dicotyledon Seed Filling. Plant Cell Physiol. 2008, 49, 1263–1271. [Google Scholar] [CrossRef] [PubMed]
- Yang, R.; Hong, Y.; Ren, Z.; Tang, K.; Zhang, H.; Zhu, J.K.; Zhao, C. A role for PICKLE in the regulation of cold and salt stress tolerance in arabidopsis. Front. Plant Sci. 2019, 10, 900. [Google Scholar] [CrossRef] [PubMed]
- Stone, S.L.; Braybrook, S.A.; Paula, S.L.; Kwong, L.W.; Meuser, J.; Pelletier, J.; Hsieh, T.F.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. Arabidopsis LEAFY COTYLEDON2 induces maturation traits and auxin activity: Implications for somatic embryogenesis. Proc. Natl. Acad. Sci. USA 2008, 105, 3151–3156. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, A.; Kagaya, Y.; Usui, H.; Hobo, T.; Takeda, S.; Hattori, T. Diverse Roles and Mechanisms of Gene Regulation by the Arabidopsis Seed Maturation Master Regulator FUS3 Revealed by Microarray Analysis. Plant Cell Physiol. 2010, 51, 2031–2046. [Google Scholar] [CrossRef] [PubMed]
- To, A.; Valon, C.; Savino, G.; Guilleminot, J.; Devic, M.; Giraudat, J.; Parcy, F. A network of local and redundant gene regulation governs Arabidopsis seed maturation. Plant Cell 2006, 18, 1642–1651. [Google Scholar] [CrossRef]
- Bedi, S.; Nag Chaudhuri, R. Transcription factor ABI3 auto-activates its own expression during dehydration stress response. FEBS Lett. 2018, 592, 2594–2611. [Google Scholar] [CrossRef]
- Yang, Z.; Liu, X.; Wang, K.; Li, Z.; Jia, Q.; Zhao, C.; Zhang, M.; Nakamura, Y.; Sinica, A. ABA-INSENSITIVE 3 with or without FUSCA3 highly up-regulates lipid droplet proteins and activates oil accumulation. J. Exp. Bot. 2022, 73, 2077–2092. [Google Scholar]
- Mönke, G.; Altschmied, L.; Tewes, A.; Reidt, W.; Mock, H.-P.; Bäumlein, H.; Conrad, U. Seed-specific transcription factors ABI3 and FUS3: Molecular interaction with DNA. Planta 2004, 219, 158–166. [Google Scholar] [CrossRef]
- Tian, R.; Wang, F.; Zheng, Q.; Niza, V.M.A.G.E.; Downie, A.B.; Perry, S.E. Direct and indirect targets of the arabidopsis seed transcription factor ABSCISIC ACID INSENSITIVE3. Plant J. 2020, 103, 1679–1694. [Google Scholar] [CrossRef]
- Schneider, A.; Aghamirzaie, D.; Elmarakeby, H.; Poudel, A.N.; Koo, A.J.; Heath, L.S.; Grene, R.; Collakova, E. Potential targets of VIVIPAROUS1/ABI3-LIKE1 (VAL1) repression in developing Arabidopsis thaliana embryos. Plant J. 2016, 85, 305–319. [Google Scholar] [CrossRef]
- Gao, M.J.; Lydiate, D.J.; Li, X.; Lui, H.; Gjetvaj, B.; Hegedus, D.D.; Rozwadowski, K. Repression of seed maturation genes by a trihelix transcriptional repressor in Arabidopsis seedlings. Plant Cell 2009, 21, 54–71. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, M.; Wang, H.H.-Y.; McCarty, D.R. Repression of the LEAFY COTYLEDON 1/B3 regulatory network in plant embryo development by VP1/ABSCISIC ACID INSENSITIVE 3-LIKE B3 genes. Plant Physiol. 2007, 143, 902–911. [Google Scholar] [CrossRef] [PubMed]
