Different Fatty Acid Supplementation in Low-Protein Diets Regulate Nutrient Utilization and Lipid and Amino Acid Metabolism in Weaned Pigs Model
Abstract
1. Introduction
2. Results
2.1. Relative Weight of Organ and Nutrient Digestibility
2.2. Plasma Biochemical Parameters
2.3. Untargeted Metabolomics
2.4. Metabolic Pathways
3. Discussion
4. Materials and Methods
4.1. Dietary Treatments and Animal Management
4.2. Sample Collection
4.3. Analytical Methods
4.3.1. Apparent Total Tract Digestibility
4.3.2. Biochemical Parameters
4.3.3. Untargeted Metabolomic Analysis
4.3.4. Quantitative Real-Time PCR
4.4. Statistical Analyses
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Wang, Y.; Zhou, J.; Wang, G.; Cai, S.; Zeng, X.; Qiao, S. Advances in low-protein diets for swine. J. Anim. Sci. Biotechnol. 2018, 9, 60. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wellock, I.J.; Fortomaris, P.D.; Houdijk, J.G.; Kyriazakis, I. Effects of dietary protein supply, weaning age and experimental enterotoxigenic Escherichia coli infection on newly weaned pigs: Health. Animal 2008, 2, 834–842. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pluske, J.R.; Pethick, D.W.; Hopwood, D.E.; Hampson, D.J. Nutritional influences on some major enteric bacterial diseases of pig. Nutr. Res. Rev. 2002, 15, 333–371. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhou, X.; Liu, Y.; Zhang, L.; Kong, X.; Li, F. Serine-to-glycine ratios in low-protein diets regulate intramuscular fat by affecting lipid metabolism and myofiber type transition in the skeletal muscle of growing-finishing pigs. Anim. Nutr. 2021, 7, 384–392. [Google Scholar] [CrossRef] [Scilit]
- Yue, L.Y.; Qiao, S.Y. Effects of low-protein diets supplemented with crystalline amino acids on performance and intestinal development in piglets over the first 2 weeks after weaning. Livest. Sci. 2008, 115, 144–152. [Google Scholar] [CrossRef] [Scilit]
- Lauridsen, C. Effects of dietary fatty acids on gut health and function of pigs pre- and post-weaning. J. Anim. Sci. 2020, 98, a86. [Google Scholar] [CrossRef] [Scilit]
- Xu, E.; Chen, C.; Fu, J.; Zhu, L.; Shu, J.; Jin, M.; Wang, Y.; Zong, X. Dietary fatty acids in gut health: Absorption, metabolism and function. Anim. Nutr. 2021, 7, 1337–1344. [Google Scholar] [CrossRef] [Scilit]
- Bergman, E.N. Energy contributions of volatile fatty acids from the gastrointestinal tract in various species. Physiol. Rev. 1990, 70, 567–590. [Google Scholar] [CrossRef] [Scilit]
- den Besten, G.; Bleeker, A.; Gerding, A.; van Eunen, K.; Havinga, R.; van Dijk, T.H.; Oosterveer, M.H.; Jonker, J.W.; Groen, A.K.; Reijngoud, D.; et al. Short-chain fatty acids protect against high-fat diet-induced obesity via a PPARγ-dependent switch from lipogenesis to fat oxidation. Diabetes 2015, 64, 2398–2408. [Google Scholar] [CrossRef] [Scilit]
- Gao, Z.; Yin, J.; Zhang, J.; Ward, R.E.; Martin, R.J.; Lefevre, M.; Cefalu, W.T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509–1517. [Google Scholar] [CrossRef] [Scilit]
- Mollica, M.P.; Mattace Raso, G.; Cavaliere, G.; Trinchese, G.; De Filippo, C.; Aceto, S.; Prisco, M.; Pirozzi, C.; Di Guida, F.; Lama, A.; et al. Butyrate regulates liver mitochondrial function, efficiency, and dynamics in insulin-resistant obese mice. Diabetes 2017, 66, 1405–1418. [Google Scholar] [CrossRef] [Scilit]
