Influence of Estrus on Dairy Cow Milk Exosomal miRNAs and Their Role in Hormone Secretion by Granulosa Cells
Abstract
1. Introduction
2. Results
2.1. Identification of Exosomes Isolated from Cow Milk
2.2. Characterization of Exosomes Derived from Estrous and Non-Estrous Cow Milk
2.3. Summary of Data Quality
2.4. Identification of Differentially Expressed miRNAs
2.5. miRNA Target Analysis
2.6. GO and KEGG Analysis of Differentially Expressed miRNA
2.7. Validation of miRNA Expression by qPCR
2.8. The Effect of Exosomes on Hormone Secretion and Endocrine-Related Gene Expression
2.9. The Effect of Exosomes on Apoptosis-Related Gene Expression
3. Discussion
4. Materials and Methods
4.1. Milk Samples
4.2. Exosome Preparation
4.3. Transmission Electron Microscopy
4.4. Exosome Protein Quantification
4.5. Exosome Characterization and Quantification
4.6. Western Blot Analysis
4.7. Small RNA Sequencing
4.8. MiRNA Analysis
4.9. Bovine Granulosa Cell Culture and Treatment with Exosomes
4.10. Detection of Expression of miRNAs and Genes by Real-Time PCR
4.11. Endocrine Secretion Detection
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lucy, M.C. Reproductive loss in high-producing dairy cattle: Where will it end? J. Dairy Sci. 2001, 84, 1277e93. [Google Scholar] [CrossRef] [PubMed]
- Adriaens, I.; Huybrechts, T.; Geerinckx, K.; Daems, D.; Lammertyn, J.; De Ketelaere, B.; Saeys, W.; Aernouts, B. Mathematical characterization of the milk progesterone profile as a leg up to individualized monitoring of reproduction status in dairy cows. Theriogenology 2017, 103, 44–51. [Google Scholar] [CrossRef] [PubMed]
- Ranasinghe, R.M.S.B.K.; Nakao, T.; Yamada, K.; Koike, K. Silent ovulation, based on walking activity and milk progesterone concentrations, in Holstein cows housed in a free-stall barn. Theriogenology 2010, 73, 942–949. [Google Scholar] [CrossRef]
- Bisinotto, R.S.; Ribeiro, E.S.; Santos, J.E. Synchronisation of ovulation for management of reproduction in dairy cows. Animal 2014, 8 (Suppl. S1), 151–159. [Google Scholar] [CrossRef]
- Stevenson, J.S.; Britt, J.H. A 100-Year Review: Practical female reproductive management. J. Dairy. Sci. 2017, 100, 10292–10313. [Google Scholar] [CrossRef] [PubMed]
- Roelofs, J.; Lopez-Gatius, F.; Hunter, R.H.; van Eerdenburg, F.J.; Hanzen, C.H. When is a cow in estrus? Clinical and practical aspects. Theriogenology 2010, 74, 327–344. [Google Scholar] [CrossRef] [PubMed]
- Leroy, C.; Walton, J.; Leblanc, S. Estrous detection intensity and accuracy and optimal timing of insemination with automated activity monitors for dairy cows. J. Dairy. Sci. 2018, 101, 1638–1647. [Google Scholar] [CrossRef]
- Mayo, L.M.; Silvia, W.J.; Ray, D.L.; Jones, B.W.; Stone, A.E.; Tsai, I.C.; Clark, J.D.; Bewley, J.M.; Heersche, G. Automated estrous detection using multiple commercial precision dairy monitoring technologies in synchronized dairy cows. J. Dairy. Sci. 2019, 102, 2645–2656. [Google Scholar] [CrossRef]
- Bruinjé, T.C.; Ambrose, D.J. Technical note: Validation of an automated in-line milk progesterone analysis system to diagnose pregnancy in dairy cattle. J. Dairy Sci. 2019, 102, 3615–3621. [Google Scholar] [CrossRef]
