Albizia julibrissin Exerts Anti-Obesity Effects by Inducing the Browning of 3T3L1 White Adipocytes
Abstract
:1. Introduction
2. Results
2.1. AJLE Inhibits Adipogenesis in 3T3-L1 Pre-Adipocytes
2.2. AJLE Induces Brown Adipocyte-like Phenotype in 3T3-L1 Mature Adipocytes
2.3. AJLE Increases Mitochondrial Function in 3T3L1 Mature Adipocytes
2.4. AJLE Accelerates Browning-Related Gene Expression in 3T3-L1 Mature Adipocytes
2.5. AJLE-Induced Browning Is Regulated by the Coordination of AMPK, p38, and SIRT1/PGC-1 α Signaling Pathways
2.6. High-Performance Liquid Chromatography Analysis
3. Discussion
4. Materials and Methods
4.1. Materials and Reagents
4.2. Preparation of Extracts from Albizia julibrissin Leaves
4.3. Cell Culture and Differentiation
4.4. Cell Viability Assay
4.5. Lactate Dehydrogenase Assay
4.6. Oil Red O Staining
4.7. TG Assay
4.8. GPDH Activity Assay
4.9. Western Blot Analysis
4.10. qRT-PCR
4.11. Mitochondrial Mass Analysis
4.12. Immunofluorescence
4.13. mtDNA/nDNA Copy Numbere
4.14. HPLC Profile
4.15. Statistical Analyses
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Tseng, Y.H.; Cypess, A.M.; Kahn, C.R. Cellular bioenergetics as a target for obesity therapy. Nat. Rev. Drug Discov. 2010, 9, 465–482. [Google Scholar] [CrossRef] [Green Version]
- NCD Risk Factor Collaboration (NCD-RisC). Worldwide trends in body-mass index, underweight, overweight, and obesity from 1975 to 2016: A pooled analysis of 2416 population-based measurement studies in 128.9 million children, adolescents, and adults. Lancet 2017, 390, 2627–2642. [Google Scholar] [CrossRef] [Green Version]
- Kopelman, P.G. Obesity as a medical problem. Nature 2000, 404, 635–643. [Google Scholar] [CrossRef]
- Greenway, F.L.; Fujioka, K.; Plodkowski, R.A.; Mudaliar, S.; Guttadauria, M.; Erickson, J.; Kim, D.D.; Dunayevich, E.; Group, C.-I.S. Effect of naltrexone plus bupropion on weight loss in overweight and obese adults (COR-I): A multicentre, randomised, double-blind, placebo-controlled, phase 3 trial. Lancet 2010, 376, 595–605. [Google Scholar] [CrossRef] [PubMed]
- Gadde, K.M.; Allison, D.B.; Ryan, D.H.; Peterson, C.A.; Troupin, B.; Schwiers, M.L.; Day, W.W. Effects of low-dose, controlled-release, phentermine plus topiramate combination on weight and associated comorbidities in overweight and obese adults (CONQUER): A randomised, placebo-controlled, phase 3 trial. Lancet 2011, 377, 1341–1352. [Google Scholar] [CrossRef] [PubMed]
- Garvey, W.T.; Ryan, D.H.; Look, M.; Gadde, K.M.; Allison, D.B.; Peterson, C.A.; Schwiers, M.; Day, W.W.; Bowden, C.H. Two-year sustained weight loss and metabolic benefits with controlled-release phentermine/topiramate in obese and overweight adults (SEQUEL): A randomized, placebo-controlled, phase 3 extension study. Am. J. Clin. Nutr. 2012, 95, 297–308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hirsch, J.; Han, P.W. Cellularity of rat adipose tissue: Effects of growth, starvation, and obesity. J. Lipid. Res. 1969, 10, 77–82. [Google Scholar] [CrossRef]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef] [Green Version]
