Mycobacterium leprae’s Infective Capacity Is Associated with Activation of Genes Involved in PGL-I Biosynthesis in a Schwann Cells Infection Model
Abstract
1. Introduction
2. Results
2.1. Mycobacterium leprae Purification from Biopsy Samples of Patients with Recurrent or Non-Recurrent Leprosy Events
2.2. Morphological Description of Schwann Cells Infected with M. leprae from Recurrent and Non-Recurrent Events
2.3. Infection Kinetics of Schwann Cells with Different Clinical Isolates of M. leprae
2.4. Replication Kinetics of M. leprae in Schwann Cells
2.5. Relationship between Multiplication Capacity and Viability of M. leprae
2.6. Level Transcription of Genes Involved in PGL-I Synthesis during Schwann Cell Infection with M. leprae Clinical Isolates
3. Discussion
4. Materials and Methods
4.1. Ethics Statement
4.2. Collection and Processing of Clinical Material
4.3. Purification and Quantification of Mycobacterium leprae
4.4. Human Schwann Cell Culture
4.5. Schwann Cell Infection with Clinical Isolates of M. leprae
4.6. Viability Assays of Mycobacterium leprae Infecting SC Culture
4.7. qRT-PCR of Genes Involved in PGL-I Biosynthesis
4.8. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Britton, W.J.; Lockwood, D.N.J. Leprosy. Lancet 2004, 363, 1209–1219. [Google Scholar] [CrossRef] [PubMed]
- Han, X.Y.; Sizer, K.C.; Velarde-Félix, J.S.; Frias-Castro, L.O.; Vargas-Ocampo, F. The Leprosy Agents Mycobacterium lepromatosis and Mycobacterium leprae in Mexico. Int. J. Dermatol. 2012, 51, 952–959. [Google Scholar] [CrossRef] [PubMed]
- Scollard, D.M.; Truman, R.W.; Ebenezer, G.J. Mechanisms of Nerve Injury in Leprosy. Clin. Dermatol. 2015, 33, 46–54. [Google Scholar] [CrossRef]
- Ridley, D.S.; Jopling, W.H. Classification of Leprosy According to Immunity. A Five-Group System. Int. J. Lepr. Other Mycobact. Dis. 1966, 34, 255–273. [Google Scholar]
- Rambukkana, A. Molecular Basis for the Peripheral Nerve Predilection of Mycobacterium leprae. Curr. Opin. Microbiol. 2001, 4, 21–27. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.A.; Mindos, T.; Parkinson, D.B. Plastic Fantastic: Schwann Cells and Repair of the Peripheral Nervous System. Stem. Cells Transl. Med. 2013, 2, 553–557. [Google Scholar] [CrossRef]
- Masaki, T.; Qu, J.; Cholewa-Waclaw, J.; Burr, K.; Raaum, R.; Rambukkana, A. Reprogramming Adult Schwann Cells to Stem Cell-like Cells by Leprosy Bacilli Promotes Dissemination of Infection. Cell 2013, 152, 51–67. [Google Scholar] [CrossRef]
- Serrano-Coll, H.; Salazar-Peláez, L.; Acevedo-Saenz, L.; Cardona-Castro, N. Mycobacterium leprae-Induced Nerve Damage: Direct and Indirect Mechanisms. Pathog. Dis. 2018, 76, fty062. [Google Scholar] [CrossRef]
- Muvdi-Arenas, S. Mecanismos Del Daño de Los Nervios. In La lepra: Una Enfermedad Vigente; Guerrero, M.I., Hernández, C.A., Rodríguez, G., Eds.; Panamericana Formas e Impresos; Centro Dermatológico Federico Lleras Acosta: Bogotá, Colombia, 2019; pp. 217–230. ISBN 978-958-59331-2-5. [Google Scholar]
- Guenin-Macé, L.; Siméone, R.; Demangel, C. Lipids of Pathogenic Mycobacteria: Contributions to Virulence and Host Immune Suppression. Transbound. Emerg. Dis. 2009, 56, 255–268. [Google Scholar] [CrossRef]
- Arbues, A.; Lugo-Villarino, G.; Neyrolles, O.; Guilhot, C.; Astarie-Dequeker, C. Playing Hide-and-Seek with Host Macrophages through the Use of Mycobacterial Cell Envelope Phthiocerol Dimycocerosates and Phenolic Glycolipids. Front. Cell. Infect. Microbiol. 2014, 4, 173. [Google Scholar] [CrossRef]
