Isoquercitrin Attenuates Steatohepatitis by Inhibition of the Activated NLRP3 Inflammasome through HSP90
Abstract
1. Introduction
2. Results
2.1. Effects of IQ on the MCD-Induced Steatohepatitis Mice Model
2.2. Effects of IQ on Anti-Oxidative Stress and Anti-Inflammation
2.3. Transcriptomics Study on the Liver Tissue of MCD-Induced Mice
2.4. Effects of IQ on the HSP90-NlLRP3 Pathway
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Treatment of Animals and Transcriptomics Study
4.3. Biochemical Measurement
4.4. Histopathological Staining and Immunohistochemical Analysis
4.5. Real-Time Quantitative PCR (RT-qPCR) Analysis
4.6. Western Blotting
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Eslam, M.; Sanyal, A.J.; George, J. International Consensus Panel MAFLD: A Consensus-Driven Proposed Nomenclature for Metabolic Associated Fatty Liver Disease. Gastroenterology 2020, 158, 1999–2014.e1. [Google Scholar] [CrossRef]
- Younossi, Z.; Tacke, F.; Arrese, M.; Chander Sharma, B.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Yilmaz, Y.; George, J.; Fan, J.; et al. Global Perspectives on Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef]
- Younossi, Z.; Anstee, Q.M.; Marietti, M.; Hardy, T.; Henry, L.; Eslam, M.; George, J.; Bugianesi, E. Global Burden of NAFLD and NASH: Trends, Predictions, Risk Factors and Prevention. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 11–20. [Google Scholar] [CrossRef]
- Younossi, Z.; Stepanova, M.; Ong, J.P.; Jacobson, I.M.; Bugianesi, E.; Duseja, A.; Eguchi, Y.; Wong, V.W.; Negro, F.; Yilmaz, Y.; et al. Nonalcoholic Steatohepatitis Is the Fastest Growing Cause of Hepatocellular Carcinoma in Liver Transplant Candidates. Clin. Gastroenterol. Hepatol. Off. Clin. Pract. J. Am. Gastroenterol. Assoc. 2019, 17, 748–755.e3. [Google Scholar] [CrossRef]
- Tosello-Trampont, A.-C.; Landes, S.G.; Nguyen, V.; Novobrantseva, T.I.; Hahn, Y.S. Kuppfer Cells Trigger Nonalcoholic Steatohepatitis Development in Diet-Induced Mouse Model through Tumor Necrosis Factor-α Production. J. Biol. Chem. 2012, 287, 40161–40172. [Google Scholar] [CrossRef]
- Henao-Mejia, J.; Elinav, E.; Jin, C.; Hao, L.; Mehal, W.Z.; Strowig, T.; Thaiss, C.A.; Kau, A.L.; Eisenbarth, S.C.; Jurczak, M.J.; et al. Inflammasome-Mediated Dysbiosis Regulates Progression of NAFLD and Obesity. Nature 2012, 482, 179–185. [Google Scholar] [CrossRef]
- Szabo, G.; Petrasek, J. Inflammasome Activation and Function in Liver Disease. Nat. Rev. Gastroenterol. Hepatol. 2015, 12, 387–400. [Google Scholar] [CrossRef]
- Szabo, G.; Csak, T. Inflammasomes in Liver Diseases. J. Hepatol. 2012, 57, 642–654. [Google Scholar] [CrossRef]
- Benetti, E.; Chiazza, F.; Patel, N.S.A.; Collino, M. The NLRP3 Inflammasome as a Novel Player of the Intercellular Crosstalk in Metabolic Disorders. Mediat. Inflamm. 2013, 2013, 678627. [Google Scholar] [CrossRef]
- Abais, J.M.; Xia, M.; Zhang, Y.; Boini, K.M.; Li, P.-L. Redox Regulation of NLRP3 Inflammasomes: ROS as Trigger or Effector? Antioxid. Redox Signal. 2015, 22, 1111–1129. [Google Scholar] [CrossRef]