- Moseti, D.; Regassa, A.; Kim, W.K. Molecular Regulation of Adipogenesis and Potential Anti-Adipogenic Bioactive Molecules. Int. J. Mol. Sci. 2016, 17, 124. [Google Scholar] [CrossRef] [Green Version]
- Tanaka, T.; Yoshida, N.; Kishimoto, T.; Akira, S. Defective adipocyte differentiation in mice lacking the C/EBPbeta and/or C/EBPdelta gene. EMBO J. 1997, 16, 7432–7443. [Google Scholar] [CrossRef] [Green Version]
- Tang, Q.Q.; Lane, M.D. Adipogenesis: From stem cell to adipocyte. Ann. Rev. Biochem. 2012, 81, 715–736. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, L.Y.; Chen, C.W.; Chen, L.K.; Chou, H.Y.; Chang, C.L.; Juan, C.C. Curcumin Attenuates Adipogenesis by Inducing Preadipocyte Apoptosis and Inhibiting Adipocyte Differentiation. Nutrients 2019, 11, 2307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dave, S.; Kaur, N.J.; Nanduri, R.; Dkhar, H.K.; Kumar, A.; Gupta, P. Inhibition of adipogenesis and induction of apoptosis and lipolysis by stem bromelain in 3T3-L1 adipocytes. PLoS ONE 2012, 7, e30831. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- McMillan, A.C.; White, M.D. Induction of thermogenesis in brown and beige adipose tissues: Molecular markers, mild cold exposure and novel therapies. Curr. Opin. Endocrinol. Diabetes Obes. 2015, 22, 347–352. [Google Scholar] [CrossRef] [PubMed]
- Giralt, M.; Villarroya, F. White, brown, beige/brite: Different adipose cells for different functions? Endocrinology 2013, 154, 2992–3000. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lo, K.A.; Sun, L. Turning WAT into BAT: A review on regulators controlling the browning of white adipocytes. Biosci. Rep. 2013, 33, e00065. [Google Scholar] [CrossRef] [PubMed]
- Tseng, Y.H.; Kokkotou, E.; Schulz, T.J.; Huang, T.L.; Winnay, J.N.; Taniguchi, C.M.; Tran, T.T.; Suzuki, R.; Espinoza, D.O.; Yamamoto, Y.; et al. New role of bone morphogenetic protein 7 in brown adipogenesis and energy expenditure. Nature 2008, 454, 1000–1004. [Google Scholar] [CrossRef]
- Azhar, Y.; Parmar, A.; Miller, C.N.; Samuels, J.S.; Rayalam, S. Phytochemicals as novel agents for the induction of browning in white adipose tissue. Nutr. Metab. 2016, 13, 89. [Google Scholar] [CrossRef] [Green Version]
- Kang, T.H.; Jeong, S.J.; Kim, N.Y.; Higuchi, R.; Kim, Y.C. Sedative activity of two flavonol glycosides isolated from the flowers of Albizzia julibrissin Durazz. J. Ethnopharmacol. 2000, 71, 321–323. [Google Scholar] [CrossRef]
- Kwon, S.H.; Ma, S.X.; Hwang, J.Y.; Lee, S.Y.; Jang, C.G. Involvement of the Nrf2/HO-1 signaling pathway in sulfuretin-induced protection against amyloid beta25-35 neurotoxicity. Neuroscience 2015, 304, 14–28. [Google Scholar] [CrossRef]
- Zheng, L.; Zheng, J.; Zhao, Y.; Wang, B.; Wu, L.; Liang, H. Three anti-tumor saponins from Albizia julibrissin. Bioorg. Med. Chem. Lett. 2006, 16, 2765–2768. [Google Scholar] [CrossRef]
- Li, W.; Yang, H.J. Isolation and Identification of Lignans and Other Phenolic Constituents from the Stem Bark of Albizia julibrissin Durazz and Evaluation of Their Nitric Oxide Inhibitory Activity. Molecules 2020, 25, 2065. [Google Scholar] [CrossRef]