- Mozūraitis, R.; Kutra, J.; Borg-Karlson, A.K.; Būda, V. Dynamics of putative sex pheromone components during heat periods in estrus-induced cows. J. Dairy Sci. 2017, 100, 7686–7695. [Google Scholar] [CrossRef]
- Zebari, H.M.; Rutter, S.M.; Bleach, E.C. Fatty acid profile of milk for determining reproductive status in lactating Holstein Friesian cows. Anim. Reprod. Sci. 2019, 202, 26–34. [Google Scholar] [CrossRef] [PubMed]
- Toledo-Alvarado, H.; Vazquez, A.I.; de los Campos, G.; Tempelman, R.J.; Gabai, G.; Cecchinato, A.; Bittante, G. Changes in milk characteristics and fatty acid profile during the estrous cycle in dairy cows. J. Dairy Sci. 2018, 101, 9135–9153. [Google Scholar] [CrossRef] [PubMed]
- Zhao, C.; Bai, Y.; Fu, S.; Wu, L.; Xia, C.; Xu, C. Comparison of Metabolic Alterations in Serum and Milk Whey Between Inactive Ovaries and Estrus Dairy Cows. Front. Vet. Sci. 2021, 7, 609391. [Google Scholar] [CrossRef] [PubMed]
- Du, C.; Nan, L.; Li, C.; Sabek, A.; Wang, H.; Luo, X.; Su, J.; Hua, G.; Ma, Y.; Zhang, S. Influence of Estrus on the Milk Characteristics and Mid-Infrared Spectra of Dairy Cows. Animals 2021, 11, 1200. [Google Scholar] [CrossRef]
- Izumi, H.; Tsuda, M.; Sato, Y.; Kosaka, N.; Ochiya, T.; Iwamoto, H.; Namba, K.; Takeda, Y. Bovine milk exosomes contain microRNA and mRNA and are taken up by human macrophages. J. Dairy Sci. 2015, 98, 2920–2933. [Google Scholar] [CrossRef]
- Pathan, M.; Fonseka, P.; Chitti, S.V.; Kang, T.; Sanwlani, R.; Van Deun, J.; Hendrix, A.; Mathivanan, S. Vesiclepedia 2019: A compendium of RNA, proteins, lipids and metabolites in extracellular vesicles. Nucleic Acids Res. 2019, 47, D516–D519. [Google Scholar] [CrossRef]
- Gurung, S.; Greening, D.W.; Catt, S.; Salamonsen, L.; Evans, J. Exosomes and soluble secretome from hormone-treated endometrial epithelial cells direct embryo implantation. Mol. Hum. Reprod. 2020, 26, 510–520. [Google Scholar] [CrossRef]
- Evans, J.; Rai, A.; Nguyen, H.P.T.; Poh, Q.H.; Elglass, K.; Simpson, R.J.; Salamonsen, L.A.; Greening, D.W. Human Endometrial Extracellular Vesicles Functionally Prepare Human Trophectoderm Model for Implantation: Understanding Bidirectional Maternal-Embryo Communication. Proteomics 2019, 19, e1800423. [Google Scholar] [CrossRef]
- Gu, Y.; Li, M.; Wang, T.; Liang, Y.; Zhong, Z.; Wang, X.; Zhou, Q.; Chen, L.; Lang, Q.; He, Z.; et al. Lactation-related microRNA expression profiles of porcine breast milk exosomes. PLoS ONE. 2012, 7, e43691. [Google Scholar] [CrossRef]
- Mincheva-Nilsson, L.; Baranov, V. The role of placental exosomes in reproduction. Am. J. Reprod. Immunol. 2010, 63, 520–533. [Google Scholar] [CrossRef]
- Yuan, C.; Li, Z.; Zhao, Y.; Wang, X.; Chen, L.; Zhao, Z.; Cao, M.; Chen, T.; Iqbal, T.; Zhang, B.; et al. Follicular fluid exosomes: Important modulator in proliferation and steroid synthesis of porcine granulosa cells. FASEB J. 2021, 35, e21610. [Google Scholar] [CrossRef] [PubMed]