- Wree, A.; McGeough, M.D.; Peña, C.A.; Schlattjan, M.; Li, H.; Inzaugarat, M.E.; Messer, K.; Canbay, A.; Hoffman, H.M.; Feldstein, A.E. NLRP3 Inflammasome Activation Is Required for Fibrosis Development in NAFLD. J. Mol. Med. Berl. Ger. 2014, 92, 1069–1082. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Hong, W.; Lu, S.; Li, Y.; Guan, Y.; Weng, X.; Feng, Z. The NLRP3 Inflammasome in Non-Alcoholic Fatty Liver Disease and Steatohepatitis: Therapeutic Targets and Treatment. Front. Pharmacol. 2022, 13, 780496. [Google Scholar] [CrossRef] [PubMed]
- Eguchi, A.; Povero, D.; Alkhouri, N.; Feldstein, A.E. Novel Therapeutic Targets for Nonalcoholic Fatty Liver Disease. Expert Opin. Ther. Targets 2013, 17, 773–779. [Google Scholar] [CrossRef] [PubMed]
- Ebrahimpour, S.; Zakeri, M.; Esmaeili, A. Crosstalk between Obesity, Diabetes, and Alzheimer’s Disease: Introducing Quercetin as an Effective Triple Herbal Medicine. Ageing Res. Rev. 2020, 62, 101095. [Google Scholar] [CrossRef]
- Miltonprabu, S.; Tomczyk, M.; Skalicka-Woźniak, K.; Rastrelli, L.; Daglia, M.; Nabavi, S.F.; Alavian, S.M.; Nabavi, S.M. Hepatoprotective Effect of Quercetin: From Chemistry to Medicine. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2017, 108, 365–374. [Google Scholar] [CrossRef]
- Arab, J.P.; Arrese, M.; Trauner, M. Recent Insights into the Pathogenesis of Nonalcoholic Fatty Liver Disease. Annu. Rev. Pathol. 2018, 13, 321–350. [Google Scholar] [CrossRef]
- Cai, X.; Fang, Z.; Dou, J.; Yu, A.; Zhai, G. Bioavailability of Quercetin: Problems and Promises. Curr. Med. Chem. 2013, 20, 2572–2582. [Google Scholar] [CrossRef]
- Olthof, M.R.; Hollman, P.C.; Vree, T.B.; Katan, M.B. Bioavailabilities of Quercetin-3-Glucoside and Quercetin-4’-Glucoside Do Not Differ in Humans. J. Nutr. 2000, 130, 1200–1203. [Google Scholar] [CrossRef]
- Hollman, P.C.; van Trijp, J.M.; Buysman, M.N.; van der Gaag, M.S.; Mengelers, M.J.; de Vries, J.H.; Katan, M.B. Relative Bioavailability of the Antioxidant Flavonoid Quercetin from Various Foods in Man. FEBS Lett. 1997, 418, 152–156. [Google Scholar] [CrossRef]
- Reinboth, M.; Wolffram, S.; Abraham, G.; Ungemach, F.R.; Cermak, R. Oral Bioavailability of Quercetin from Different Quercetin Glycosides in Dogs. Br. J. Nutr. 2010, 104, 198–203. [Google Scholar] [CrossRef]
- Chagas, M.d.S.S.; Behrens, M.D.; Moragas-Tellis, C.J.; Penedo, G.X.M.; Silva, A.R.; Gonçalves-de-Albuquerque, C.F. Flavonols and Flavones as Potential Anti-Inflammatory, Antioxidant, and Antibacterial Compounds. Oxid. Med. Cell. Longev. 2022, 2022, 9966750. [Google Scholar] [CrossRef] [PubMed]
- Valentová, K.; Vrba, J.; Bancířová, M.; Ulrichová, J.; Křen, V. Isoquercitrin: Pharmacology, Toxicology, and Metabolism. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2014, 68, 267–282. [Google Scholar] [CrossRef] [PubMed]
- Qin, G.; Ma, J.; Huang, Q.; Yin, H.; Han, J.; Li, M.; Deng, Y.; Wang, B.; Hassan, W.; Shang, J. Isoquercetin Improves Hepatic Lipid Accumulation by Activating AMPK Pathway and Suppressing TGF-β Signaling on an HFD-Induced Nonalcoholic Fatty Liver Disease Rat Model. Int. J. Mol. Sci. 2018, 19, 4126. [Google Scholar] [CrossRef] [PubMed]