- Lingbeek, M.M.; Borewicz, K.; Febery, E.; Han, Y.; Doelman, J.; van Kuijk, S.J.A. Short-chain fatty acid administration via water acidifier improves feed efficiency and modulates fecal microbiota in weaned piglets. J. Anim. Sci. 2021, 99, b307. [Google Scholar] [CrossRef] [Scilit]
- Cui, Z.; Wang, X.; Liao, S.; Qi, M.; Zha, A.; Zuo, G.; Liao, P.; Chen, Y.; Guo, C.; Tan, B. Effects of medium-chainf acid glycerides on nutrient metabolism and energy utilization in weaned piglets. Front. Vet. Sci. 2022, 9, 938888. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Ma, L.J.; Yang, Y.; Xiao, Z.; Wan, J.B. n-3 Polyunsaturated fatty acids for the management of alcoholic liver disease: A critical review. Crit. Rev. Food Sci. Nutr. 2019, 59, S116–S129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Xu, Q.; Li, Y.; Tang, Z.; Sun, W.; Zhang, X.; Sun, J.; Sun, Z. Comparative effects of dietary supplementations with sodium butyrate, medium-chain fatty acids, and n-3 polyunsaturated fatty acids in late pregnancy and lactation on the reproductive performance of sows and growth performance of suckling piglets. J. Anim. Sci. 2019, 97, 4256–4267. [Google Scholar] [CrossRef] [Scilit]
- Hoy, A.J.; Nagarajan, S.R.; Butler, L.M. Tumour fatty acid metabolism in the context of therapy resistance and obesity. Nat. Rev. Cancer 2021, 21, 753–766. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rao, Z.; Li, J.; Shi, B.; Zeng, Y.; Liu, Y.; Sun, Z.; Wu, L.; Sun, W.; Tang, Z. Dietary tryptophan levels impact growth performance and intestinal microbial ecology in weaned piglets via tryptophan metabolites and intestinal antimicrobial peptides. Animals 2021, 11, 817. [Google Scholar] [CrossRef] [Scilit]
- Bugger, H.; Byrne, N.J.; Abel, E.D. Animal models of dysregulated cardiac metabolism. Circ. Res. 2022, 130, 1965–1993. [Google Scholar] [CrossRef] [Scilit]
- Reinke, H.; Asher, G. Circadian clock control of liver metabolic functions. Gastroenterology 2016, 150, 574–580. [Google Scholar] [CrossRef] [Scilit]
- Tai, T.Y.; Pek, S. Direct stimulation by growth hormone of glucagon and insulin release from isolated rat pancreas. Endocrinology 1976, 99, 669–677. [Google Scholar] [CrossRef] [Scilit]
- Kang, M.; Yin, J.; Ma, J.; Wu, X.; Huang, K.; Li, T.; Ouyang, L. Effects of dietary histidine on growth performance, serum amino acids, and intestinal morphology and microbiota communities in low protein diet-fed piglets. Mediat. Inflamm. 2020, 2020, 1240152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Zhang, H.; Yang, L.; Zhang, L.; Wang, T. Effect of medium-chain triglycerides on growth performance, nutrient digestibility, plasma metabolites and antioxidant capacity in weanling pigs. Anim. Nutr. 2015, 1, 12–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bergsson, G.; Steingrímsson, O.; Thormar, H. Bactericidal effects of fatty acids and monoglycerides on Helicobacter pylori. Int. J. Antimicrob. Agents 2002, 20, 258–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stubbs, R.S.; Stabile, B.E. Role of cholecystokinin in pancreatic exocrine response to intraluminal amino acids and fat. Am. J. Physiol. 1985, 248, G347–G352. [Google Scholar] [CrossRef] [Scilit]