- Ng, V.; Zanazzi, G.; Timpl, R.; Talts, J.F.; Salzer, J.L.; Brennan, P.J.; Rambukkana, A. Role of the Cell Wall Phenolic Glycolipid-1 in the Peripheral Nerve Predilection of Mycobacterium leprae. Cell 2000, 103, 511–524. [Google Scholar] [CrossRef]
- Díaz Acosta, C.C.; Dias, A.A.; Rosa, T.L.S.A.; Batista-Silva, L.R.; Rosa, P.S.; Toledo-Pinto, T.G.; Costa, F.d.M.R.; Lara, F.A.; Rodrigues, L.S.; Mattos, K.A.; et al. PGL I Expression in Live Bacteria Allows Activation of a CD206/PPARγ Cross-Talk That May Contribute to Successful Mycobacterium leprae Colonization of Peripheral Nerves. PLoS Pathog. 2018, 14, e1007151. [Google Scholar] [CrossRef] [PubMed]
- Hunter, S.W.; Brennan, P.J. A Novel Phenolic Glycolipid from Mycobacterium leprae Possibly Involved in Immunogenicity and Pathogenicity. J. Bacteriol. 1981, 147, 728–735. [Google Scholar] [CrossRef]
- Daffé, M.; Laneelle, M.A. Distribution of Phthiocerol Diester, Phenolic Mycosides and Related Compounds in Mycobacteria. Microbiology 1988, 134, 2049–2055. [Google Scholar] [CrossRef]
- Tabouret, G.; Astarie-Dequeker, C.; Demangel, C.; Malaga, W.; Constant, P.; Ray, A.; Honoré, N.; Bello, N.F.; Perez, E.; Daffé, M.; et al. Mycobacterium leprae Phenolglycolipid-1 Expressed by Engineered M. Bovis BCG Modulates Early Interaction with Human Phagocytes. PLoS Pathog. 2010, 6, e1001159. [Google Scholar] [CrossRef]
- Arenas, N.E.; Pieffet, G.; Rocha-Roa, C.; Guerrero, M.I. Design of a Specific Peptide against Phenolic Glycolipid-1 from Mycobacterium leprae and Its Implications in Leprosy Bacilli Entry. Memórias Inst. Oswaldo Cruz 2022, 117, e220025. [Google Scholar] [CrossRef] [PubMed]
- Guerrero-Guerrero, M.I.; Muvdi-Arenas, S.; Leon-Franco, C.I. Relapses in Multibacillary Leprosy Patients: A Retrospective Cohort of 11 Years in Colombia. Lepr. Rev. 2012, 83, 247–260. [Google Scholar] [CrossRef]
- Nunzi, E.; Massone, C.; Noto, S. Clinical Features. In Leprosy; Nunzi, E., Massone, C., Eds.; Springer: Milan, Italy, 2012; pp. 75–110. ISBN 978-88-470-2375-8. [Google Scholar]
- Gonçalves, F.G.; Belone, A.d.F.F.; Rosa, P.S.; Laporta, G.Z. Underlying Mechanisms of Leprosy Recurrence in the Western Amazon: A Retrospective Cohort Study. BMC Infect. Dis. 2019, 19, 460. [Google Scholar] [CrossRef]
- Toman, K. Bacterial Persistence in Leprosy. Int. J. Lepr. Other Mycobact. Dis. 1981, 49, 205–217. [Google Scholar] [PubMed]
- Gupta, U.; Katoch, V. Understanding the Phenomenon of Persistence in Mycobacterial Infections. Indian J. Lepr. 1997, 69, 385–393. [Google Scholar]
- Ali, M.K.; Thorat, D.M.; Subramanian, M.; Parthasarathy, G.; Selvaraj, U.; Prabhakar, V. A Study on Trend of Relapse in Leprosy and Factors Influencing Relapse. Indian J. Lepr. 2005, 77, 105–115. [Google Scholar] [PubMed]
- Guerrero, M.I.; Colorado, C.L.; Torres, J.F.; León, C.I. Is Drug-Resistant Mycobacterium leprae a Real Cause for Concern?: First Approach to Molecular Monitoring of Multibacillary Colombian Patients with and without Previous Leprosy Treatment. Biomédica 2014, 34, 137–147. [Google Scholar] [CrossRef] [PubMed]
- Lahiri, R.; Adams, L.B. Cultivation and Viability Determination of Mycobacterium leprae, Chapter 5.3. In International Textbook of Leprosy; Scollard, D.M., Gillis, T.P., Eds.; 2016; Available online: www.internationaltextbookofleprosy.org (accessed on 1 May 2023).