- Sanyal, A.J. Past, Present and Future Perspectives in Nonalcoholic Fatty Liver Disease. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 377–386. [Google Scholar] [CrossRef]
- Schuster, S.; Cabrera, D.; Arrese, M.; Feldstein, A.E. Triggering and Resolution of Inflammation in NASH. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 349–364. [Google Scholar] [CrossRef]
- Thomas, H. NAFLD: A Critical Role for the NLRP3 Inflammasome in NASH. Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 197. [Google Scholar] [CrossRef]
- Mridha, A.R.; Wree, A.; Robertson, A.A.B.; Yeh, M.M.; Johnson, C.D.; Van Rooyen, D.M.; Haczeyni, F.; Teoh, N.C.-H.; Savard, C.; Ioannou, G.N.; et al. NLRP3 Inflammasome Blockade Reduces Liver Inflammation and Fibrosis in Experimental NASH in Mice. J. Hepatol. 2017, 66, 1037–1046. [Google Scholar] [CrossRef]
- Cai, C.; Zhu, X.; Li, P.; Li, J.; Gong, J.; Shen, W.; He, K. NLRP3 Deletion Inhibits the Non-Alcoholic Steatohepatitis Development and Inflammation in Kupffer Cells Induced by Palmitic Acid. Inflammation 2017, 40, 1875–1883. [Google Scholar] [CrossRef]
- Mangan, M.S.J.; Olhava, E.J.; Roush, W.R.; Seidel, H.M.; Glick, G.D.; Latz, E. Targeting the NLRP3 Inflammasome in Inflammatory Diseases. Nat. Rev. Drug Discov. 2018, 17, 688. [Google Scholar] [CrossRef]
- Swanson, K.V.; Deng, M.; Ting, J.P.-Y. The NLRP3 Inflammasome: Molecular Activation and Regulation to Therapeutics. Nat. Rev. Immunol. 2019, 19, 477–489. [Google Scholar] [CrossRef]
- Juliana, C.; Fernandes-Alnemri, T.; Wu, J.; Datta, P.; Solorzano, L.; Yu, J.-W.; Meng, R.; Quong, A.A.; Latz, E.; Scott, C.P.; et al. Anti-Inflammatory Compounds Parthenolide and Bay 11-7082 Are Direct Inhibitors of the Inflammasome. J. Biol. Chem. 2010, 285, 9792–9802. [Google Scholar] [CrossRef] [PubMed]
- Coll, R.C.; Robertson, A.A.B.; Chae, J.J.; Higgins, S.C.; Muñoz-Planillo, R.; Inserra, M.C.; Vetter, I.; Dungan, L.S.; Monks, B.G.; Stutz, A.; et al. A Small-Molecule Inhibitor of the NLRP3 Inflammasome for the Treatment of Inflammatory Diseases. Nat. Med. 2015, 21, 248–255. [Google Scholar] [CrossRef] [PubMed]
- Youm, Y.-H.; Nguyen, K.Y.; Grant, R.W.; Goldberg, E.L.; Bodogai, M.; Kim, D.; D’Agostino, D.; Planavsky, N.; Lupfer, C.; Kanneganti, T.D.; et al. The Ketone Metabolite β-Hydroxybutyrate Blocks NLRP3 Inflammasome-Mediated Inflammatory Disease. Nat. Med. 2015, 21, 263–269. [Google Scholar] [CrossRef] [PubMed]
- Daniels, M.J.D.; Rivers-Auty, J.; Schilling, T.; Spencer, N.G.; Watremez, W.; Fasolino, V.; Booth, S.J.; White, C.S.; Baldwin, A.G.; Freeman, S.; et al. Fenamate NSAIDs Inhibit the NLRP3 Inflammasome and Protect against Alzheimer’s Disease in Rodent Models. Nat. Commun. 2016, 7, 12504. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Wang, J.; Deng, Y.; Liao, L.; Zhou, M.; Peng, C.; Li, Y. Quercetin as a Protective Agent for Liver Diseases: A Comprehensive Descriptive Review of the Molecular Mechanism. Phytother. Res. PTR 2021, 35, 4727–4747. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Wu, F.; Yang, C.; Zhao, C.; Cheng, N.; Cao, W.; Zhao, H. Alternative to Sugar, Honey Does Not Provoke Insulin Resistance in Rats Based on Lipid Profiles, Inflammation, and IRS/PI3K/AKT Signaling Pathways Modulation. J. Agric. Food Chem. 2022, 70, 10194–10208. [Google Scholar] [CrossRef]