- Roland, M.C.P.; Lekva, T.; Godang, K.; Bollerslev, J.; Henriksen, T. Changes in maternal blood glucose and lipid concentrations during pregnancy differ by maternal body mass index and are related to birthweight: A prospective, longitudinal study of healthy pregnancies. PLoS ONE 2020, 15, e232749. [Google Scholar] [CrossRef] [Scilit]
- Liu, N.; Ji, Y.; Yang, Y.; Jia, H.; Si, X.; Jiang, D.; Zhang, Y.; Dai, Z.; Wu, Z. Impact of dietary crude protein level on hepatic lipid metabolism in weaned female piglets. Animals 2021, 11, 1829. [Google Scholar] [CrossRef] [Scilit]
- Chiang, J.Y.L. Bile acid metabolism and signaling. Compr. Physiol. 2013, 3, 1191–1212. [Google Scholar]
- Salvatore, D.; Simonides, W.S.; Dentice, M.; Zavacki, A.M.; Larsen, P.R. Thyroid hormones and skeletal muscle—New insights and potential implications. Nat. Rev. Endocrinol. 2014, 10, 206–214. [Google Scholar] [CrossRef] [Scilit]
- Orskov, H. Somatostatin, growth hormone, insulin-like growth factor-1, and diabetes: Friends or foes? Metab.-Clin. Exp. 1996, 45, 91–95. [Google Scholar] [CrossRef] [Scilit]
- Steinert, R.E.; Feinle-Bisset, C.; Asarian, L.; Horowitz, M.; Beglinger, C.; Geary, N. Ghrelin, CCK, GLP-1, and PYY(3-36): Secretory controls and physiological roles in eating and glycemia in health, obesity, and after RYGB. Physiol. Rev. 2017, 97, 411–463. [Google Scholar] [CrossRef] [Scilit]
- Miller, L.J.; Harikumar, K.G.; Wootten, D.; Sexton, P.M. Roles of cholecystokinin in the nutritional continuum. Physiology and potential therapeutics. Front. Endocrinol. 2021, 12, 684656. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gessner, D.K.; Gröne, B.; Rosenbaum, S.; Most, E.; Hillen, S.; Becker, S.; Erhardt, G.; Reiner, G.; Eder, K. Effect of dietary fish oil on the expression of genes involved in lipid metabolism in liver and skeletal muscle of lactating sows. J. Anim. Physiol. Anim. Nutr. 2016, 100, 337–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Covarrubias, A.J.; Perrone, R.; Grozio, A.; Verdin, E. NAD+ metabolism and its roles in cellular processes during ageing. Nat. Rev. Mol. Cell Biol. 2021, 22, 119–141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katsyuba, E.; Romani, M.; Hofer, D.; Auwerx, J. NAD+ homeostasis in health and disease. Nat. Metab. 2020, 2, 9–31. [Google Scholar] [CrossRef] [Scilit]
- Horman, T.; Fernandes, M.F.; Tache, M.C.; Hucik, B.; Mutch, D.M.; Leri, F. Dietary n-6/n-3 ratio influences brain fatty acid composition in adult rats. Nutrients 2020, 12, 1847. [Google Scholar] [CrossRef] [Scilit]
- You, Y.N.; Ling, P.; Qu, J.Z.; Bistrian, B.R. Effects of medium-chain triglycerides, long-chain triglycerides, or 2-monododecanoin on fatty acid composition in the portal vein, intestinal lymph, and systemic circulation in rats. J. Parenter. Enter. Nutr. 2008, 32, 169–175. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Qiao, S.; Ren, M.; Zeng, X.; Ma, X.; Wu, Z.; Thacker, P.; Wu, G. Supplementation with branched-chain amino acids to a low-protein diet regulates intestinal expression of amino acid and peptide transporters in weanling pigs. Amino Acids 2013, 45, 1191–1205. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.; Su, W.; Kang, B.; Jiang, Q.; Zhao, Y.; Fu, C.; Yao, K. Supplementation with α-ketoglutarate to a low-protein diet enhances amino acid synthesis in tissues and improves protein metabolism in the skeletal muscle of growing pigs. Amino Acids 2018, 50, 1525–1537. [Google Scholar] [CrossRef] [Scilit]
