First Characterization of Human Dermal Fibroblasts Showing a Decreased Xylosyltransferase-I Expression Induced by the CRISPR/Cas9 System
Abstract
:1. Introduction
2. Results
2.1. Generation of CRISPR/Cas9 Based Neonatal NHDF-Cells Showing a Strongly Reduced XYLT1 Expression
2.2. Characterization of Neonatal NHDF Cells Showing a Diminished XYLT1 Expression
2.2.1. Transcriptional Level
2.2.2. Translational Level
2.3. Wound-Healing
2.4. Cellular Senescence
2.5. Proliferation Capability
3. Discussion
4. Materials and Methods
4.1. Cell Culture
4.2. CRISPR/Cas9 Workflow
4.2.1. Transfection of NHDF-Cells with a CRISPR/Cas9 All-in-One Vector
4.2.2. Isolation of GFP-Positive NHDF Cells Using FACS-Technology
4.2.3. T7 Endonuclease Assay
4.2.4. TA-Cloning
4.3. Treatment of Dermal Fibroblasts with TGF-β1
4.4. Nucleic Acid Extraction and Reverse Transcription
4.5. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.6. Mass Spectrometric XT-I Assay
4.7. Quantification of Cellular Senescence
4.8. Quantification of α-SMA Protein Expression by Immunostaining and Western Blot
4.9. Wound Healing Assay
4.10. WST-I Proliferation Assay
4.11. Statistics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Faust, I.; Roch, C.; Kuhn, J.; Prante, C.; Knabbe, C.; Hendig, D. Human xylosyltransferase-I-A new marker for myofibroblast differentiation in skin fibrosis. Biochem. Biophys. Res. Commun. 2013, 436, 449–454. [Google Scholar] [CrossRef] [PubMed]
- Hinz, B.; Phan, S.H.; Thannickal, V.J.; Galli, A.; Bochaton-Piallat, M.-L.; Gabbiani, G. The Myofibroblast: One Function, Multiple Origins. Am. J. Pathol. 2007, 170, 1807–1816. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Shan, B.; Klingsberg, R.C.; Qin, X.; Lasky, J.A. Abrogation of TGF-β1-induced fibroblast-myofibroblast differentiation by histone deacetylase inhibition. Am. J. Physiol. Lung Cell Mol. Physiol. 2009, 297, L864–L870. [Google Scholar] [CrossRef] [Green Version]
- Shinde, A.V.; Humeres, C.; Frangogiannis, N.G. The role of α-smooth muscle actin in fibroblast-mediated matrix contraction and remodeling. Biochim. Biophys. Acta 2016, 1863, 298–309. [Google Scholar] [CrossRef] [PubMed]
- Baum, J.; Duffy, H.S. Fibroblasts and Myofibroblasts: What are we talking about? J. Cardiovasc. Pharmacol. 2011, 57, 376–379. [Google Scholar] [CrossRef]
- van Koningsbruggen, S.; Knoester, H.; Bakx, R.; Mook, O.; Knegt, L.; Cobben, J.M. Complete and partial XYLT1 deletion in a patient with neonatal short limb skeletal dysplasia. Am. J. Med. Genet. A 2016, 170A, 510–514. [Google Scholar] [CrossRef] [PubMed]
- Rajabi, F.; Bereshneh, A.H.; Ramezanzadeh, M.; Garshasbi, M. Novel compound heterozygous variants in XYLT1 gene caused Desbuquois dysplasia type 2 in an aborted fetus: A case report. BMC Pediatr. 2022, 22, 63. [Google Scholar] [CrossRef]
