Reviewing the Potential Therapeutic Approaches Targeting the Modulation of Gastrointestinal Microflora in Schizophrenia
Abstract
1. Introduction
2. Methodology
2.1. Database Searching Strategy
2.2. Inclusion Criteria
2.3. Exclusion Criteria
2.4. Study Selection
| No. of Patients | Hypervariable Region Primers Sequencer | Microbial Ratio | Year of Publication | Reference |
|---|---|---|---|---|
| n = 117 53/64 | V3-V4 341F 5′-GGACTACHVGGGTWTCTAAT-3′ 805R 5′-ACTCCTACGGGAGGCAGCAG-3′ HiSeq 2500 | Proteobacteria ↑ Firmicutes ↓ Succinivibrio ↑ Megasphaera ↑ Collinsella ↑ Clostridium ↑ Klebsiella ↑ Methanobrevibacter ↑ Blautia ↓ Coprococcus ↓ Roseburia ↓ | 2018 | [37] |
| n = 29 12/17 | V3-V4 357F 5′-CGCTCTTCCGATCTCTGTACGGRAGGCAGCAG-3′ 806R 5′-CGCTCTTCCGATCTGACGGACTACHVGGGTWTCTAAT-3′ MiSeq | Parabacteroides ↑ | 2019 | [34] |
| n = 37 21/16 | V4 515F 5′GTGCCAGCMGCCGCGGTAA-3′ 806R 5′-TAATCTWTGGGVHCATCAGG-3′ MiSeq | Alistipes ↑ Actinobacteria ↑ | 2019 | [39] |
| n = 50 25/25 | V4 HiSeq 2000 | Proteobacteria ↓ Anaerococcus ↑ Haemophilus ↓ Sutterella ↓ Clostridium ↓ | 2019 | [40] |
| n = 194 40/85/69 | V4 515F 5′GTGCCAGCMGCCGCGGTAA-3′ 806R 5′-TAATCTWTGGGVHCATCAGG-3′ MiSeq | Christensenellaceae ↑ Enterobacteriaceae ↑ Pasteurellaceae ↓ Turicibacteraceae ↓ Escherichia ↑ | 2020 | [38] |
| n = 26 10/16 | ITS1F CTTGGTCATTTAGAGGAAGTAA ITS2R GCTGCGTTCTTCATCGATGC 338F 5′- ACTCCTACGGGAGGCAGCAG-3′ 806R 5′-GGACTACHVGGGTWTCTAAT-3′ MiSeq | Proteobacteria ↑ Faecalibacterium ↓ Lachnospiraceae ↓ Chaetomium ↑ Trichoderma ↓ | 2020 | [42] |
| n = 168 84/84 | V4 515F 5′GTGCCAGCMGCCGCGGTAA-3′ 806R 5′-TAATCTWTGGGVHCATCAGG-3′ HiSeq 2500 | Actinobacteria ↑ Deltaproteobacteria ↑ Actinomycetales ↑ Sphingomonadales ↑ Rhodocyclales ↓ Sphingomonadaceae ↑ Alcaligenaceae ↓ Enterococcaceae ↓ Leuconostocaceae ↓ Rhodocyclaceae ↓ Rikenellaceae ↓ Eggerthella ↑ Megasphaera ↑ Enterococcus ↓ Akkermansia muciniphila ↑ Bifidobacterium adolescentis ↑ Clostridium perfringens ↑ Lactobacillus gasseri ↑ Megasphaera elsdeniis ↑ | 2020 | [41] |
| n = 118 32/29/29/28 | V3-V4 MiSeq | Firmicutes ↓ Bacteroidetes ↑ Bacteroidaceae ↑ Rikenellaceae ↑ Tannerellaceae ↑ Bacteroides thetaiotaomicron ↑ Bacteroides uniformis ↑ Parabacteroides goldsteinii ↑ | 2022 | [35] |
| n = 161 90/71 | V3-V4 341F 5′-CCTACGGGNGGCWGCAG-3 ’ 785R 5′-ACTACHVGGGTATCTAATCC-3′ MiSeq | Faecalibacterium ↓ Roseburia ↓ Actinomyces ↑ Butyricicoccus ↓ Prevotella ↑ | 2022 | [36] |
| n = 90 45/45 | V3-V4 341F 5′-CCTACGGGNGGCWGCAG-3′ 805R 5′-GACTACHVGGGTATCTAATCC-3′ NovaSeq 6000 | Bacteroidetes ↓ Fusobacteria ↓ Firmicutes ↑ Verrucomicrobia ↑ Synergistetes ↑ Christensenella ↑ Desulfovibrio ↑ | 2022 | [33] |
3. Discussion
3.1. Unique and Joint Effects of the Composition of Gut Microflora
3.1.1. Probiotics
3.1.2. Vitamin D
3.1.3. Selenium
3.1.4. Olanzapine
3.1.5. Risperidone
3.1.6. Amisulpride
3.1.7. Clozapine
3.1.8. Multiple Antipsychotics
3.2. In-Depth Overview
3.3. Future Directions of Research
3.3.1. Ketamine
3.3.2. Amphetamine
3.3.3. Phencyclidine
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Kahn, R.S.; Sommer, I.E.; Murray, R.M.; Meyer-Lindenberg, A.; Weinberger, D.R.; Cannon, T.D.; O’Donovan, M.; Correll, C.U.; Kane, J.M.; van Os, J.; et al. Schizophrenia. Nat. Rev. Dis. Prim. 2015, 1, 15067. [Google Scholar] [CrossRef] [PubMed]