- Duan, Y.; Guo, Q.; Wen, C.; Wang, W.; Li, Y.; Tan, B.; Li, F.; Yin, Y. Free amino acid profile and expression of genes implicated in protein metabolism in skeletal muscle of growing pigs fed low-protein diets supplemented with branched-chain amino acids. J. Agric. Food Chem. 2016, 64, 9390–9400. [Google Scholar] [CrossRef] [Scilit]
- Mulukutla, B.C.; Yongky, A.; Le, T.; Mashek, D.G.; Hu, W. Regulation of glucose metabolism—A perspective from cell bioprocessing. Trends Biotechnol. 2016, 34, 638–651. [Google Scholar] [CrossRef] [Scilit]
- Smith, H.Q.; Li, C.; Stanley, C.A.; Smith, T.J. Glutamate dehydrogenase, a complex enzyme at a crucial metabolic branch point. Neurochem. Res. 2019, 44, 117–132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Spanaki, C.; Plaitakis, A. The role of glutamate dehydrogenase in mammalian ammonia metabolism. Neurotox. Res. 2012, 21, 117–127. [Google Scholar] [CrossRef] [Scilit]
- Bonnefont, J.; Djouadi, F.; Prip-Buus, C.; Gobin, S.; Munnich, A.; Bastin, J. Carnitine palmitoyltransferases 1 and 2: Biochemical, molecular and medical aspects. Mol. Asp. Med. 2004, 25, 495–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Casals, N.; Zammit, V.; Herrero, L.; Fadó, R.; Rodríguez-Rodríguez, R.; Serra, D. Carnitine palmitoyltransferase 1C: From cognition to cancer. Prog. Lipid Res. 2016, 61, 134–148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Wei, H.; Li, F.; Duan, Y.; Guo, Q.; Yin, Y. Effects of low-protein diets supplemented with branched-chain amino acid on lipid metabolism in white adipose tissue of piglets. J. Agric. Food Chem. 2017, 65, 2839–2848. [Google Scholar] [CrossRef] [Scilit]
- Smith, S.; Witkowski, A.; Joshi, A.K. Structural and functional organization of the animal fatty acid synthase. Prog. Lipid Res. 2003, 42, 289–317. [Google Scholar] [CrossRef] [Scilit]
- Olofsson, L.E.; Orho-Melander, M.; William-Olsson, L.; Sjöholm, K.; Sjöström, L.; Groop, L.; Carlsson, B.; Carlsson, L.M.S.; Olsson, B. CCAAT/enhancer binding protein alpha (C/EBPalpha) in adipose tissue regulates genes in lipid and glucose metabolism and a genetic variation in C/EBPalpha is associated with serum levels of triglycerides. J. Clin. Endocrinol. Metab. 2008, 93, 4880–4886. [Google Scholar] [CrossRef] [Scilit]
- Nutrient Requirements of Swine, 12th revised ed.; The National Academies Press: Washington, DC, USA, 2012.
- Zelena, E.; Dunn, W.B.; Broadhurst, D.; Francis-McIntyre, S.; Carroll, K.M.; Begley, P.; O’Hagan, S.; Knowles, J.D.; Halsall, A.; Wilson, I.D.; et al. Development of a robust and repeatable UPLC-MS method for the long-term metabolomic study of human serum. Anal. Chem. 2009, 81, 1357–1364. [Google Scholar] [CrossRef] [Scilit]
- Want, E.J.; Masson, P.; Michopoulos, F.; Wilson, I.D.; Theodoridis, G.; Plumb, R.S.; Shockcor, J.; Loftus, N.; Holmes, E.; Nicholson, J.K. Global metabolic profiling of animal and human tissues via UPLC-MS. Nat. Protoc. 2013, 8, 17–32. [Google Scholar] [CrossRef] [Scilit]
- Tang, Q.; Xu, E.; Wang, Z.; Xiao, M.; Cao, S.; Hu, S.; Wu, Q.; Xiong, Y.; Jiang, Z.; Wang, F.; et al. Dietary Hermetia illucens larvae meal improves growth performance and intestinal barrier function of weaned pigs under the environment of enterotoxigenic escherichia coli k88. Front. Nutr. 2022, 8, 812011. [Google Scholar] [CrossRef] [Scilit]