- Kausar, M.; Chew, E.G.Y.; Ullah, H.; Anees, M.; Khor, C.C.; Foo, J.N.; Makitie, O.; Siddiqi, S. A Novel Homozygous Frameshift Variant in XYLT2 Causes Spondyloocular Syndrome in a Consanguineous Pakistani Family. Front. Genet. 2019, 10, 144. [Google Scholar] [CrossRef]
- Taylan, F.; Costantini, A.; Coles, N.; Pekkinen, M.; Héon, E.; Şıklar, Z.; Berberoğlu, M.; Kämpe, A.; Kıykım, E.; Grigelioniene, G.; et al. Spondyloocular Syndrome: Novel Mutations in XYLT2 Gene and Expansion of the Phenotypic Spectrum. J. Bone Miner. Res. 2016, 31, 1577–1585. [Google Scholar] [CrossRef] [Green Version]
- Poönighaus, C.; Ambrosius, M.; Casanova, J.C.; Prante, C.; Kuhn, J.; Esko, J.D.; Kleesiek, K.; Goötting, C. Human xylosyltransferase II is involved in the biosynthesis of the uniform tetrasaccharide linkage region in chondroitin sulfate and heparan sulfate proteoglycans. J. Biol. Chem. 2007, 282, 5201–5206. [Google Scholar] [CrossRef] [Green Version]
- Fischer, B.; Kuhn, J.; Ly, T.-D.; Schmidt, V.; Kleine, A.; Hendig, D.; Knabbe, C.; Faust, I. Development of a xylosyltransferase-I-selective UPLC MS/MS activity assay using a specific acceptor peptide. Biochimie 2021, 184, 88–94. [Google Scholar] [CrossRef] [PubMed]
- Fischer, B.; Ly, T.-D.; Schmidt, V.; Hendig, D.; Kuhn, J.; Knabbe, C.; Faust, I. Xylosyltransferase-deficient human HEK293 cells show a strongly reduced proliferation capacity and viability. Biochem. Biophys. Res. Commun. 2020, 521, 507–513. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Faust, I.; Donhauser, E.; Fischer, B.; Ibold, B.; Kuhn, J.; Knabbe, C.; Hendig, D. Characterization of dermal myofibroblast differentiation in pseudoxanthoma elasticum. Exp. Cell Res. 2017, 360, 153–162. [Google Scholar] [CrossRef] [PubMed]
- Riedel, L.; Fischer, B.; Ly, T.-D.; Hendig, D.; Kuhn, J.; Knabbe, C.; Faust, I. microRNA-29b mediates fibrotic induction of human xylosyltransferase-I in human dermal fibroblasts via the Sp1 pathway. Sci. Rep. 2018, 8, 17779. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ciemerych, M.A.; Kenney, A.M.; Sicinska, E.; Kalaszczynska, I.; Bronson, R.T.; Rowitch, D.H.; Gardner, H.; Sicinski, P. Development of mice expressing a single D-type cyclin. Genes Dev. 2002, 16, 3277–3289. [Google Scholar] [CrossRef] [Green Version]
- Desmoulière, A.; Geinoz, A.; Gabbiani, F.; Gabbiani, G. Transforming growth factor-beta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts. J. Cell Biol. 1993, 122, 103–111. [Google Scholar] [CrossRef] [Green Version]
- Ding, H.; Chen, J.; Qin, J.; Chen, R.; Yi, Z. TGF-β-induced α-SMA expression is mediated by C/EBPβ acetylation in human alveolar epithelial cells. Mol. Med. 2021, 27, 22. [Google Scholar] [CrossRef]
- Brenmoehl, S.N.M.J.; Miller, S.N.; Hofmann, C.; Vogl, D.; Falk, W.; Lmerich, G.R.; Rogler, G. Transforming growth factor-β1 induces intestinal myofibroblast differentiation and modulates their migration. World J. Gastroenterol. 2009, 15, 1431–1442. [Google Scholar] [CrossRef] [Green Version]