- Wu, L.; Zhang, Q.; Mo, W.; Feng, J.; Li, S.; Li, J.; Liu, T.; Xu, S.; Wang, W.; Lu, X.; et al. Quercetin Prevents Hepatic Fibrosis by Inhibiting Hepatic Stellate Cell Activation and Reducing Autophagy via the TGF-Β1/Smads and PI3K/Akt Pathways. Sci. Rep. 2017, 7, 9289. [Google Scholar] [CrossRef] [PubMed]
- Lamkanfi, M.; Dixit, V.M. Mechanisms and Functions of Inflammasomes. Cell 2014, 157, 1013–1022. [Google Scholar] [CrossRef]
- Martinon, F.; Burns, K.; Tschopp, J. The Inflammasome: A Molecular Platform Triggering Activation of Inflammatory Caspases and Processing of ProIL-Beta. Mol. Cell 2002, 10, 417–426. [Google Scholar] [CrossRef]
- Srinivasula, S.M.; Poyet, J.-L.; Razmara, M.; Datta, P.; Zhang, Z.; Alnemri, E.S. The PYRIN-CARD Protein ASC Is an Activating Adaptor for Caspase-1. J. Biol. Chem. 2002, 277, 21119–21122. [Google Scholar] [CrossRef]
- Howard, A.D.; Kostura, M.J.; Thornberry, N.; Ding, G.J.; Limjuco, G.; Weidner, J.; Salley, J.P.; Hogquist, K.A.; Chaplin, D.D.; Mumford, R.A. IL-1-Converting Enzyme Requires Aspartic Acid Residues for Processing of the IL-1 Beta Precursor at Two Distinct Sites and Does Not Cleave 31-KDa IL-1 Alpha. J. Immunol. 1991, 147, 2964–2969. [Google Scholar] [CrossRef]
- Ghayur, T.; Banerjee, S.; Hugunin, M.; Butler, D.; Herzog, L.; Carter, A.; Quintal, L.; Sekut, L.; Talanian, R.; Paskind, M.; et al. Caspase-1 Processes IFN-Gamma-Inducing Factor and Regulates LPS-Induced IFN-Gamma Production. Nature 1997, 386, 619–623. [Google Scholar] [CrossRef]
- Gu, Y.; Kuida, K.; Tsutsui, H.; Ku, G.; Hsiao, K.; Fleming, M.A.; Hayashi, N.; Higashino, K.; Okamura, H.; Nakanishi, K.; et al. Activation of Interferon-Gamma Inducing Factor Mediated by Interleukin-1beta Converting Enzyme. Science 1997, 275, 206–209. [Google Scholar] [CrossRef]
- Wan, X.; Xu, C.; Yu, C.; Li, Y. Role of NLRP3 Inflammasome in the Progression of NAFLD to NASH. Can. J. Gastroenterol. Hepatol. 2016, 2016, 6489012. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.; Su, W.; Zhang, L.; Shi, C.; Zhou, J.; Wang, P.; Wang, H.; Shi, X.; Wei, S.; Wang, Q.; et al. TGR5 Regulates Macrophage Inflammation in Nonalcoholic Steatohepatitis by Modulating NLRP3 Inflammasome Activation. Front. Immunol. 2020, 11, 609060. [Google Scholar] [CrossRef]
- Juliana, C.; Fernandes-Alnemri, T.; Kang, S.; Farias, A.; Qin, F.; Alnemri, E.S. Non-Transcriptional Priming and Deubiquitination Regulate NLRP3 Inflammasome Activation. J. Biol. Chem. 2012, 287, 36617–36622. [Google Scholar] [CrossRef] [PubMed]
- Py, B.F.; Kim, M.-S.; Vakifahmetoglu-Norberg, H.; Yuan, J. Deubiquitination of NLRP3 by BRCC3 Critically Regulates Inflammasome Activity. Mol. Cell 2013, 49, 331–338. [Google Scholar] [CrossRef] [PubMed]