| Item | Dietary Treatments 1 | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| CON | LP | LP + SB | LP + MCFA | LP + PUFA | |||
| Organ Weight (g) | |||||||
| Liver | 391.9 | 403.1 | 373.9 | 396.0 | 396.0 | 7.35 | 0.799 |
| Heart | 85.93 | 87.02 | 85.67 | 83.82 | 83.17 | 1.23 | 0.876 |
| Kidney | 78.85 | 75.48 | 76.85 | 74.98 | 78.07 | 1.77 | 0.960 |
| Pancreas | 22.55 | 24.42 | 18.18 | 23.30 | 21.88 | 0.80 | 0.125 |
| Spleen | 33.65 | 32.12 | 27.43 | 36.25 | 35.90 | 1.40 | 0.273 |
| Relative weight of organ (g/kg) | |||||||
| Liver | 23.16 b | 28.55 a | 27.32 a | 29.85 a | 29.37 a | 0.67 | 0.005 |
| Heart | 5.09 b | 6.17 a | 6.24 a | 6.32 a | 6.17 a | 0.12 | 0.001 |
| Kidney | 4.67 | 5.35 | 5.63 | 5.64 | 5.78 | 0.14 | 0.078 |
| Pancreas | 1.39 b | 1.73 a | 1.32 b | 1.75 a | 1.62 ab | 0.06 | 0.014 |
| Spleen | 2.00 | 2.28 | 2.00 | 2.73 | 2.66 | 0.11 | 0.052 |
| Items | Dietary Treatments 1 | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| CON | LP | LP + SB | LP + MCFA | LP + PUFA | |||
| Dry matter, % | 90.42 b | 90.53 b | 92.03 ab | 93.08 a | 91.35 ab | 0.28 | 0.006 |
| Crude protein, % | 87.32 | 85.73 | 87.42 | 89.72 | 86.86 | 0.47 | 0.096 |
| Ca, % | 73.63 | 76.14 | 78.75 | 83.01 | 74.52 | 1.19 | 0.078 |
| Total P, % | 72.72 c | 73.54 c | 80.00 ab | 84.88 a | 76.29 bc | 1.05 | <0.001 |
| Items | Dietary Treatments 1 | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| CON | LP | LP + SB | LP + MCFA | LP + PUFA | |||
| TP (μg/mL) | 42.38 | 42.77 | 41.81 | 42.53 | 41.20 | 0.49 | 0.877 |
| PUN (mmol/L) | 1.26 | 1.52 | 2.84 | 1.96 | 2.18 | 0.22 | 0.195 |
| Glucose (mmol/L) | 5.90 | 5.35 | 5.03 | 5.79 | 6.38 | 0.23 | 0.419 |
| TC (mmol/L) | 2.31 b | 2.94 a | 2.54 b | 2.51 b | 2.40 b | 0.07 | 0.029 |
| TG (mol/L) | 0.57 | 0.60 | 0.51 | 0.56 | 0.57 | 0.03 | 0.953 |
| LDL-C (mmol/L) | 0.21 | 0.19 | 0.19 | 0.21 | 0.18 | 0.01 | 0.818 |
| HDL-C (mmol/L) | 1.06 | 1.22 | 0.97 | 1.32 | 1.26 | 0.05 | 0.135 |
| Item | Dietary Treatments 1 | SEM | p-Value | ||||
|---|---|---|---|---|---|---|---|
| CON | LP | LP + SB | LP + MCFA | LP + PUFA | |||
| Triiodothyronine (pmol/L) | 1.60 | 1.55 | 1.59 | 1.65 | 1.57 | 0.01 | 0.125 |
| Tetraiodothyronine (pmol/L) | 5.49 | 5.96 | 5.66 | 5.20 | 5.54 | 0.12 | 0.355 |
| Insulin (mIU/L) | 0.90 | 0.60 | 0.55 | 2.34 | 0.88 | 0.34 | 0.451 |
| GLP-1 (ng/mL) | 0.65 | 0.60 | 0.26 | 1.80 | 0.78 | 0.24 | 0.310 |
| GHRP (ng/mL) | 0.87 | 0.54 | 0.51 | 0.66 | 2.84 | 0.36 | 0.191 |
| CCK (pg/mL) | 8.35 ab | 0.69 b | 3.71 b | 2.97 b | 11.54 a | 1.33 | 0.045 |
| GH (ng/mL) | 0.67 | 0.53 | 0.45 | 2.64 | 0.71 | 0.32 | 0.154 |
| Somatostatin (pg/mL) | 5.24 | 3.48 | 3.32 | 14.19 | 6.87 | 1.73 | 0.268 |
| Leptin (ng/mL) | 0.45 | 0.26 | 0.35 | 1.25 | 0.45 | 0.15 | 0.211 |
| Items | Dietary Treatments 1 | ||||
|---|---|---|---|---|---|
| CON | LP | LP + SB | LP + MCFA | LP + PUFA | |
| Ingredient | |||||
| Corn | 61.45 | 69.37 | 69.23 | 69.23 | 69.23 |
| Soybean meal | 12.90 | 8.30 | 8.28 | 8.28 | 8.28 |
| Puffed soybean | 12.14 | 8.20 | 8.18 | 8.18 | 8.18 |
| Fish meal | 4.80 | 4.70 | 4.69 | 4.69 | 4.69 |
| Soybean oil | 1.80 | 1.90 | 1.90 | 1.90 | 1.90 |
| Whey powder | 2.50 | 2.50 | 2.50 | 2.50 | 2.50 |
