Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM?
Abstract
:1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Oocyte Recovery, Selection, and In Vitro Maturation
4.2. DNA and RNA Preparation, cDNA Synthesis, and Real-Time Quantitative PCR
4.3. Immunofluorescence Staining and Confocal Microscopy
4.4. Expession of a HES1/GFP Fusion Protein and Fluorescence Recovery after Photo Bleaching (FRAP)
4.5. Statistic
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eppig, J.J. Oocyte-Somatic Cell Interactions During Oocyte Growth and Maturation in the Mammal. In Oogenesis; Browder, L.W., Ed.; Springer: Bosten, MA, USA, 1985. [Google Scholar] [CrossRef]
- Matzuk, M.M.; Burns, K.H.; Viveiros, M.M.; Eppig, J.J. Intercellular communication in the mammalian ovary: Oocytes carry the conversation. Science 2002, 296, 2178–2180. [Google Scholar] [CrossRef] [PubMed]
- Eppig, J.J. Reproduction: Oocytes call, granulosa cells connect. Curr. Biol. 2018, 28, 354–356. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vanorny, D.A.; Prasasya, R.D.; Chalpe, A.J.; Kilen, S.M.; Mayo, K.E. Notch Signaling Regulates Ovarian Follicle Formation and Coordinates Follicular Growth. Mol. Endocrinol. 2014, 28, 499–511. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vanorny, D.A.; Mayo, K.E. The role of Notch signaling in the mammalian ovary. Reproduction 2017, 153, 187–204. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Trombly, D.J.; Woodruff, T.K.; Mayo, K.E. Suppression of Notch Signaling in the Neonatal Mouse Ovary Decreases Primordial Follicle Formation. Endocrinology 2009, 150, 1014–1024. [Google Scholar] [CrossRef] [Green Version]
- Chen, C.L.; Fu, X.F.; Wang, L.Q.; Wang, J.J.; Ma, H.G.; Cheng, S.F.; Hou, Z.M.; Ma, J.M.; Quan, G.B.; Shen, W.; et al. Primordial follicle assembly was regulated by notch signaling pathway in mice. Mol. Biol. Rep. 2014, 41, 1891–1899. [Google Scholar] [CrossRef]
- Johnson, J.; Espinoza, T.; McGaughey, R.W.; Rawls, A.; Wilson-Rawls, J. Notch pathway genes are expressed in mammalian ovarian follicles. Mech. Dev. 2001, 109, 355–361. [Google Scholar] [CrossRef]
- Zhang, C.P.; Yang, J.L.; Zhang, J.; Li, L.; Huang, L.; Ji, S.Y.; Hu, Z.Y.; Gao, F.; Liu, Y.X. Notch Signaling Is Involved in Ovarian Follicle Development by Regulating Granulosa Cell Proliferation. Endocrinology 2011, 152, 2437–2447. [Google Scholar] [CrossRef]
- Terauchi, K.J.; Shigeta, Y.; Iguchi, T.; Sato, T. Role of Notch signaling in granulosa cell proliferation and polyovular follicle induction during folliculogenesis in mouse ovary. Cell Tissue Res. 2016, 365, 197–208. [Google Scholar] [CrossRef]
- Prasasya, R.D.; Mayo, K.E. Notch signaling regulates differentiation and steroidogenesis in female mouse ovarian granulosa cells. Endocrinology 2018, 159, 184–198. [Google Scholar] [CrossRef] [Green Version]
- Koike, H.; Harada, M.; Kusamoto, A.; Kunitomi, C.; Xu, Z.; Tanaka, T.; Urata, Y.; Nose, E.; Takahashi, N.; Wada-Hiraike, O.; et al. Notch Signaling Induced by Endoplasmic Reticulum Stress Regulates Cumulus-Oocyte Complex Expansion in Polycystic Ovary Syndrome. Biomolecules 2022, 12, 1037. [Google Scholar] [CrossRef]
- Murta, D.; Batista, M.; Silva, E.; Trindade, A.; Mateus, L.; Duarte, A.; Lopes da Costa, L. Differential expression of Notch component and effector genes during ovarian follicle and corpus luteum development during the oestrous cycle. Reprod. Fertil. Dev. 2014, 27, 1038–1048. [Google Scholar] [CrossRef] [PubMed]
- Hubbard, N.; Prasasya, R.D.; Mayo, K.E. Activation of Notch Signaling by Oocytes and Jag1 in Mouse Ovarian Granulosa Cells. Endocrinology 2019, 160, 2863–2876. [Google Scholar] [CrossRef] [PubMed]