- Thannickal, V.J.; Lee, D.Y.; White, E.S.; Cui, Z.; Larios, J.M.; Chacon, R.; Horowitz, J.C.; Day, R.M.; Thomas, P.E. Myofibroblast differentiation by transforming growth factor-beta1 is dependent on cell adhesion and integrin signaling via focal adhesion kinase. J. Biol. Chem. 2003, 278, 12384–12389. [Google Scholar] [CrossRef] [Green Version]
- Prante, C.; Milting, H.; Kassner, A.; Farr, M.; Ambrosius, M.; Schön, S.; Seidler, D.G.; El Banayosy, A.; Körfer, R.; Kuhn, J.; et al. Transforming growth factor beta1-regulated xylosyltransferase I activity in human cardiac fibroblasts and its impact for myocardial remodeling. J. Biol. Chem. 2007, 282, 26441–26449. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mis, E.K.; Liem, K.F.; Kong, Y.; Schwartz, N.B.; Domowicz, M.; Weatherbee, S.D. Forward genetics defines Xylt1 as a key, conserved regulator of early chondrocyte maturation and skeletal length. Dev. Biol. 2014, 385, 67–82. [Google Scholar] [CrossRef] [Green Version]
- Rashid, H.; Chen, H.; Hassan, Q.; Javed, A. Dwarfism in Homozygous Agc1CreERT Mice is Associated with Decreased Expression of Aggrecan. Genesis 2017, 55, e23070. [Google Scholar] [CrossRef] [PubMed]
- Jain, M.; Saber, A.Y. Dwarfism. In StatPearls; StatPearls Publishing: Treasure Island, UK, 2022. [Google Scholar]
- Bui, C.; Huber, C.; Tuysuz, B.; Alanay, Y.; Bole-Feysot, C.; Leroy, J.G.; Mortier, G.; Nitschke, P.; Munnich, A.; Cormier-Daire, V. XYLT1 mutations in Desbuquois dysplasia type 2. Am. J. Hum. Genet. 2014, 94, 405–414. [Google Scholar] [CrossRef] [Green Version]
- Swart, M.; Troeberg, L. Effect of Polarization and Chronic Inflammation on Macrophage Expression of Heparan Sulfate Proteoglycans and Biosynthesis Enzymes. J. Histochem. Cytochem. 2018, 67, 9–27. [Google Scholar] [CrossRef] [Green Version]
- Venkatesan, N.; Barré, L.; Magdalou, J.; Mainard, D.; Netter, P.; Fournel-Gigleux, S.; Ouzzine, M. Modulation of xylosyltransferase I expression provides a mechanism regulating glycosaminoglycan chain synthesis during cartilage destruction and repair. FASEB J. 2009, 23, 813–822. [Google Scholar] [CrossRef] [PubMed]
- McCoy, S.Y.; Falgowski, K.A.; Srinivasan, P.P.; Thompson, W.R.; Selva, E.M.; Kirn-Safran, C.B. Serum xylosyltransferase 1 level increases during early posttraumatic osteoarthritis in mice with high bone forming potential. Bone 2012, 51, 224–231. [Google Scholar] [CrossRef] [Green Version]
- Venkatesan, N.; Barré, L.; Bourhim, M.; Magdalou, J.; Mainard, D.; Netter, P.; Fournel-Gigleux, S.; Ouzzine, M. Xylosyltransferase-I regulates glycosaminoglycan synthesis during the pathogenic process of human osteoarthritis. PLoS ONE 2012, 7, e34020. [Google Scholar] [CrossRef]
- Chen, L.; Klass, C.; Woods, A. Syndecan-2 regulates transforming growth factor-beta signaling. J. Biol. Chem. 2004, 279, 15715–15718. [Google Scholar] [CrossRef] [Green Version]