- de Ávila, A.C.F.C.M.; Bridi, A.; Andrade, G.M.; Del Collado, M.; Sangalli, J.R.; Nociti, R.P.; da Silva Junior, W.A.; Bastien, A.; Robert, C.; Meirelles, F.V.; et al. Estrous cycle impacts microRNA content in extracellular vesicles that modulate bovine cumulus cell transcripts during in vitro maturation. Biol. Reprod. 2020, 102, 362–375. [Google Scholar] [CrossRef] [PubMed]
- Zhao, G.; Yang, C.; Yang, J.; Liu, P.; Jiang, K.; Shaukat, A.; Wu, H.; Deng, G. Placental exosome-mediated Bta-miR-499-Lin28B/let-7 axis regulates inflammatory bias during early pregnancy. Cell. Death Dis. 2018, 9, 704. [Google Scholar] [CrossRef]
- Liu, W.M.; Cheng, R.R.; Niu, Z.R.; Chen, A.C.; Ma, M.Y.; Li, T.; Chiu, P.C.; Pang, R.T.; Lee, Y.L.; Ou, J.P.; et al. Let-7 derived from endometrial extracellular vesicles is an important inducer of embryonic diapause in mice. Sci. Adv. 2020, 6, eaaz7070. [Google Scholar] [CrossRef] [PubMed]
- Inchaisri, C.; Jorritsma, R.; Vos, P.L.; van der Weijden, G.C.; Hogeveen, H. Economic consequences of reproductive performance in dairy cattle. Theriogenology 2010, 74, 835–846. [Google Scholar] [CrossRef] [PubMed]
- van Hooijdonk, A.C.; Kussendrager, K.D.; Steijns, J.M. In vivo antimicrobial and antiviral activity of components in bovine milk and colostrum involved in non-specific defence. Br. J. Nutr. 2000, 84 (Suppl. S1), 127–134. [Google Scholar] [CrossRef]
- Wolf, T.; Baier, S.R.; Zempleni, J. The Intestinal Transport of Bovine Milk Exosomes Is Mediated by Endocytosis in Human Colon Carcinoma Caco-2 Cells and Rat Small Intestinal IEC-6 Cells. J. Nutr. 2015, 145, 2201–2206. [Google Scholar] [CrossRef] [PubMed]
- Rani, P.; Vashisht, M.; Golla, N.; Shandilya, S.; Onteru, S.K.; Singh, D. Milk miRNAs encapsulated in exosomes are stable to human digestion and permeable to intestinal barrier in vitro. J. Funct. Foods. 2017, 34, 431–439. [Google Scholar] [CrossRef]
- Lopez, H.; Satter, L.D.; Wiltbank, M.C. Relationship between level of milk production and estrous behavior of lactating dairy cows. Anim. Reprod. Sci. 2004, 81, 209–223. [Google Scholar] [CrossRef]
- Harrison, R.O.; Ford, S.P.; Young, J.W.; Conley, A.J.; Freeman, A.E. Increased milk production versus reproductive and energy status of high producing dairy cows. J. Dairy. Sci. 1990, 73, 2749–2758. [Google Scholar] [CrossRef]
- Adriaens, I.; Saeys, W.; Huybrechts, T.; Lamberigts, C.; François, L.; Geerinckx, K.; Leroy, J.; De Ketelaere, B.; Aernouts, B. A novel system for on-farm fertility monitoring based on milk progesterone. J. Dairy. Sci. 2018, 101, 8369–8382. [Google Scholar] [CrossRef] [PubMed]
- Borchardt, S.; Tippenhauer, C.M.; Plenio, J.L.; Bartel, A.; Madureira, A.M.L.; Cerri, R.L.A.; Heuwieser, W. Association of estrous expression detected by an automated activity monitoring system within 40 days in milk and reproductive performance of lactating Holstein cows. J. Dairy. Sci. 2021, 104, 9195–9204. [Google Scholar] [CrossRef] [PubMed]
- Ioannidis, J.; Donadeu, F.X. Circulating microRNA Profiles during the Bovine Oestrous Cycle. PLoS ONE. 2016, 11, e0158160. [Google Scholar] [CrossRef] [PubMed]
- Lu, T.; Zou, X.; Liu, G.; Deng, M.; Sun, B.; Guo, Y.; Liu, D.; Li, Y. A Preliminary Study on the Characteristics of microRNAs in Ovarian Stroma and Follicles of Chuanzhong Black Goat during Estrus. Genes 2020, 11, 970. [Google Scholar] [CrossRef] [PubMed]