- Iso, T.; Kedes, L.; Hamamori, Y. HES and HERP families: Multiple effectors of the Notch signaling pathway. J. Cell. Physiol. 2003, 194, 237–255. [Google Scholar] [CrossRef] [PubMed]
- Kageyama, R.; Ohtsuka, T.; Kobayashi, T. The Hes gene family: Repressors and oscillators that orchestrate embryogenesis. Development 2007, 134, 1243–1251. [Google Scholar] [CrossRef] [Green Version]
- Manosalva, I.; González, A.; Kageyama, R. Hes1 in the somatic cells of the murine ovary is necessary for oocyte survival and maturation. Dev. Biol. 2013, 375, 140–151. [Google Scholar] [CrossRef] [Green Version]
- Alm, H.; Torner, H.; Lohrke, B.; Viergutz, T.; Ghoneim, I.M.; Kanitz, W. Bovine blastocyst Springer development rate in vitro is influenced by selection of oocytes by brillant cresyl blue staining before IVM as indicator for glucose-6-phosphate dehydrogenase activity. Theriogenology 2005, 63, 2194–2205. [Google Scholar] [CrossRef]
- Bhojwani, S.; Alm, H.; Torner, H.; Kanitz, W.; Pöhland, R. Selection of developmentally competent oocytes through brilliant cresyl blue stain enhances blastocyst development rate after bovine nuclear transfer. Theriogenology 2007, 67, 341–345. [Google Scholar] [CrossRef]
- Marello, K.; LaRovere, J.; Sommerville, J. Binding of Xenopus oocyte masking proteins to mRNA sequenzes. Nucleic Acids Res. 1992, 20, 5593–5600. [Google Scholar] [CrossRef]
- Verrotti, A.C.; Strickland, S. Oocyte selection of mutations affecting cytoplasmic polyadenylation of maternal mRNAs. Mol. Reprod. Dev. 1997, 46, 482–488. [Google Scholar] [CrossRef]
- Tomek, W.; Torner, H.; Kanitz, W. Comparative Analysis of Protein Synthesis, Transcription and Cytoplasmic Polyadenylation of mRNA during Maturation of Bovine Oocytes in vitro. Reprod. Domest. Anim. 2002, 37, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Legge, M. Oocyte and zygote zona pellucida permeability to macromolecules. J. Exp. Zool. 1995, 271, 145–150. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.; Zhang, Y.; Ai, J.; Li, K. Application of Single-Cell RNA Sequencing in Ovarian Development. Biomolecules 2023, 13, 47. [Google Scholar] [CrossRef]
- Pöhland, R.; Tomek, W.; Becker, F.; Kurth, J.; Kanitz, W.; Bhojwani, S. Qualitative and quantitative differences of cytoskeleton proteins in embryos produced in vitro, in vivo, and by somatic nuclear transfer. Mol. Reprod. Dev. 2008, 75, 1109–1119. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence | Bp |
---|---|---|
HES1F | TCTACACCAGCAACAGCGGGA | 100 |
HES2R | TTCCGCCACGGTCTCCACAT | 100 |
RPS18 forward | GAGGTGGAACGTGTGATCACCATT | |
RPS18 reverse | TGTATTTCCCGTCCTTCACGTCCT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pöhland, R.; Vanselow, J.; Sterza, F.M. Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM? Int. J. Mol. Sci. 2023, 24, 11932. https://doi.org/10.3390/ijms241511932
Pöhland R, Vanselow J, Sterza FM. Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM? International Journal of Molecular Sciences. 2023; 24(15):11932. https://doi.org/10.3390/ijms241511932
Chicago/Turabian StylePöhland, Ralf, Jens Vanselow, and Fabiana Melo Sterza. 2023. "Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM?" International Journal of Molecular Sciences 24, no. 15: 11932. https://doi.org/10.3390/ijms241511932
APA StylePöhland, R., Vanselow, J., & Sterza, F. M. (2023). Translocation of Oocytic HES1 into Surrounding Cumulus Cells in Bovine: Mechanism of Cellular Interaction during IVM? International Journal of Molecular Sciences, 24(15), 11932. https://doi.org/10.3390/ijms241511932