- Locascio, A.; Roig-Villanova, I.; Bernardi, J.; Varotto, S. Current perspectives on the hormonal control of seed development in Arabidopsis and maize: A focus on auxin. Front. Plant Sci. 2014, 5, 412. [Google Scholar]
- Jain, R.; Dhaka, N.; Yadav, P.; Sharma, R. Role of phytohormones in regulating agronomically important seed traits in crop plants. Plant Horm. Crop Improv. 2023, 2023, 65–88. [Google Scholar]
- Bewley, J.D.; Nonogaki, H. Seed Maturation and Germination. Ref. Modul. Life Sci. 2017, 2003, 623–626. [Google Scholar]
- Ali, F.; Qanmber, G.; Li, F.; Wang, Z. Updated role of ABA in seed maturation, dormancy, and germination. J. Adv. Res. 2022, 35, 199–214. [Google Scholar]
- Finkelstein, R.; Reeves, W.; Ariizumi, T.; Steber, C. Molecular aspects of seed dormancy. Annu. Rev. Plant Biol. 2008, 59, 387–415. [Google Scholar] [CrossRef]
- Wilson, R.L.; Kim, H.; Bakshi, A.; Binder, B.M. The Ethylene Receptors ETHYLENE RESPONSE1 and ETHYLENE RESPONSE2 Have Contrasting Roles in Seed Germination of Arabidopsis during Salt Stress. Plant Physiol. 2014, 165, 1353. [Google Scholar] [CrossRef]
- Wang, H.; Zhang, Y.; Xiao, N.; Zhang, G.; Wang, F.; Chen, X.; Fang, R. Rice GERMIN-LIKE PROTEIN 2-1 Functions in Seed Dormancy under the Control of Abscisic Acid and Gibberellic Acid Signaling Pathways. Plant Physiol. 2020, 183, 1157–1170. [Google Scholar] [CrossRef]
- DeLisle, A.J.; Crouch, M.L. Seed Storage Protein Transcription and mRNA Levels in Brassica napus during Development and in Response to Exogenous Abscisic Acid. Plant Physiol. 1989, 91, 617–623. [Google Scholar] [CrossRef] [PubMed]
- Chiu, R.S.; Nahal, H.; Provart, N.J.; Gazzarrini, S. The role of the Arabidopsis FUSCA3 transcription factor during inhibition of seed germination at high temperature. BMC Plant Biol. 2012, 12, 15. [Google Scholar] [CrossRef] [PubMed]
- Curaba, J.; Moritz, T.; Blervaque, R.; Parcy, F.; Raz, V.; Herzog, M.; Vachon, G. AtGA3ox2, a key gene responsible for bioactive gibberellin biosynthesis, is regulated during embryogenesis by Leafy Cotyledon2 and FUSCA3 in arabidopsis. Plant Physiol. 2004, 136, 3660–3669. [Google Scholar] [CrossRef]
- Gazzarrini, S.; Tsuchiya, Y.; Lumba, S.; Okamoto, M.; McCourt, P. The Transcription Factor FUSCA3 Controls Developmental Timing in Arabidopsis through the Hormones Gibberellin and Abscisic Acid. Dev. Cell 2004, 7, 373–385. [Google Scholar] [CrossRef] [PubMed]
- Holdsworth, M.J.; Bentsink, L.; Soppe, W.J.J. Molecular networks regulating Arabidopsis seed maturation, after-ripening, dormancy and germination. New Phytol. 2008, 179, 33–54. [Google Scholar] [CrossRef]
- Meinke, D.W.; Franzmann, L.H.; Nickle, T.C.; Yeung, E.C. Leafy cotyledon mutants of arabidopsis. Plant Cell 1994, 6, 1049–1064. [Google Scholar] [CrossRef]
- Stone, S.L.; Kwong, L.W.; Yee, K.M.; Pelletier, J.; Lepiniec, L.; Fischer, R.L.; Goldberg, R.B.; Harada, J.J. LEAFY COTYLEDON2 encodes a B3 domain transcription factor that induces embryo development. Proc. Natl. Acad. Sci. USA 2001, 98, 11806–11811. [Google Scholar] [CrossRef]