- Wu, D.; Wu, K.; Zhu, Q.; Xiao, W.; Shan, Q.; Yan, Z.; Wu, J.; Deng, B.; Xue, Y.; Gong, W.; et al. Formononetin Administration Ameliorates Dextran Sulfate Sodium-Induced Acute Colitis by Inhibiting NLRP3 Inflammasome Signaling Pathway. Mediat. Inflamm. 2018, 2018, 3048532. [Google Scholar] [CrossRef]
- Mayor, A.; Martinon, F.; De Smedt, T.; Pétrilli, V.; Tschopp, J. A Crucial Function of SGT1 and HSP90 in Inflammasome Activity Links Mammalian and Plant Innate Immune Responses. Nat. Immunol. 2007, 8, 497–503. [Google Scholar] [CrossRef]
- Choudhury, A.; Bullock, D.; Lim, A.; Argemi, J.; Orning, P.; Lien, E.; Bataller, R.; Mandrekar, P. Inhibition of HSP90 and Activation of HSF1 Diminish Macrophage NLRP3 Inflammasome Activity in Alcohol-Associated Liver Injury. Alcohol. Clin. Exp. Res. 2020, 44, 1300–1311. [Google Scholar] [CrossRef]
- Lo, C.-W.; Yen, C.-C.; Chen, C.-Y.; Chen, H.-W.; Lii, C.-K. Benzyl Isothiocyanate Attenuates Activation of the NLRP3 Inflammasome in Kupffer Cells and Improves Diet-Induced Steatohepatitis. Toxicol. Appl. Pharmacol. 2023, 462, 116424. [Google Scholar] [CrossRef] [PubMed]




| Name | GenBank Accession | Forward Primer | Reverse Primer |
|---|---|---|---|
| Keap1 | NM_016679 | CGGGGACGCAGTGATGTATG | TGTGTAGCTGAAGGTTCGGTTA |
| HO1 | NM_010442 | AGGTACACATCCAAGCCGAGA | CATCACCAGCTTAAAGCCTTCT |
| TNFa | NM_013693 | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| IL1b | NM_008361 | GAAATGCCACCTTTTGACAGTG | TGGATGCTCTCATCAGGACAG |
| IL6 | NM_031168 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| Arg1 | NM_007482 | CTCCAAGCCAAAGTCCTTAGAG | AGGAGCTGTCATTAGGGACATC |
| TGFβ | NM_011577 | CTCCCGTGGCTTCTAGTGC | GCCTTAGTTTGGACAGGATCTG |
| TXNIP | NM_001009935 | TCTTTTGAGGTGGTCTTCAACG | GCTTTGACTCGGGTAACTTCACA |
| HSP90 | NM_008302 | GTCCGCCGTGTGTTCATCAT | GCACTTCTTGACGATGTTCTTGC |
| NLRP3 | NM_145827 | ATTACCCGCCCGAGAAAGG | TCGCAGCAAAGATCCACACAG |
| ASC | NM_023258 | CTTGTCAGGGGATGAACTCAAAA | GCCATACGACTCCAGATAGTAGC |
| GAPDH | NM_008085 | TGGATTTGGACGCATTGGTC | TTTGCACTGGTACGTGTTGAT |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ma, J.; Li, M.; Yang, T.; Deng, Y.; Ding, Y.; Guo, T.; Shang, J. Isoquercitrin Attenuates Steatohepatitis by Inhibition of the Activated NLRP3 Inflammasome through HSP90. Int. J. Mol. Sci. 2023, 24, 8795. https://doi.org/10.3390/ijms24108795
Ma J, Li M, Yang T, Deng Y, Ding Y, Guo T, Shang J. Isoquercitrin Attenuates Steatohepatitis by Inhibition of the Activated NLRP3 Inflammasome through HSP90. International Journal of Molecular Sciences. 2023; 24(10):8795. https://doi.org/10.3390/ijms24108795
Chicago/Turabian StyleMa, Ji, Maoru Li, Tingting Yang, Yang Deng, Yadong Ding, Tiantian Guo, and Jing Shang. 2023. "Isoquercitrin Attenuates Steatohepatitis by Inhibition of the Activated NLRP3 Inflammasome through HSP90" International Journal of Molecular Sciences 24, no. 10: 8795. https://doi.org/10.3390/ijms24108795
APA StyleMa, J., Li, M., Yang, T., Deng, Y., Ding, Y., Guo, T., & Shang, J. (2023). Isoquercitrin Attenuates Steatohepatitis by Inhibition of the Activated NLRP3 Inflammasome through HSP90. International Journal of Molecular Sciences, 24(10), 8795. https://doi.org/10.3390/ijms24108795