- Zou, X.; Lu, T.; Zhao, Z.; Liu, G.; Lian, Z.; Guo, Y.; Sun, B.; Liu, D.; Li, Y. Comprehensive analysis of mRNAs and miRNAs in the ovarian follicles of uniparous and multiple goats at estrus phase. BMC Genom. 2020, 21, 267. [Google Scholar] [CrossRef]
- Gad, A.; Sánchez, J.M.; Browne, J.A.; Nemcova, L.; Laurincik, J.; Prochazka, R.; Lonergan, P. Plasma extracellular vesicle miRNAs as potential biomarkers of superstimulatory response in cattle. Sci. Rep. 2020, 10, 19130. [Google Scholar] [CrossRef]
- Donadeu, F.X.; Schauer, S.N.; Sontakke, S.D. Involvement of miRNAs in ovarian follicular and luteal development. J. Endocrinol. 2012, 215, 323. [Google Scholar] [CrossRef]
- Huang, J.; Ju, Z.; Li, Q.; Hou, Q.; Wang, C.; Li, J.; Li, R.; Wang, L.; Sun, T.; Hang, S.; et al. Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle. Int. J. Biol. Sci. 2011, 7, 1016–1026. [Google Scholar] [CrossRef]
- Yin, M.; Lu, M.; Yao, G.; Tian, H.; Lian, J.; Liu, L.; Liang, M.; Wang, Y.; Sun, F. Transactivation of microRNA-383 by steroidogenic factor-1 promotes estradiol release from mouse ovarian granulosa cells by targeting RBMS1. Mol. Endocrinol. 2012, 26, 1129–1143. [Google Scholar] [CrossRef]
- Salilew-Wondim, D.; Ahmad, I.; Gebremedhn, S.; Sahadevan, S.; Hossain, M.D.; Rings, F.; Hoelker, M.; Tholen, E.; Neuhoff, C.; Looft, C.; et al. The expression pattern of microRNAs in granulosa cells of subordinate and dominant follicles during the early luteal phase of the bovine estrous cycle. PLoS ONE 2014, 9, e106795. [Google Scholar] [CrossRef]
- Hata, T.; Murakami, K.; Nakatani, H.; Yamamoto, Y.; Matsuda, T.; Aoki, N. Isolation of bovine milk-derived microvesicles carrying mRNAs and microRNAs. Biochem. Biophys. Res. Commun. 2010, 396, 528–533. [Google Scholar] [CrossRef] [PubMed]
- Götze, A.; Honnens, A.; Flachowsky, G.; Bollwein, H. Variability of mammary blood flow in lactating Holstein-Friesian cows during the first twelve weeks of lactation. J. Dairy. Sci. 2010, 93, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Sabapatha, A.; Gercel-Taylor, C.; Taylor, D.D. Specific isolation of placenta-derived exosomes from the circulation of pregnant women and their immunoregulatory consequences. Am. J. Reprod. Immunol. 2006, 56, 345–355. [Google Scholar] [CrossRef]
- Chowdhury, I.; Thomas, K.; Zeleznik, A.; Thompson, W.E. Prohibitin regulates the FSH signaling pathway in rat granulosa cell differentiation. J. Mol. Endocrinol. 2016, 56, 325–336. [Google Scholar] [CrossRef] [PubMed]
- Carson, R.S.; Findlay, J.K.; Clarke, I.J.; Burger, H.G. Estradiol, testosterone, and androstenedione in ovine follicular fluid during growth and atresia of ovarian follicles. Biol. Reprod. 1981, 24, 105–113. [Google Scholar] [CrossRef]
- Webb, R.; England, B.G. Identification of the ovulatory follicle in the ewe: Associated changes in follicular size, thecal and granulosa cell LH receptors, antral fluid steroids and circulating hormones during the preovulatory period. Endocrinology 1982, 110, 873–881. [Google Scholar] [CrossRef]