- Sujak, A.; Kotlarz, A.; Strobel, W. Compositional and nutritional evaluation of several lupin seeds. Food Chem. 2006, 98, 711–719. [Google Scholar] [CrossRef]
- Księżak, J.; Staniak, M.; Bojarszczuk, J. Nutrient contents in yellow lupine (Lupinus luteus L.) and blue lupine (Lupinus angustifolius L.) cultivars depending on habitat conditions. Polish J. Environ. Stud. 2018, 27, 1145–1153. [Google Scholar] [CrossRef]
- Borek, S.; Pukacka, S.; Michalski, K.; Ratajczak, L. Lipid and protein accumulation in developing seeds of three lupine species: Lupinus luteus L., Lupinus albus L., and Lupinus mutabilis Sweet. J. Exp. Bot. 2009, 60, 3453–3466. [Google Scholar] [CrossRef]
- Jones, S.I.; Vodkin, L.O. Using RNA-Seq to Profile Soybean Seed Development from Fertilization to Maturity. PLoS ONE 2013, 8, e59270. [Google Scholar] [CrossRef] [PubMed]
- Chen, Z.; Ly Vu, B.; Leprince, O.; Verdier, J. RNA sequencing data for heat stress response in isolated medicago truncatula seed tissues. Data Br. 2021, 35, 106726. [Google Scholar] [CrossRef] [PubMed]
- Henderson, J.T.; Li, H.-C.; Rider, S.D.; Mordhorst, A.P.; Romero-Severson, J.; Cheng, J.-C.; Robey, J.; Sung, Z.R.; de Vries, S.C.; Ogas, J. PICKLE acts throughout the plant to repress expression of embryonic traits and may play a role in gibberellin-dependent responses. Plant Physiol. 2004, 134, 995–1005. [Google Scholar] [CrossRef] [PubMed]
- Glazinska, P.; Kulasek, M.; Glinkowski, W.; Wysocka, M.; Kosiński, J.G. LuluDB—The Database Created Based on Small RNA, Transcriptome, and Degradome Sequencing Shows the Wide Landscape of Non-coding and Coding RNA in Yellow Lupine (Lupinus luteus L.) Flowers and Pods. Front. Genet. 2020, 11, 1–16. [Google Scholar] [CrossRef]
- Nodine, M.D.; Bartel, D.P. MicroRNAs prevent precocious gene expression and enable pattern formation during plant embryogenesis. Genes Dev. 2010, 24, 2678–2692. [Google Scholar] [CrossRef] [PubMed]
- Willmann, M.R.; Mehalick, A.J.; Packer, R.L.; Jenik, P.D. MicroRNAs regulate the timing of embryo maturation in Arabidopsis. Plant Physiol. 2011, 155, 1871–1884. [Google Scholar] [CrossRef] [PubMed]
- Finkelstein, R.R.; Gibson, S.I. ABA and sugar interactions regulating development: Cross-talk or voices in a crowd? Curr. Opin. Plant Biol. 2002, 5, 26–32. [Google Scholar] [CrossRef]
- Slater, S.M.H.; Yuan, H.Y.; Lulsdorf, M.M.; Vandenberg, A.; Zaharia, L.I.; Han, X.; Abrams, S.R. Comprehensive hormone profiling of the developing seeds of four grain legumes. Plant Cell Rep. 2013, 32, 1939–1952. [Google Scholar] [CrossRef]
- Santos-Mendoza, M.; Dubreucq, B.; Baud, S.; Parcy, F.; Caboche, M.; Lepiniec, L. Deciphering gene regulatory networks that control seed development and maturation in Arabidopsis. Plant J. 2008, 54, 608–620. [Google Scholar] [CrossRef]
- Lopez-Molina, L.; Mongrand, S.; McLachlin, D.T.; Chait, B.T.; Chua, N.H. ABI5 acts downstream of ABI3 to execute an ABA-dependent growth arrest during germination. Plant J. 2002, 32, 317–328. [Google Scholar] [CrossRef]