- Mattila, T.; Koeter, M.; Wohlfarth, T.; Storosum, J.; van den Brink, W.; de Haan, L.; Derks, E.; Leufkens, H.; Denys, D. Impact of DSM-5 changes on the diagnosis and acute treatment of schizophrenia. Schizophr. Bull. 2015, 41, 637–643. [Google Scholar] [CrossRef] [PubMed]
- Antonova, E.; Sharma, T.; Morris, R.; Kumari, V. The relationship between brain structure and neurocognition in schizophrenia: A selective review. Schizophr. Res. 2004, 70, 117–145. [Google Scholar] [CrossRef] [PubMed]
- Orsolini, L.; Pompili, S.; Volpe, U. Schizophrenia: A Narrative Review of Etiopathogenetic, Diagnostic and Treatment Aspects. J. Clin. Med. 2022, 11, 5040. [Google Scholar] [CrossRef] [PubMed]
- Kraepelin, E. Clinical Psychiatry: A Text-Book for Students and Physicians; Macmillan: New York, NY, USA, 1915. [Google Scholar]
- Strauss, J.S.; Carpenter, W.T., Jr.; Bartko, J.J. Part III. Speculations on the Processes That Underlie Schizophrenic Symptoms and Signs. Schizophr. Bull. 1974, 1, 61–69. [Google Scholar] [CrossRef] [PubMed]
- Crow, T.J. Positive and Negative Schizophrenic Symptoms and the Role of Dopamine. Br. J. Psychiatry 1980, 137, 383–386. [Google Scholar] [CrossRef]
- Andreasen, N.C.; Olsen, S. Negative v Positive Schizophrenia: Definition and Validation. Arch. Gen. Psychiatry 1982, 39, 789–794. [Google Scholar] [CrossRef]
- Kirkpatrick, B.; Fenton, W.S.; Carpenter, W.T., Jr.; Marder, S.R. The NIMH-MATRICS Consensus Statement on Negative Symptoms. Schizophr. Bull. 2006, 32, 214–219. [Google Scholar] [CrossRef]
- Galderisi, S.; Mucci, A.; Buchanan, R.W.; Arango, C. Negative symptoms of schizophrenia: New developments and unanswered research questions. Lancet Psychiatry 2018, 5, 664–677. [Google Scholar] [CrossRef] [PubMed]
- Kirkpatrick, B.; Buchanan, R.W.; Ross, D.E.; Carpenter, W.T., Jr. A Separate Disease within the Syndrome of Schizophrenia. Arch. Gen. Psychiatry 2001, 58, 165–171. [Google Scholar] [CrossRef] [PubMed]
- Milev, P.; Ho, B.-C.; Arndt, S.; Andreasen, N.C. Predictive Values of Neurocognition and Negative Symptoms on Functional Outcome in Schizophrenia: A Longitudinal First-Episode Study with 7-Year Follow-Up. Am. J. Psychiatry 2005, 162, 495–506. [Google Scholar] [CrossRef] [PubMed]
- Kessler, R.C.; Birnbaum, H.; Demler, O.; Falloon, I.R.H.; Gagnon, E.; Guyer, M.; Howes, M.J.; Kendler, K.S.; Shi, L.; Walters, E.; et al. The Prevalence and Correlates of Nonaffective Psychosis in the National Comorbidity Survey Replication (NCS-R). Biol. Psychiatry 2005, 58, 668–676. [Google Scholar] [CrossRef] [PubMed]
- Wu, E.Q.; Shi, L.; Birnbaum, H.; Hudson, T.; Kessler, R. Annual prevalence of diagnosed schizophrenia in the USA: A claims data analysis approach. Psychol. Med. 2006, 36, 1535–1540. [Google Scholar] [CrossRef] [PubMed]
- Desai, P.R.; Lawson, K.A.; Barner, J.C.; Rascati, K.L. Estimating the direct and indirect costs for community-dwelling patients with schizophrenia. J. Pharm. Health Serv. Res. 2013, 4, 187–194. [Google Scholar] [CrossRef]
- Saha, S.; Chant, D.; Welham, J.; McGrath, J. A Systematic Review of the Prevalence of Schizophrenia. PLOS Med. 2005, 2, e141. [Google Scholar] [CrossRef]