| CaHPO4 | 1.10 | 1.24 | 1.24 | 1.24 | 1.24 |
| Limestone | 0.80 | 0.80 | 0.80 | 0.80 | 0.80 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 | 0.30 |
| L-Lys.HCl | 0.66 | 0.91 | 0.91 | 0.91 | 0.91 |
| DL-methionine | 0.25 | 0.32 | 0.32 | 0.32 | 0.32 |
| L-tryptophan | 0.05 | 0.09 | 0.09 | 0.09 | 0.09 |
| L-threonine | 0.25 | 0.37 | 0.37 | 0.37 | 0.37 |
| Premix a | 1.00 | 1.00 | 1.00 | 1.00 | 1.00 |
| SB | 0.00 | 0.00 | 0.20 | 0.00 | 0.00 |
| MCFAs | 0.00 | 0.00 | 0.00 | 0.20 | 0.00 |
| n-3 PUFAs | 0.00 | 0.00 | 0.00 | 0.00 | 0.20 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels b | |||||
| DE (MJ/kg) | 14.67 | 14.58 | 14.59 | 14.59 | 14.60 |
| CP | 20.45 | 16.75 | 16.54 | 16.68 | 16.15 |
| Lysine | 1.56 | 1.55 | 1.55 | 1.55 | 1.55 |
| Methionine | 0.58 | 0.61 | 0.61 | 0.61 | 0.61 |
| Tryptophan | 0.26 | 0.26 | 0.26 | 0.26 | 0.26 |
| Threonine | 0.96 | 0.96 | 0.96 | 0.96 | 0.96 |
| Cysteine | 0.31 | 0.27 | 0.26 | 0.26 | 0.26 |
| Valine | 0.83 | 0.70 | 0.70 | 0.70 | 0.70 |
| Leucine | 1.60 | 1.41 | 1.40 | 1.40 | 1.40 |
| Isoleucine | 0.72 | 0.60 | 0.60 | 0.60 | 0.60 |
| Arginase | 1.15 | 0.92 | 0.92 | 0.92 | 0.92 |
| Phenylalanine | 0.81 | 0.68 | 0.67 | 0.67 | 0.67 |
| Tryptophan | 0.56 | 0.49 | 0.49 | 0.49 | 0.49 |
| Histidine | 0.45 | 0.39 | 0.39 | 0.39 | 0.39 |
| Ca | 0.80 | 0.89 | 0.88 | 0.87 | 0.82 |
| Total P | 0.69 | 0.74 | 0.74. | 0.77 | 0.73 |
| Gene | Primer Sequence (5′→3′) | Accession Number | Product Size (bp) |
|---|---|---|---|
| CPT1 | F: CCACTATGACCCGGAAGACG | NM_001007191.1 | 111 |
| R: TTGAACGCGATGAGGGTGAA | |||
| ACC | F: TTCCTATCGGCTATTGACA R: CTTCGCACATACACCTCC | NM_001114269.1 | 158 |
| FASN | F: CGTGGGCTACAGCATGATAGG R: GAGGAGCAGGCCGTGTCTAT | NM_001099930.1 | 108 |
| SREBP1 | F: TCCATCAATGACAAGATCATCGA R: CTGGTTGCTCTGCTGAAGGAA | NM_214157.1 | 123 |
| GAPDH | F: ACATCAAGAAGGTGGTGAAG R: ATTGTCGTACCAGGAAATGAG | NM_001206359.1 | 178 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, Q.; Li, W.; Ren, Z.; Ding, Q.; Peng, X.; Tang, Z.; Pang, J.; Xu, Y.; Sun, Z. Different Fatty Acid Supplementation in Low-Protein Diets Regulate Nutrient Utilization and Lipid and Amino Acid Metabolism in Weaned Pigs Model. Int. J. Mol. Sci. 2023, 24, 8501. https://doi.org/10.3390/ijms24108501
Tang Q, Li W, Ren Z, Ding Q, Peng X, Tang Z, Pang J, Xu Y, Sun Z. Different Fatty Acid Supplementation in Low-Protein Diets Regulate Nutrient Utilization and Lipid and Amino Acid Metabolism in Weaned Pigs Model. International Journal of Molecular Sciences. 2023; 24(10):8501. https://doi.org/10.3390/ijms24108501
Chicago/Turabian StyleTang, Qingsong, Wenxue Li, Zhongxiang Ren, Qi Ding, Xie Peng, Zhiru Tang, Jiaman Pang, Yetong Xu, and Zhihong Sun. 2023. "Different Fatty Acid Supplementation in Low-Protein Diets Regulate Nutrient Utilization and Lipid and Amino Acid Metabolism in Weaned Pigs Model" International Journal of Molecular Sciences 24, no. 10: 8501. https://doi.org/10.3390/ijms24108501
APA StyleTang, Q., Li, W., Ren, Z., Ding, Q., Peng, X., Tang, Z., Pang, J., Xu, Y., & Sun, Z. (2023). Different Fatty Acid Supplementation in Low-Protein Diets Regulate Nutrient Utilization and Lipid and Amino Acid Metabolism in Weaned Pigs Model. International Journal of Molecular Sciences, 24(10), 8501. https://doi.org/10.3390/ijms24108501