- Wen, X.; Tozer, A.J.; Li, D.; Docherty, S.M.; Al-Shawaf, T.; Iles, R.K. Human granulosa-lutein cell in vitro production of progesterone, inhibin A, inhibin B, and activin A are dependent on follicular size and not the presence of the oocyte. Fertil. Steril. 2008, 89 (Suppl. 5), 1406–1413. [Google Scholar] [CrossRef]
- Sangsritavong, S.; Combs, D.K.; Sartori, R.; Armentano, L.E.; Wiltbank, M.C. High feed intake increases liver blood flow and metabolism of progesterone and estradiol-17beta in dairy cattle. J. Dairy Sci. 2002, 85, 2831–2842. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, X.; Yang, C.; Liu, Q.; Ran, Z.; Li, X.; He, C. A mouse model reveals the events and underlying regulatory signals during the gonadotrophin-dependent phase of follicle development. Mol. Hum. Reprod. 2020, 26, 920–937. [Google Scholar] [CrossRef]
- Santos, P.H.; Satrapa, R.A.; Fontes, P.K.; Franchi, F.F.; Razza, E.M.; Mani, F.; Nogueira, M.F.G.; Barros, C.M.; Castilho, A.C.S. Effect of superstimulation on the expression of microRNAs and genes involved in steroidogenesis and ovulation in Nelore cows. Theriogenology 2018, 110, 192–200. [Google Scholar] [CrossRef]
- Pan, Z.; Zhang, J.; Lin, F.; Ma, X.; Wang, X.; Liu, H. Expression profiles of key candidate genes involved in steroidogenesis during follicular atresia in the pig ovary. Mol. Biol. Rep. 2012, 39, 10823–10832. [Google Scholar] [CrossRef] [PubMed]
- Zhen, Y.; Wang, L.; Riaz, H.; Wu, J.; Yuan, Y.; Han, L.; Wang, Y.; Zhao, Y.; Dan, Y.; Huo, L. Knockdown of CEBPβ by RNAi in porcine granulosa cells resulted in S phase cell cycle arrest and decreased progesterone and estradiol synthesis. J. Steroid Biochem. Mol. Biol. 2014, 143, 90–98. [Google Scholar] [CrossRef] [PubMed]
- Miller, W.L. Steroidogenic acute regulatory protein (StAR), a novel mitochondrial cholesterol transporter. Biochim. Biophys. Acta. 2007, 1771, 663–676. [Google Scholar] [CrossRef] [PubMed]
- Hung, W.T.; Navakanitworakul, R.; Khan, T.; Zhang, P.; Davis, J.S.; McGinnis, L.K.; Christenson, L.K. Stage-specific follicular extracellular vesicle uptake and regulation of bovine granulosa cell proliferation. Biol. Reprod. 2017, 97, 644–655. [Google Scholar] [CrossRef]
- Knight, P.G.; Glister, C. TGF-beta superfamily members and ovarian follicledevelopment. Reproduction 2006, 132, 191–206. [Google Scholar] [CrossRef]
- Gasperin, B.G.; Rovani, M.T.; Ferreira, R.; Ilha, G.F.; Bordignon, V.; Gonçalves, P.B.; Duggavathi, R. Functional status of STAT3 and MAPK3/1 signaling pathways in granulosa cells during bovine follicular deviation. Theriogenology 2015, 83, 353–359. [Google Scholar] [CrossRef]
- Ryan, K.E.; Glister, C.; Lonergan, P.; Martin, F.; Knight, P.G.; Evans, A.C. Functional significance of the signal transduction pathways Akt and Erk in ovarian follicles: In vitro and in vivo studies in cattle and sheep. J. Ovarian Res. 2008, 1, 2. [Google Scholar] [CrossRef]
- Cheng, Y.; Feng, Y.; Jansson, L.; Sato, Y.; Deguchi, M.; Kawamura, K.; Hsueh, A.J. Actin polymerization-enhancing drugs promote ovarian follicle growth mediated by the hippo signaling effector YAP. FASEB J. 2015, 29, 2423–2430. [Google Scholar] [CrossRef]