- Giraudat, J.; Hauge, B.M.; Valon, C.; Smalle, J.; Parcy, F.; Goodmana, H.M. Isolation of the Arabidopsis AB13 Gene by Positional Cloning. Plant Cell 1992, 4, 1251–1261. [Google Scholar]
- Gagete, A.P.; Riera, M.; Franco, L.; Rodrigo, M.I. Functional analysis of the isoforms of an ABI3-like factor of Pisum sativum generated by alternative splicing. J. Exp. Bot. 2009, 60, 1703–1714. [Google Scholar] [CrossRef]
- Gao, Y.; Liu, J.; Zhang, Z.; Sun, X.; Zhang, N.; Fan, J.; Niu, X.; Xiao, F.; Liu, Y. Functional characterization of two alternatively spliced transcripts of tomato ABSCISIC ACID INSENSITIVE3 (ABI3) gene. Plant Mol. Biol. 2013, 82, 131–145. [Google Scholar] [CrossRef]
- Lalanne, D.; Malabarba, J.; Ly Vu, J.; Hundertmark, M.; Delahaie, J.; Leprince, O.; Buitink, J.; Verdier, J. Medicago abi3 splicing isoforms regulate the expression of different gene clusters to orchestrate seed maturation. Plants 2021, 10, 1710. [Google Scholar] [CrossRef]
- Roscoe, T.T.; Guilleminot, J.; Bessoule, J.-J.; Berger, F.; Devic, M. Complementation of Seed Maturation Phenotypes by Ectopic Expression of ABSCISIC ACID INSENSITIVE3, FUSCA3 and LEAFY COTYLEDON2 in Arabidopsis. Plant Cell Physiol. 2015, 56, 1215–1228. [Google Scholar] [CrossRef]
- Fauteux, F.; Strömvik, M.V. Seed storage protein gene promoters contain conserved DNA motifs in Brassicaceae, Fabaceae and Poaceae. BMC Plant Biol. 2009, 9, 126. [Google Scholar] [CrossRef]
- Ramtekey, V.; Cherukuri, S.; Kumar, S.; Sripathy, V.K.; Sheoran, S.; Udaya, B.; Bhojaraja, K.N.; Kumar, S.; Singh, A.N.; Singh, H.V. Seed Longevity in Legumes: Deeper Insights Into Mechanisms and Molecular Perspectives. Front. Plant Sci. 2022, 13, 918206. [Google Scholar]
- Ruan, J.; Chen, H.; Zhu, T.; Yu, Y.; Lei, Y.; Yuan, L.; Liu, J.; Wang, Z.Y.; Kuang, J.F.; Lu, W.J.; et al. Brassinosteroids repress the seed maturation program during the seed-to-seedling transition. Plant Physiol. 2021, 186, 534–548. [Google Scholar] [CrossRef]
- Unterholzner, S.J.; Rozhon, W.; Papacek, M.; Ciomas, J.; Lange, T.; Kugler, K.G.; Mayer, K.F.; Sieberer, T.; Poppenberger, B. Brassinosteroids are master regulators of gibberellin biosynthesis in Arabidopsis. Plant Cell 2015, 27, 2261–2272. [Google Scholar] [CrossRef]
- Huang, X.Q.; He, R.Q.; Liao, X.Y.; Zhou, B.; Peng, W.S.; Lin, J.Z.; Tang, D.Y.; Zhu, Y.H.; Zhao, X.Y.; Liu, X.M. Effect of exogenous gibberellin on reserve accumulation during the seed filling stage of oilseed rape. Genet. Mol. Res. 2014, 13, 2827–2839. [Google Scholar] [CrossRef]
- Park, Y.J.; Kim, J.Y.; Lee, J.H.; Lee, B.D.; Paek, N.C.; Park, C.M. GIGANTEA Shapes the Photoperiodic Rhythms of Thermomorphogenic Growth in Arabidopsis. Mol. Plant 2020, 13, 459–470. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, J.; Wang, Z.; Liu, K.; Wang, P. Post-anthesis development of inferior and superior spikelets in rice in relation to abscisic acid and ethylene. J. Exp. Bot. 2006, 57, 149–160. [Google Scholar] [CrossRef] [PubMed]