- Wise, L.S.; Green, H. Participation of one isozyme of cytosolic glycerophosphate dehydrogenase in the adipose conversion of 3T3 cells. J. Biol. Chem. 1979, 254, 273–275. [Google Scholar] [CrossRef]
- Harms, M.; Seale, P. Brown and beige fat: Development, function and therapeutic potential. Nat. Med. 2013, 19, 1252–1263. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, I.; Chu, C.T.; Kaufman, B.A. The mitochondrial transcription factor TFAM in neurodegeneration: Emerging evidence and mechanisms. FEBS Lett. 2018, 592, 793–811. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Canto, C.; Auwerx, J. PGC-1alpha, SIRT1 and AMPK, an energy sensing network that controls energy expenditure. Curr. Opin. Lipidol. 2009, 20, 98–105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- St-Pierre, J.; Jiandie, L.; Stefan, K.; Paul, T.T.; Ruojing, Y.; Christopher, B.N.; Bruce, M.S. Bioenergetic analysis of peroxisome proliferator-activated receptor gamma coactivators 1alpha and 1beta (PGC-1alpha and PGC-1beta) in muscle cells. J. Biol. Chem. 2003, 278, 26597–26603. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jung, M.J.; Kang, S.S.; Jung, H.A.; Kim, G.J.; Choi, J.S. Isolation of flavonoids and a cerebroside from the stem bark of Albizzia julibrissin. Arch. Pharm. Res. 2004, 27, 593–599. [Google Scholar] [CrossRef] [PubMed]
- Lau, C.S.; Carrier, D.J.; Beitle, R.R.; Bransby, D.I.; Howard, L.R.; Lay, J.O., Jr.; Liyanage, R.; Clausen, E.C. Identification and quantification of glycoside flavonoids in the energy crop Albizia julibrissin. Bioresour. Technol. 2007, 98, 429–435. [Google Scholar] [CrossRef]
- Vaughn, K.; McClain, C.; Carrier, D.J.; Wallace, S.; King, J.; Nagarajan, S.; Clausen, E. Effect of Albizia julibrissin water extracts on low-density lipoprotein oxidization. J. Agric. Food Chem. 2007, 55, 4704–4709. [Google Scholar] [CrossRef]
- Bostrom, P.; Wu, J.; Jedrychowski, M.P.; Korde, A.; Ye, L.; Lo, J.C.; Rasbach, K.A.; Bostrom, E.A.; Choi, J.H.; Long, J.Z.; et al. A PGC1-alpha-dependent myokine that drives brown-fat-like development of white fat and thermogenesis. Nature 2012, 481, 463–468. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rosen, E.D.; Hsu, C.H.; Wang, X.; Sakai, S.; Freeman, M.W.; Gonzalez, F.J.; Spiegelman, B.M. C/EBPalpha induces adipogenesis through PPARgamma: A unified pathway. Genes Dev. 2002, 16, 22–26. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Darlington, G.J.; Ross, S.E.; MacDougald, O.A. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 1998, 273, 30057–30060. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Asano, H.; Kanamori, Y.; Higurashi, S.; Nara, T.; Kato, K.; Matsui, T.; Funaba, M. Induction of beige-like adipocytes in 3T3-L1 cells. J. Vet. Med. Sci. 2014, 76, 57–64. [Google Scholar] [CrossRef] [Green Version]
- Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L.M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B.M. Transcriptional control of brown fat determination by PRDM16. Cell Metab. 2007, 6, 38–54. [Google Scholar] [CrossRef] [Green Version]