- Trombone, A.P.F.; Pedrini, S.C.B.; Diório, S.M.; Belone, A.d.F.F.; Fachin, L.R.V.; do Nascimento, D.C.; Rosa, P.S. Optimized Protocols for Mycobacterium leprae Strain Management: Frozen Stock Preservation and Maintenance in Athymic Nude Mice. J. Vis. Exp. 2014, 85, 50620. [Google Scholar] [CrossRef]
- Kadam, U.S.; Lossie, A.C.; Schulz, B.; Irudayaraj, J. Gene Expression Analysis Using Conventional and Imaging Methods. In DNA and RNA Nanobiotechnologies in Medicine: Diagnosis and Treatment of Diseases; Erdmann, V.A., Barciszewski, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2013; pp. 141–162. ISBN 978-3-642-36853-0. [Google Scholar]
- Rodrigues, L.C.; Lockwood, D.N.J. Leprosy Now: Epidemiology, Progress, Challenges, and Research Gaps. Lancet Infect. Dis. 2011, 11, 464–470. [Google Scholar] [CrossRef]
- Muvdi-Arenas, S.; Ordóñez-Rubiano, M. Aspectos Clínicos. In La Lepra: Una Enfermedad Vigente; Guerrero, M.I., Hernández, C.A., Rodríguez, G., Eds.; Panamericana Formas e Impresos; Centro Dermatológico Federico Lleras Acosta: Bogotá, Colombia, 2019; pp. 89–114. [Google Scholar]
- Hess, S.; Rambukkana, A. Bacterial-Induced Cell Reprogramming to Stem Cell-like Cells: New Premise in Host–Pathogen Interactions. Curr. Opin. Microbiol. 2015, 23, 179–188. [Google Scholar] [CrossRef]
- Shepard, C.C. The Experimental Disease That Follows the Injection of Human Leprosy Bacilli into Foot-Pads of Mice. J. Exp. Med. 1960, 112, 445–454. [Google Scholar] [CrossRef]
- Pena, M.T.; Sharma, R.; Truman, R.W. The Armadillo Model for Leprosy, Chapter 10.2. In International Textbook of Leprosy; Scollard, D.M., Gillis, T.P., Eds.; 2016; Available online: www.internationaltextbookofleprosy.org (accessed on 1 May 2023).
- Chavarro-Portillo, B.; Soto, C.Y.; Guerrero, M.I. Mycobacterium leprae’s Evolution and Environmental Adaptation. Acta Trop. 2019, 197, 105041. [Google Scholar] [CrossRef]
- WHO. Global Leprosy Update, 2018: Moving towards a Leprosy Free World. Wkly. Epidemiol. Rec. 2019, 94, 389–412. [Google Scholar]
- WHO. Global Leprosy (Hansen Disease) Update, 2019: Time to Step-up Prevention Initiatives. Wkly. Epidemiol. Rec. 2020, 95, 417–440. [Google Scholar]
- Nery, J.A.C.; Sales, A.M.; Hacker, M.A.V.B.; Moraes, M.O.; Maia, R.C.; Sarno, E.N.; Illarramendi, X. Low Rate of Relapse after Twelve-Dose Multidrug Therapy for Hansen’s Disease: A 20-Year Cohort Study in a Brazilian Reference Center. PLoS Negl. Trop. Dis. 2021, 15, e0009382. [Google Scholar] [CrossRef]
- WHO. Global Leprosy Programme. Global Leprosy Strategy 2016–2020: Accelerating towards a Leprosy-Free World; WHO: Geneva, Switzerland, 2016; Volume 20. [Google Scholar]
- Casalenovo, M.B.; Rosa, P.S.; de Faria Bertoluci, D.F.; Barbosa, A.S.A.A.; do Nascimento, D.C.; de Souza, V.N.B.; Nogueira, M.R.S. Myelination Key Factor Krox-20 Is Downregulated in Schwann Cells and Murine Sciatic Nerves Infected by Mycobacterium leprae. Int. J. Exp. Pathol. 2019, 100, 83–93. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Pérez, A.; Estévez, O.; González-Fernández, Á. Contribution and Future of High-Throughput Transcriptomics in Battling Tuberculosis. Front. Microbiol. 2022, 13, 835620. [Google Scholar] [CrossRef]
- Davis, J.M.; Ramakrishnan, L. The Role of the Granuloma in Expansion and Dissemination of Early Tuberculous Infection. Cell 2009, 136, 37–49. [Google Scholar] [CrossRef] [PubMed]