- Kondhare, K.R.; Hedden, P.; Kettlewell, P.S.; Farrell, A.D.; Monaghan, J.M. Quantifying the impact of exogenous abscisic acid and gibberellins on pre-maturity α-amylase formation in developing wheat grains. Sci. Rep. 2014, 4, 5355. [Google Scholar]
- Ito, A.; Sakamoto, D.; Itai, A.; Nishijima, T.; Oyama-Okubo, N.; Nakamura, Y.; Moriguchi, T.; Nakajima, I. Effects of GA3+4 and GA4+7 application either alone or combined with prohexadione-ca on fruit development of Japanese pear ‘Kosui’. Hortic. J. 2016, 85, 201–208. [Google Scholar] [CrossRef]
- Lur’, H.-S.; Setter, T.L. Role of Auxin in Maize Endosperm Development (Timing of Nuclear DNA Endoreduplication, Zein Expression, and Cytokinin). Plant Physiol. 1993, 103, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Matilla, A.J. Auxin: Hormonal signal required for seed development and dormancy. Plants 2020, 9, 705. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Zhou, L.; Yang, Y.; Zhang, W.; Chen, Z.; Li, X.; Qian, Q.; Kong, F.; Li, Y.; Liu, X.; et al. The gibberellin signaling negative regulator RGA-LIKE3 promotes seed storage protein accumulation. Plant Physiol. 2021, 185, 1697–1707. [Google Scholar] [PubMed]
- De Wit, M.; Galvão, V.C.; Fankhauser, C. Light-Mediated Hormonal Regulation of Plant Growth and Development. Annu. Rev. Plant Biol. 2016, 67, 513–537. [Google Scholar] [CrossRef]
- Yan, A.; Chen, Z. The Control of Seed Dormancy and Germination by Temperature, Light and Nitrate. Bot. Rev. 2020, 86, 39–75. [Google Scholar]
- Parcy, F.; Valon, C.; Raynal, M.; Gaubier-Comella, P.; Delseny, M.; Giraudat, J. Regulation of Gene Expression Programs during Arabidopsis Seed Development: Roles of the AB13 Locus and of Endogenous Abscisic Acid. Plant Cell 1994, 6, 1567–1582. [Google Scholar]
- Glazińska, P.; Kulasek, M.; Glinkowski, W.; Wojciechowski, W.; Kosiński, J. Integrated analysis of small rna, transcriptome and degradome sequencing provides new insights into floral development and abscission in yellow lupine (Lupinus luteus L.). Int. J. Mol. Sci. 2019, 20, 5122. [Google Scholar] [CrossRef] [PubMed]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114. [Google Scholar] [CrossRef]
- Grabherr, M.G.; Haas, B.J.; Yassour, M.; Levin, J.Z.; Thompson, D.A.; Amit, I.; Adiconis, X.; Fan, L.; Raychowdhury, R.; Zeng, Q.; et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 2011, 29, 644–652. [Google Scholar] [CrossRef] [PubMed]
- McGinnis, S.; Madden, T.L. BLAST: At the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 2004, 32, W20. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.B.; Kamphuis, L.G.; Nelson, M.N. The Lupin Genome; Singh, K.B., Kamphuis, L.G., Nelson, M.N., Eds.; Compendium of Plant Genomes; Springer International Publishing: Cham, Switzerland, 2020; ISBN 978-3-030-21269-8. [Google Scholar]
- Mousavi-Derazmahalleh, M.; Bayer, P.E.; Nevado, B.; Hurgobin, B.; Filatov, D.; Kilian, A.; Kamphuis, L.G.; Singh, K.B.; Berger, J.D.; Hane, J.K.; et al. Exploring the genetic and adaptive diversity of a pan-Mediterranean crop wild relative: Narrow-leafed lupin. Theor. Appl. Genet. 2018, 131, 887–901. [Google Scholar] [CrossRef] [PubMed]