- Suzuki, Y.; Tanigaki, T.; Heimer, D.; Wang, W.; Ross, W.G.; Murphy, G.A.; Sakai, A.; Sussman, H.H.; Vu, T.H.; Raffin, T.A. TGF-beta 1 causes increased endothelial ICAM-1 expression and lung injury. J. Appl. Physiol. 1994, 77, 1281–1287. [Google Scholar] [CrossRef]
- Bui, T.M.; Wiesolek, H.L.; Sumagin, R. ICAM-1: A master regulator of cellular responses in inflammation, injury resolution, and tumorigenesis. J. Leukoc. Biol. 2020, 108, 787–799. [Google Scholar] [CrossRef]
- Figenschau, S.L.; Knutsen, E.; Urbarova, I.; Fenton, C.; Elston, B.; Perander, M.; Mortensen, E.S.; Fenton, K.A. ICAM1 expression is induced by proinflammatory cytokines and associated with TLS formation in aggressive breast cancer subtypes. Sci. Rep. 2018, 8, 11720. [Google Scholar] [CrossRef] [Green Version]
- Clark, P.R.; Manes, T.D.; Pober, J.S.; Kluger, M.S. Increased ICAM-1 Expression Causes Endothelial Cell Leakiness, Cytoskeletal Reorganization and Junctional Alterations. J. Investig. Dermatol. 2007, 127, 762–774. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gordon, C.M.; Gordon, L.B.; Snyder, B.D.; Nazarian, A.; Quinn, N.; Huh, S.; Giobbie-Hurder, A.; Neuberg, D.; Cleveland, R.; Kleinman, M.; et al. Hutchinson-gilford progeria is a skeletal dysplasia. J. Bone Miner. Res. 2011, 26, 1670–1679. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vidak, S.; Foisner, R. Molecular insights into the premature aging disease progeria. Histochem. Cell Biol. 2016, 145, 401–417. [Google Scholar] [CrossRef] [Green Version]
- Lee, J.W.; Ong, E.B.B. Genomic Instability and Cellular Senescence: Lessons From the Budding Yeast. Front. Cell Dev. Biol. 2021, 8, 619126. [Google Scholar] [CrossRef]
- White, E.Z.; Pennant, N.M.; Carter, J.R.; Hawsawi, O.; Odero-Marah, V.; Hinton, C.V. Serum deprivation initiates adaptation and survival to oxidative stress in prostate cancer cells. Sci. Rep. 2020, 10, 12505. [Google Scholar] [CrossRef] [PubMed]
- Kues, W.; Anger, M.; Carnwath, J.; Paul, D.; Motlik, J.; Niemann, H. Cell Cycle Synchronization of Porcine Fetal Fibroblasts: Effects of Serum Deprivation and Reversible Cell Cycle Inhibitors1. Biol. Reprod. 2000, 62, 412–419. [Google Scholar] [CrossRef] [Green Version]
- Dzieran, J.; Fabian, J.; Feng, T.; Coulouarn, C.; Ilkavets, I.; Kyselova, A.; Breuhahn, K.; Dooley, S.; Meindl-Beinker, N.M. Comparative Analysis of TGF-β/Smad Signaling Dependent Cytostasis in Human Hepatocellular Carcinoma Cell Lines. PLoS ONE 2013, 8, e72252. [Google Scholar] [CrossRef]
- Zhang, Y.; Alexander, P.B.; Wang, X.-F. TGF-β Family Signaling in the Control of Cell Proliferation and Survival. Cold Spring Harb. Perspect. Biol. 2017, 9, a022145. [Google Scholar] [CrossRef] [Green Version]
- Rich, J.N.; Zhang, M.; Datto, M.B.; Bigner, D.D.; Wang, X.-F. Transforming Growth Factor-β-mediated p15INK4BInduction and Growth Inhibition in Astrocytes Is SMAD3-dependent and a Pathway Prominently Altered in Human Glioma Cell Lines. J. Biol. Chem. 1999, 274, 35053–35058. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kuhn, J.; Götting, C.; Beahm, B.J.; Bertozzi, C.R.; Faust, I.; Kuzaj, P.; Knabbe, C.; Hendig, D. Xylosyltransferase II is the predominant isoenzyme which is responsible for the steady-state level of xylosyltransferase activity in human serum. Biochem. Biophys. Res. Commun. 2015, 459, 469–474. [Google Scholar] [CrossRef] [PubMed]