- Cunningham, M.A.; Zhu, Q.; Hammond, J.M. FoxO1a can Alter cell cycle progression by regulating the nuclear localization of p27kip in granulosa cells. Mol. Endocrinol. 2004, 18, 1756–1767. [Google Scholar] [CrossRef]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular growth and atresia in mammalian ovaries: Regulation by survival and death of granulosa cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef]
- Kaipia, A.; Hsueh, A.J. Regulation of ovarian follicle atresia. Annu. Rev. Physiol. 1997, 59, 349–363. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.; Jo, M.; Lee, E.; Choi, D. Induction of apoptotic cell death via accumulation of autophagosomes in rat granulosa cells. Fertil. Steril. 2011, 95, 1482–1486. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Wang, S.; Zhou, J.; Pang, X.; Wang, L. RNAi-mediated knockdown of MTNR1B without disrupting the effects of melatonin on apoptosis and cell cycle in bovine granulose cells. PeerJ. 2018, 6, e4463. [Google Scholar] [CrossRef] [PubMed]
- Okamoto, A.; Ikeda, M.; Kaneko, A.; Kishida, C.; Shimada, M.; Yamashita, Y. The novel pig in vitro maturation system to improve developmental competence of oocytes derived from atretic non-vascularized follicle. Biol. Reprod. 2016, 95, 7. [Google Scholar] [CrossRef]
- Besnard, N.; Horne, E.A.; Whitehead, S.A. Prolactin and lipopolysaccharide treatment increased apoptosis and atresia in rat ovarian follicles. Acta Physiol. Scand. 2001, 172, 17–25. [Google Scholar] [CrossRef]
- Gao, H.N.; Ren, F.Z.; Wen, P.C.; Xie, L.X.; Wang, R.; Yang, Z.N.; Li, Y.X. Yak milk-derived exosomal microRNAs regulate intestinal epithelial cells on proliferation in hypoxic environment. J. Dairy Sci. 2021, 104, 1291–1303. [Google Scholar] [CrossRef]
- Gao, H.N.; Guo, H.Y.; Zhang, H.; Xie, X.L.; Wen, P.C.; Ren, F.Z. Yak-milk-derived exosomes promote proliferation of intestinal epithelial cells in an hypoxic environment. J. Dairy Sci. 2019, 102, 985–996. [Google Scholar] [CrossRef] [PubMed]
- Sahmi, F.; Sahmi, M.; Gévry, N.; Sahadevan, P.; Allen, B.G.; Price, C.A. A putative protein-RNA complex regulates posttranscriptional processing of cytochrome P450 aromatase (CYP19A1) in bovine granulosa cells. Mol. Reprod. Dev. 2019, 86, 1901–1908. [Google Scholar] [CrossRef]
- Wu, S.; Sun, H.; Zhang, Q.; Jiang, Y.; Fang, T.; Cui, I.; Yan, G.; Hu, Y. MicroRNA-132 promotes estradiol synthesis in ovarian granulosa cells via translational repression of Nurr1. Reprod. Biol. Endocrinol. 2015, 13, 94. [Google Scholar] [CrossRef]
- Dai, A.; Sun, H.; Fang, T.; Zhang, Q.; Wu, S.; Jiang, Y.; Ding, L.; Yan, G.; Hu, Y. MicroRNA-133b stimulates ovarian estradiol synthesis by targeting Foxl2. FEBS Lett. 2013, 587, 2474–2482. [Google Scholar] [CrossRef]
- Hilker, R.E.; Pan, B.; Zhan, X.; Li, J. MicroRNA-21 enhances estradiol production by inhibiting WT1 expression in granulosa cells. J. Mol. Endocrinol. 2022, 68, 11–22. [Google Scholar] [CrossRef] [PubMed]
- Gao, S.; Zhao, J.; Xu, Q.; Guo, Y.; Liu, M.; Zhang, C.; Zhou, B. MiR-31 targets HSD17B14 and FSHR, and miR-20b targets HSD17B14 to affect apoptosis and steroid hormone metabolism of porcine ovarian granulosa cells. Theriogenology 2022, 180, 94–102. [Google Scholar] [CrossRef] [PubMed]