- Moreno-Küstner, B.; Martín, C.; Pastor, L. Prevalence of psychotic disorders and its association with methodological issues. A systematic review and meta-analyses. PLoS ONE 2018, 13, e0195687. [Google Scholar] [CrossRef]
- Chong, H.Y.; Teoh, S.L.; Wu, D.B.-C.; Kotirum, S.; Chiou, C.-F.; Chaiyakunapruk, N. Global economic burden of schizophrenia: A systematic review. Neuropsychiatr. Dis. Treat. 2016, 12, 357–373. [Google Scholar] [CrossRef]
- McGrath, J.; Saha, S.; Chant, D.; Welham, J. Schizophrenia: A Concise Overview of Incidence, Prevalence, and Mortality. Epidemiol. Rev. 2008, 30, 67–76. [Google Scholar] [CrossRef]
- Weinberger, D.R.; Harrison, P. Schizophrenia, 3rd ed.; John Wiley & Sons: Hoboken, NJ, USA, 2011; pp. 9–23. ISBN 9781444327298. [Google Scholar]
- Laursen, T.M.; Nordentoft, M.; Mortensen, P.B. Excess Early Mortality in Schizophrenia. Annu. Rev. Clin. Psychol. 2014, 10, 425–448. [Google Scholar] [CrossRef]
- Brown, A.S. The environment and susceptibility to schizophrenia. Prog. Neurobiol. 2011, 93, 23–58. [Google Scholar] [CrossRef]
- Li, Z.; Chen, J.; Yu, H.; He, L.; Xu, Y.; Zhang, D.; Yi, Q.; Li, C.; Li, X.; Shen, J.; et al. Genome-wide association analysis identifies 30 new susceptibility loci for schizophrenia. Nat. Genet. 2017, 49, 1576–1583. [Google Scholar] [CrossRef] [PubMed]
- Singh, T.; Walters, J.T.R.; Johnstone, M.; Curtis, D.; Suvisaari, J.; Torniainen, M.; Rees, E.; Iyegbe, C.; Blackwood, D.; McIntosh, A.M.; et al. The contribution of rare variants to risk of schizophrenia in individuals with and without intellectual disability. Nat. Genet. 2017, 49, 1167–1173. [Google Scholar] [CrossRef]
- Marshall, C.R.; Howrigan, D.P.; Merico, D.; Thiruvahindrapuram, B.; Wu, W.; Greer, D.S.; Antaki, D.; Shetty, A.; Holmans, P.A.; Pinto, D.; et al. Contribution of copy number variants to schizophrenia from a genome-wide study of 41,321 subjects. Nat. Genet. 2017, 49, 27–35. [Google Scholar] [CrossRef]
- Xu, B.; Roos, J.L.; Dexheimer, P.; Boone, B.; Plummer, B.; Levy, S.; Gogos, J.A.; Karayiorgou, M. Exome sequencing supports a de novo mutational paradigm for schizophrenia. Nat. Genet. 2011, 43, 864–868. [Google Scholar] [CrossRef] [PubMed]
- Ripke, S.; Neale, B.M.; Corvin, A.; Walters, J.T.R.; Farh, K.-H.; Holmans, P.A.; Lee, P.; Bulik-Sullivan, B.; Collier, D.A.; Huang, H.; et al. Biological insights from 108 schizophrenia-associated genetic loci. Nature 2014, 511, 421–427. [Google Scholar]
- Stevović, L.I.; Repišti, S.; Radojičić, T.; Sartorius, N.; Tomori, S.; Kulenović, A.D.; Popova, A.; Kuzman, M.R.; Vlachos, I.I.; Statovci, S.; et al. Non-pharmacological interventions for schizophrenia—Analysis of treatment guidelines and implementation in 12 Southeast European countries. Schizophrenia 2022, 8, 10. [Google Scholar] [CrossRef]
- Stroup, T.S.; Gray, N. Management of common adverse effects of antipsychotic medications. World Psychiatry 2018, 17, 341–356. [Google Scholar] [CrossRef]
- Nikolova, V.L.; Hall, M.R.B.; Hall, L.J.; Cleare, A.J.; Stone, J.M.; Young, A.H. Perturbations in Gut Microbiota Composition in Psychiatric Disorders: A Review and Meta-analysis. JAMA Psychiatry 2021, 78, 1343–1354. [Google Scholar] [CrossRef]
- Szeligowski, T.; Yun, A.; Lennox, B.; Burnet, P. The Gut Microbiome and Schizophrenia: The Current State of the Field and Clinical Applications. Front. Psychiatry 2020, 11, 156. [Google Scholar] [CrossRef]