- Kuhn, J.; Prante, C.; Schon, S.; Gotting, C.; Kleesiek, K. Measurement of Fibrosis Marker Xylosyltransferase I Activity by HPLC Electrospray Ionization Tandem Mass Spectrometry. Clin. Chem. 2006, 52, 2243–2249. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gary, R.; Kindell, S.M. Quantitative assay of senescence-associated β-galactosidase activity in mammalian cell extracts. Anal. Biochem. 2005, 343, 329–334. [Google Scholar] [CrossRef] [PubMed]
Gene | Protein | 5′-3′Sequence | Reference | TA (°C) | Efficiancy |
---|---|---|---|---|---|
hACAN | ACAN | CACCCCATGCAATTTGAG GCCACTGTGCCCTTTTTA | NM_001135.4 | 63 | 1.92 |
hACTA2 | α-SMA | GACCGAATGCAGAAGGAG CGGTGGACAATGGAAGG | NM_001320855.1 | 59 | 1.90 |
hβ2M | β2M | TGTGCTCGCGCTACTCTCTCTT CGGATGGATGAAACCCAGACA | NM_004048 | 63 | 1.98 |
hGAPDH | GAPDH | AGGTCGGAGTCAACGGAT TCCTGGAAGATGGTGATG | NM_002046 | 63 | 1.83 |
hHPRT1 | HPRT1 | GCTGACCTGCTGGATTAC TGCGACCTTGACCATCTT | NM_000194 | 63 | 1.94 |
hICAM-1 | ICAM-1 | ACCATCTACAGCTTTCCGGC CAATCCCTCTCGTCCAGTCG | NM_000201.3 | 59 | 1.91 |
hSDC2 | SDC2 | GGAGCTGATGAGGATGTA AATGACAGCTGCTAGGAC | NM_002998.3 | 59 | 1.90 |
hXYLT1 | XT-I | TGTGACCTTCTCCACAGACG CCACGATGTGCTTGTACTGG | NM_022166.3 | 63 | 2.00 |
hXYLT2 | XT-II | ACACAGATGACCCGCTTGTGG TTGGTGACCCGCAGGTTGTTG | NM_022167.3 | 63 | 1.95 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fischer, B.; Schmidt, V.; Ly, T.-D.; Kleine, A.; Knabbe, C.; Faust-Hinse, I. First Characterization of Human Dermal Fibroblasts Showing a Decreased Xylosyltransferase-I Expression Induced by the CRISPR/Cas9 System. Int. J. Mol. Sci. 2022, 23, 5045. https://doi.org/10.3390/ijms23095045
Fischer B, Schmidt V, Ly T-D, Kleine A, Knabbe C, Faust-Hinse I. First Characterization of Human Dermal Fibroblasts Showing a Decreased Xylosyltransferase-I Expression Induced by the CRISPR/Cas9 System. International Journal of Molecular Sciences. 2022; 23(9):5045. https://doi.org/10.3390/ijms23095045
Chicago/Turabian StyleFischer, Bastian, Vanessa Schmidt, Thanh-Diep Ly, Anika Kleine, Cornelius Knabbe, and Isabel Faust-Hinse. 2022. "First Characterization of Human Dermal Fibroblasts Showing a Decreased Xylosyltransferase-I Expression Induced by the CRISPR/Cas9 System" International Journal of Molecular Sciences 23, no. 9: 5045. https://doi.org/10.3390/ijms23095045
APA StyleFischer, B., Schmidt, V., Ly, T.-D., Kleine, A., Knabbe, C., & Faust-Hinse, I. (2022). First Characterization of Human Dermal Fibroblasts Showing a Decreased Xylosyltransferase-I Expression Induced by the CRISPR/Cas9 System. International Journal of Molecular Sciences, 23(9), 5045. https://doi.org/10.3390/ijms23095045