- Hane, J.K.; Ming, Y.; Kamphuis, L.G.; Nelson, M.N.; Garg, G.; Atkins, C.A.; Bayer, P.E.; Bravo, A.; Bringans, S.; Cannon, S.; et al. A comprehensive draft genome sequence for lupin (Lupinus angustifolius), an emerging health food: Insights into plant–microbe interactions and legume evolution. Plant Biotechnol. J. 2017, 15, 318–330. [Google Scholar]
- Li, H.; Handsaker, B.; Wysoker, A.; Fennell, T.; Ruan, J.; Homer, N.; Marth, G.; Abecasis, G.; Durbin, R. The Sequence Alignment/Map format and SAMtools. Bioinformatics 2009, 25, 2078–2079. [Google Scholar] [CrossRef]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef]
- Wiśniewski, J.R.; Zougman, A.; Nagaraj, N.; Mann, M. Universal sample preparation method for proteome analysis. Nat. Methods 2009, 6, 359–362. [Google Scholar] [CrossRef]








| Gene Tested | Sequence 5’→3’ | Length (nt) | Melting Temp.(°C) | UPL Probe Number | |
|---|---|---|---|---|---|
| LlLEC2 | FP | GCCGGATTATTATCCCAAAGA | 21 | 50.5 | 30 |
| RP | TTCCTTTTTGCAAAGGGTTG | 20 | 47.7 | ||
| LlABI3 | FP | CTATGGCACAGGTGGTTCCT | 20 | 53.8 | 138 |
| RP | CTGGGTTTGCATGGCAGT | 18 | 50.3 | ||
| LlFUS3 | FP | CCACCACCTCCACCATTT | 18 | 50.3 | 69 |
| RP | TTTCACGAGCCGGAGATG | 18 | 50.3 | ||
| LlBETA | FP | TGGATTTGGCATAAATGCTG | 20 | 47.7 | 6 |
| RP | ACATTGTCTTCAGAACCTGCAA | 22 | 51.1 | ||
| LlDELTA2 | FP | AAGATGATTCAGCAGGAGCAA | 21 | 50.5 | 69 |
| RP | TTCCTGCTATGTCCAACAACA | 21 | 50.5 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Klajn, N.; Kapczyńska, K.; Pasikowski, P.; Glazińska, P.; Kugiel, H.; Kęsy, J.; Wojciechowski, W. Regulatory Effects of ABA and GA on the Expression of Conglutin Genes and LAFL Network Genes in Yellow Lupine (Lupinus luteus L.) Seeds. Int. J. Mol. Sci. 2023, 24, 12380. https://doi.org/10.3390/ijms241512380
Klajn N, Kapczyńska K, Pasikowski P, Glazińska P, Kugiel H, Kęsy J, Wojciechowski W. Regulatory Effects of ABA and GA on the Expression of Conglutin Genes and LAFL Network Genes in Yellow Lupine (Lupinus luteus L.) Seeds. International Journal of Molecular Sciences. 2023; 24(15):12380. https://doi.org/10.3390/ijms241512380
Chicago/Turabian StyleKlajn, Natalia, Katarzyna Kapczyńska, Paweł Pasikowski, Paulina Glazińska, Hubert Kugiel, Jacek Kęsy, and Waldemar Wojciechowski. 2023. "Regulatory Effects of ABA and GA on the Expression of Conglutin Genes and LAFL Network Genes in Yellow Lupine (Lupinus luteus L.) Seeds" International Journal of Molecular Sciences 24, no. 15: 12380. https://doi.org/10.3390/ijms241512380
APA StyleKlajn, N., Kapczyńska, K., Pasikowski, P., Glazińska, P., Kugiel, H., Kęsy, J., & Wojciechowski, W. (2023). Regulatory Effects of ABA and GA on the Expression of Conglutin Genes and LAFL Network Genes in Yellow Lupine (Lupinus luteus L.) Seeds. International Journal of Molecular Sciences, 24(15), 12380. https://doi.org/10.3390/ijms241512380