- Lewis, K. Persister Cells, Dormancy and Infectious Disease. Nat. Rev. Microbiol. 2007, 5, 48–56. [Google Scholar] [CrossRef]
- Veatch, A.V.; Kaushal, D. Opening Pandora’s Box: Mechanisms of Mycobacterium tuberculosis Resuscitation. Trends Microbiol. 2018, 26, 145–157. [Google Scholar] [CrossRef] [PubMed]
- Adams, L.B.; Soileau, N.A.; Battista, J.R.; Krahenbuhl, J.L. Inhibition of Metabolism and Growth of Mycobacterium leprae by Gamma Irradiation. Int. J. Lepr. Other Mycobact. Dis. 2000, 68, 1–10. [Google Scholar]
- Truman, R.W.; Krahenbuhl, J.L. Viable M. leprae as a Research Reagent. Int. J. Lepr. Other Mycobact. Dis. 2001, 69, 1–12. [Google Scholar]
- Davis, G.L.; Ray, N.A.; Lahiri, R.; Gillis, T.P.; Krahenbuhl, J.L.; Williams, D.L.; Adams, L.B. Molecular Assays for Determining Mycobacterium leprae Viability in Tissues of Experimentally Infected Mice. PLoS Negl. Trop. Dis. 2013, 7, e2404. [Google Scholar] [CrossRef]
- Fréhel, C.; Offredo, C.; de Chastellier, C. The Phagosomal Environment Protects Virulent Mycobacterium avium from Killing and Destruction by Clarithromycin. Infect. Immun. 1997, 65, 2792–2802. [Google Scholar] [CrossRef]
- Rambukkana, A.; Salzer, J.L.; Yurchenco, P.D.; Tuomanen, E.I. Neural Targeting of Mycobacterium leprae Mediated by the G Domain of the Laminin-Alpha2 Chain. Cell 1997, 88, 811–821. [Google Scholar] [CrossRef]
- Mattos, K.A.; Lara, F.A.; Oliveira, V.G.C.; Rodrigues, L.S.; D’Avila, H.; Melo, R.C.N.; Manso, P.P.A.; Sarno, E.N.; Bozza, P.T.; Pessolani, M.C.V. Modulation of Lipid Droplets by Mycobacterium leprae in Schwann Cells: A Putative Mechanism for Host Lipid Acquisition and Bacterial Survival in Phagosomes. Cell. Microbiol. 2011, 13, 259–273. [Google Scholar] [CrossRef] [PubMed]
- Pérez, E.; Constant, P.; Laval, F.; Lemassu, A.; Lanéelle, M.-A.; Daffé, M.; Guilhot, C. Molecular Dissection of the Role of Two Methyltransferases in the Biosynthesis of Phenolglycolipids and Phthiocerol Dimycoserosate in the Mycobacterium tuberculosis Complex. J. Biol. Chem. 2004, 279, 42584–42592. [Google Scholar] [CrossRef]
- Hunter, S.W.; Fujiwara, T.; Brennan, P.J. Structure and Antigenicity of the Major Specific Glycolipid Antigen of Mycobacterium leprae. J. Biol. Chem. 1982, 257, 15072–15078. [Google Scholar] [CrossRef] [PubMed]
- Wheat, W.H.; Casali, A.L.; Thomas, V.; Spencer, J.S.; Lahiri, R.; Williams, D.L.; McDonnell, G.E.; Gonzalez-Juarrero, M.; Brennan, P.J.; Jackson, M. Long-Term Survival and Virulence of Mycobacterium leprae in Amoebal Cysts. PLoS Negl. Trop. Dis. 2014, 8, e3405. [Google Scholar] [CrossRef] [PubMed]
- Teles, R.M.B.; Graeber, T.G.; Krutzik, S.R.; Montoya, D.; Schenk, M.; Lee, D.J.; Komisopoulou, E.; Kelly-Scumpia, K.; Chun, R.; Iyer, S.S.; et al. Type I Interferon Suppresses Type II Interferon-Triggered Human Anti-Mycobacterial Responses. Science 2013, 339, 1448–1453. [Google Scholar] [CrossRef] [PubMed]
- Boxx, G.M.; Cheng, G. The Roles of Type I Interferon in Bacterial Infection. Cell Host Microbe 2016, 19, 760–769. [Google Scholar] [CrossRef]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A Tool to Design Target-Specific Primers for Polymerase Chain Reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef]
- Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A.M. Primer3Plus, an Enhanced Web Interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
Code | Case | Bacillary Index | Number of Bacilli/mL | BacLight LIVE/DEAD Viability |
---|---|---|---|---|
Exp 1 | Non-recurrence | 1.8 | 1,709,403 | >80% |
Exp 2 | Recurrence | 3.0 | ≈1,600,000 | >80% |
Exp 3 | Non-recurrence | 5.0 | 27,254,012 | >80% |
Exp 4 | Non-recurrence | 2.0 | 106,660,872 | >80% |
Exp 5 | Non-recurrence | 2.0 | 62,762,831 | >80% |
Exp 6 | Dead bacilli (Thai-53) | NA | 134,451,081 | 0% |
Quantification | Clinical Isolate | Time 1 | Time 2 | Time 3 | Time 4 | Time 5 |
---|---|---|---|---|---|---|
Number of infected cells per well | Recurrence | 650 | 850 | 850 | 1500 | 2200 |
Non-recurrence | 2750 | 4116 | 4066 | 4650 | 5400 | |
dead | 2066 | 2200 | 2050 | 1950 | 2550 | |
Average number of bacilli per well | Recurrence | 28,180 | 23,680 | 34,200 | 30,200 | 31,000 |
Non-recurrence | 45,200 | 35,600 | 51,600 | 64,000 | 59,400 | |
dead | 42,600 | 43,200 | 54,600 | 42,800 | 33,000 |
Primer | Sequence | Size | Length | Tm | % GC |
---|---|---|---|---|---|
ppsC-F | CGGAGCTAGCCGATCTCACT | 127 | 20 | 64.5 | 60.0 |
ppsC-R | CGCACAGGATTACGCATGTT | 20 | 60.4 | 50.0 | |
ML0126-F | CTTTCGTGCGCATAATCACTG | 210 | 21 | 60.6 | 47.6 |
ML0126-R | GCGACGAGATCCTCGTAATTG | 21 | 62.6 | 52.4 | |
ML0127-F | GATCTTCGCCATCTTGGACAG | 178 | 21 | 62.6 | 52.4 |
ML0127-R | CTCGTATGCCTCAATGGCTTC | 21 | 62.6 | 52.4 | |
ML0128-F | CGATCCACGGTACAACAACCT | 172 | 21 | 62.6 | 52.4 |
ML0128-R | TTCGATCTCGGACAGCAATTT | 21 | 58.7 | 42.9 | |
ML2346-F | ATGAAGCGTCCGAACCTGAT | 104 | 20 | 60.4 | 50.0 |
ML2346-R | GGATTCGCCTCTAACGCAAC | 20 | 62.4 | 55.0 | |
ML2347-F | GATGGATCGCACTTTGGTGA | 113 | 20 | 60.4 | 50.0 |
ML2347-R | CGTAGATAGCCGGGCCATAA | 20 | 62.4 | 55.0 | |
ML2348-F | GGCCTATGACGAGCTCTGCT | 165 | 20 | 64.5 | 60.0 |
ML2348-R | CCGAAGCCGAAGTAGATTGG | 20 | 62.4 | 55.0 | |
Sod-F | CACCGTTCGGAGAGAGGTTC | 192 | 20 | 64.5 | 60.0 |
sod-R | TCAACGAGATCCACCACACC | 20 | 62.4 | 55.0 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chavarro-Portillo, B.; Soto, C.Y.; Guerrero, M.I. Mycobacterium leprae’s Infective Capacity Is Associated with Activation of Genes Involved in PGL-I Biosynthesis in a Schwann Cells Infection Model. Int. J. Mol. Sci. 2023, 24, 8727. https://doi.org/10.3390/ijms24108727
Chavarro-Portillo B, Soto CY, Guerrero MI. Mycobacterium leprae’s Infective Capacity Is Associated with Activation of Genes Involved in PGL-I Biosynthesis in a Schwann Cells Infection Model. International Journal of Molecular Sciences. 2023; 24(10):8727. https://doi.org/10.3390/ijms24108727
Chicago/Turabian StyleChavarro-Portillo, Bibiana, Carlos Y. Soto, and Martha Inírida Guerrero. 2023. "Mycobacterium leprae’s Infective Capacity Is Associated with Activation of Genes Involved in PGL-I Biosynthesis in a Schwann Cells Infection Model" International Journal of Molecular Sciences 24, no. 10: 8727. https://doi.org/10.3390/ijms24108727
APA StyleChavarro-Portillo, B., Soto, C. Y., & Guerrero, M. I. (2023). Mycobacterium leprae’s Infective Capacity Is Associated with Activation of Genes Involved in PGL-I Biosynthesis in a Schwann Cells Infection Model. International Journal of Molecular Sciences, 24(10), 8727. https://doi.org/10.3390/ijms24108727