- Cai, J.H.; Sun, Y.T.; Bao, S. HucMSCs-exosomes containing miR-21 promoted estrogen production in ovarian granulosa cells via LATS1-mediated phosphorylation of LOXL2 and YAP. Gen. Comp. Endocrinol. 2022, 321, 114015. [Google Scholar] [CrossRef] [PubMed]
- Mutai, E.; Ramer-Tait, A.E.; Zempleni, J. MicroRNAs in bovine milk exosomes are bioavailable in humans but do not elicit a robust pro-inflammatory cytokine response. ExRNA 2020, 2, 2. [Google Scholar] [CrossRef]
- Manca, S.; Upadhyaya, B.; Mutai, E.; Desaulniers, A.T.; Cederberg, R.A.; White, B.R.; Zempleni, J. Milk exosomes are bioavailable and distinct microRNA cargos have unique tissue distribution patterns. Sci. Rep. 2018, 8, 11321. [Google Scholar] [CrossRef]
- Sadri, M.; Shu, J.; Kachman, S.D.; Cui, J.; Zempleni, J. Milk exosomes and miRNA cross the placenta and promote embryo survival in mice. Reproduction 2020, 160, 501–509. [Google Scholar] [CrossRef]
- Wellnitz, O.; Bruckmaier, R.M. Invited review: The role of the blood-milk barrier and its manipulation for the efficacy of the mammary immune response and milk production. J. Dairy Sci. 2021, 104, 6376–6388. [Google Scholar] [CrossRef]
- Vaswani, K.; Koh, Y.Q.; Almughlliq, F.B.; Peiris, H.N.; Mitchell, M.D. A method for the isolation and enrichment of purified bovine milk exosomes. Reprod. Biol. 2017, 17, 341–348. [Google Scholar] [CrossRef]
- Thery, C.; Amigorena, S.; Raposo, G.; Clayton, A. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr. Protoc. Cell. Biol. 2006, 30, 22. [Google Scholar] [CrossRef]
- Kusuma, R.J.; Manca, S.; Friemel, T.; Sukreet, S.; Nguyen, C.; Zempleni, J. Human vascular endothelial cells transport foreign exosomes from cow’s milk by endocytosis. Am. J. Physiol. Cell. Physiol. 2016, 310, C800–C807. [Google Scholar] [CrossRef]
- Tian, Y.; Ma, L.; Gong, M.; Su, G.; Zhu, S.; Zhang, W.; Wang, S.; Li, Z.; Chen, C.; Li, L.; et al. Protein Profiling and Sizing of Extracellular Vesicles from Colorectal Cancer Patients via Flow Cytometry. ACS Nano 2018, 12, 671–680. [Google Scholar] [CrossRef] [PubMed]
- Dong, L.; Zieren, R.C.; Horie, K.; Kim, C.J.; Mallick, E.; Jing, Y.; Feng, M.; Kuczler, M.D.; Green, J.; Amend, S.R.; et al. Comprehensive evaluation of methods for small extracellular vesicles separation from human plasma, urine and cell culture medium. J. Extracell. Vesicles 2020, 10, e12044. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Trapnell, C.; Pop, M.; Salzberg, S.L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009, 10, R25. [Google Scholar] [CrossRef] [PubMed]
- Pflug, F.G.; von Haeseler, A. TRUmiCount: Correctly counting absolute numbers of molecules using unique molecular identifiers. Bioinformatics 2018, 34, 3137–3144. [Google Scholar] [CrossRef]
- Wang, L.; Feng, Z.; Wang, X.; Wang, X.; Zhang, X. DEGseq: An R package for identifying differentially expressed genes from RNA-seq data. Bioinformatics 2010, 26, 136–138. [Google Scholar] [CrossRef]
- Krüger, J.; Rehmsmeier, M. RNAhybrid: microRNA target prediction easy, fast and flexible. Nucleic Acids Res. 2006, 34 (Suppl. S2), W451–W454. [Google Scholar] [CrossRef]