- Tiraby, C.; Tavernier, G.; Lefort, C.; Larrouy, D.; Bouillaud, F.; Ricquier, D.; Langin, D. Acquirement of brown fat cell features by human white adipocytes. J. Biol. Chem. 2003, 278, 33370–33376. [Google Scholar] [CrossRef] [Green Version]
- Kotzbeck, P.; Giordano, A.; Mondini, E.; Murano, I.; Severi, I.; Venema, W.; Cecchini, M.P.; Kershaw, E.E.; Barbatelli, G.; Haemmerle, G.; et al. Brown adipose tissue whitening leads to brown adipocyte death and adipose tissue inflammation. J. Lipid. Res. 2018, 59, 784–794. [Google Scholar] [CrossRef] [Green Version]
- Niemann, B.; Haufs-Brusberg, S.; Puetz, L.; Feickert, M.; Jaeckstein, M.Y.; Hoffmann, A.; Zurkovic, J.; Heine, M.; Trautmann, E.M.; Müller, C.E.; et al. Apoptotic brown adipocytes enhance energy expenditure via extracellular inosine. Nature 2022, 609, 361–368. [Google Scholar] [CrossRef]
- Zhang, J.; Yang, J.; Yang, N.; Ma, J.; Lu, D.; Dong, Y.; Liang, H.; Liu, D.; Cang, M. Dlgap1 negatively regulates browning of white fat cells through effects on cell proliferation and apoptosis. Lipids Health Dis. 2020, 19, 39. [Google Scholar] [CrossRef] [Green Version]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [Green Version]
- Kim, J.H.; Lee, S.; Cho, E.J. Flavonoids from Acer okamotoanum Inhibit Adipocyte Differentiation and Promote Lipolysis in the 3T3-L1 Cells. Molecules 2020, 25, 1920. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Berkoz, M. Effect of Hyperoside on the Inhibition of Adipogenesis in 3t3-L1 Adipocytes. Acta Endocrinol. 2019, 15, 165–172. [Google Scholar] [CrossRef] [PubMed]
- Quiros, P.M.; Goyal, A.; Jha, P.; Auwerx, J. Analysis of mtDNA/nDNA Ratio in Mice. Curr. Protoc. Mouse Biol. 2017, 7, 47–54. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
PRDM16 | AAGACGTTCGGTCAGCTCTCCA | CTGGCACTCATGTGGCTTCTCT |
UCP-1 | AGATCTTCTCAGCCGGAGTT | AGCTGATTTGCCTCTGAATG |
BMP7 | GGAGCGATTTGACAACGAGACC | AGTGGTTGCTGGTGGCTGTGAT |
TFAM | AATGTGGAGCGTGCTAAAAG | AGGGCTGCAATTTTCCTAAC |
GAPDH | GACCCCTTCATTGACCTC | GCTAAGCAGTTGGTGGTG |
Gene Name | Forward Primer | Reverse Primer |
---|---|---|
ND1 | CTAGCAGAAACAAACCGGGC | CCGGCTGCGTATTCTACGTT |
HK2 | GCCAGCCTCTCCTGATTTTAGTGT | GGGAACACAAAAGACCTCTTCTGG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, Y.; Ji, H.; Ryu, D.; Cho, E.; Park, D.; Jung, E. Albizia julibrissin Exerts Anti-Obesity Effects by Inducing the Browning of 3T3L1 White Adipocytes. Int. J. Mol. Sci. 2023, 24, 11496. https://doi.org/10.3390/ijms241411496
Kim Y, Ji H, Ryu D, Cho E, Park D, Jung E. Albizia julibrissin Exerts Anti-Obesity Effects by Inducing the Browning of 3T3L1 White Adipocytes. International Journal of Molecular Sciences. 2023; 24(14):11496. https://doi.org/10.3390/ijms241411496
Chicago/Turabian StyleKim, Yuna, Hyanggi Ji, Dehun Ryu, Eunae Cho, Deokhoon Park, and Eunsun Jung. 2023. "Albizia julibrissin Exerts Anti-Obesity Effects by Inducing the Browning of 3T3L1 White Adipocytes" International Journal of Molecular Sciences 24, no. 14: 11496. https://doi.org/10.3390/ijms241411496