- John, B.; Enright, A.J.; Aravin, A.; Tuschl, T.; Sander, C.; Marks, D.S. Human MicroRNA targets. PLoS Biol. 2005, 3, e264. [Google Scholar] [CrossRef]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef]
- Wang, S.; Liu, W.; Wang, L.; Pang, X.; Yang, L. The role of Melatonin receptor MTNR1A in the action of Melatonin on bovine granulosa cells. Mol. Reprod. 2017, 84, 1140–1154. [Google Scholar] [CrossRef]
- Wang, S.; Liu, W.; Pang, X.; Dai, S.; Liu, G. The Mechanism of Melatonin and Its Receptor MT2 Involved in the Development of Bovine Granulosa Cells. Int. J. Mol. Sci. 2018, 19, 2028. [Google Scholar] [CrossRef]
- Wang, S.; Liu, W.; Wen, A.; Yang, B.; Pang, X. Luzindole and 4P-PDOT block the effect of melatonin on bovine granulosa cell apoptosis and cell cycle depending on its concentration. PeerJ 2021, 9, e10627. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward Primer Sequence (5′→3′) | Reverse Primer Sequence (5′→3′) |
---|---|---|
CYP11A1 | ATGCTGGAGGAGACAGTGAACC | GCAGTAGAGGATGCCTGGGTAA |
CYP19A1 | CACCCATCTTTGCCAGGTAGTC | ACCCACAGGAGGTAAGCCTATAAA |
StAR | GTG GAT TTT GCC AAT CAC CT | TTATTG AAA ACG TGC CAC CA |
RUNX2 | AAGGCAAGGCTAGGTGGAAT | AGAGGGGCACAGACTTTGAA |
HSD-3β | TGCCACAATCTGACCGCATC | CTCCACCAACAGGCAGATGA |
Bcl-2 | CGCATCGTGGCCTTCTTTGAGTT | GCCGGTTCAGGTACTCAGTCAT |
p53 | CCTCCCAGAAGACCTACCCT | CTCCGTCATGTGCTCCAACT |
Caspase-3 | CAGACAGTGGTGCTGAGGATGA | GCTACCTTTCGGTTAACCCGA |
β-actin | CATCGGCAATGAGCGGTTCC | CCGTGTTGGCGTAGAGGTCC |
bta-miR-3141 | AACAATGAGGGCGGGTGGA | |
bta-miR-154a | ACCACCGTAGGTTATCCGTGT | |
bta-miR-432 | AACCGGTCTTGGAGTAGGTCA | |
bta-miR-339b | AACAAGTCCCTGTCCTCCAGG | |
bta-let-7a-3p | CTATACAATCTACTGTCTTTC | |
bta-miR-1777a | ATTAATTGGGGGCGGTGGG | |
bta-miR-29c | GGGTAGCACCATTTGAAAT | |
bta-miR-502b | AACCATGAATCCACCTGGGC | |
bta-miR-664a | AACGATACAGGCTGGGGTGT | |
bta-miR-409b | AACAATGGGGTTCACCGAGC | |
U6 | GCTTCGGCAGCACATATACTAAAAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, W.; Du, C.; Nan, L.; Li, C.; Wang, H.; Fan, Y.; Zhou, A.; Zhang, S. Influence of Estrus on Dairy Cow Milk Exosomal miRNAs and Their Role in Hormone Secretion by Granulosa Cells. Int. J. Mol. Sci. 2023, 24, 9608. https://doi.org/10.3390/ijms24119608
Liu W, Du C, Nan L, Li C, Wang H, Fan Y, Zhou A, Zhang S. Influence of Estrus on Dairy Cow Milk Exosomal miRNAs and Their Role in Hormone Secretion by Granulosa Cells. International Journal of Molecular Sciences. 2023; 24(11):9608. https://doi.org/10.3390/ijms24119608
Chicago/Turabian StyleLiu, Wenju, Chao Du, Liangkang Nan, Chunfang Li, Haitong Wang, Yikai Fan, Ao Zhou, and Shujun Zhang. 2023. "Influence of Estrus on Dairy Cow Milk Exosomal miRNAs and Their Role in Hormone Secretion by Granulosa Cells" International Journal of Molecular Sciences 24, no. 11: 9608. https://doi.org/10.3390/ijms24119608
APA StyleLiu, W., Du, C., Nan, L., Li, C., Wang, H., Fan, Y., Zhou, A., & Zhang, S. (2023). Influence of Estrus on Dairy Cow Milk Exosomal miRNAs and Their Role in Hormone Secretion by Granulosa Cells. International Journal of Molecular Sciences, 24(11), 9608. https://doi.org/10.3390/ijms24119608