- Green, B.N.; Johnson, C.D.; Adams, A. Writing narrative literature reviews for peer-reviewed journals: Secrets of the trade. J. Chiropr. Med. 2006, 5, 101–117. [Google Scholar] [CrossRef]
- Xu, Y.; Shao, M.; Fang, X.; Tang, W.; Zhou, C.; Hu, X.; Zhang, X.; Su, K.-P. Antipsychotic-induced gastrointestinal hypomotility and the alteration in gut microbiota in patients with schizophrenia. Brain. Behav. Immun. 2022, 99, 119–129. [Google Scholar] [CrossRef] [PubMed]
- Okubo, R.; Koga, M.; Katsumata, N.; Odamaki, T.; Matsuyama, S.; Oka, M.; Narita, H.; Hashimoto, N.; Kusumi, I.; Xiao, J.; et al. Effect of bifidobacterium breve A-1 on anxiety and depressive symptoms in schizophrenia: A proof-of-concept study. J. Affect. Disord. 2019, 245, 377–385. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Liu, C.; Yang, Y.; Kang, D.; Xiao, J.; Long, Y.; Lang, B.; Peng, X.; Wang, W.; Wang, X.; et al. The effects of probiotics plus dietary fiber on antipsychotic-induced weight gain: A randomized clinical trial. Transl. Psychiatry 2022, 12, 185. [Google Scholar] [CrossRef] [PubMed]
- Ling, Z.; Jin, G.; Yan, X.; Cheng, Y.; Shao, L.; Song, Q.; Liu, X.; Zhao, L. Fecal Dysbiosis and Immune Dysfunction in Chinese Elderly Patients with Schizophrenia: An Observational Study. Front. Cell. Infect. Microbiol. 2022, 12, 886872. [Google Scholar] [CrossRef]
- Shen, Y.; Xu, J.; Li, Z.; Huang, Y.; Yuan, Y.; Wang, J.; Zhang, M.; Hu, S.; Liang, Y. Analysis of gut microbiota diversity and auxiliary diagnosis as a biomarker in patients with schizophrenia: A cross-sectional study. Schizophr. Res. 2018, 197, 470–477. [Google Scholar] [CrossRef]
- Ma, X.; Asif, H.; Dai, L.; He, Y.; Zheng, W.; Wang, D.; Ren, H.; Tang, J.; Li, C.; Jin, K.; et al. Alteration of the gut microbiome in first-episode drug-naïve and chronic medicated schizophrenia correlate with regional brain volumes. J. Psychiatry Res. 2020, 123, 136–144. [Google Scholar] [CrossRef]
- Flowers, S.A.; Baxter, N.T.; Ward, K.M.; Kraal, A.Z.; McInnis, M.G.; Schmidt, T.M.; Ellingrod, V.L. Effects of Atypical Antipsychotic Treatment and Resistant Starch Supplementation on Gut Microbiome Composition in a Cohort of Patients with Bipolar Disorder or Schizophrenia. Pharmacother. J. Hum. Pharmacol. Drug Ther. 2019, 39, 161–170. [Google Scholar] [CrossRef]
- Nguyen, T.T.; Kosciolek, T.; Maldonado, Y.; Daly, R.E.; Martin, A.S.; McDonald, D.; Knight, R.; Jeste, D. V Differences in gut microbiome composition between persons with chronic schizophrenia and healthy comparison subjects. Schizophr. Res. 2019, 204, 23–29. [Google Scholar] [CrossRef]
- Xu, R.; Wu, B.; Liang, J.; He, F.; Gu, W.; Li, K.; Luo, Y.; Chen, J.; Gao, Y.; Wu, Z.; et al. Altered gut microbiota and mucosal immunity in patients with schizophrenia. Brain. Behav. Immun. 2020, 85, 120–127. [Google Scholar] [CrossRef]
- Zhang, X.; Pan, L.; Zhang, Z.; Zhou, Y.; Jiang, H.; Ruan, B. Analysis of gut mycobiota in first-episode, drug-naïve Chinese patients with schizophrenia: A pilot study. Behav. Brain Res. 2020, 379, 112374. [Google Scholar] [CrossRef]
- Yamamura, R.; Okubo, R.; Katsumata, N.; Odamaki, T.; Hashimoto, N.; Kusumi, I.; Xiao, J.; Matsuoka, Y.J. Lipid and Energy Metabolism of the Gut Microbiota Is Associated with the Response to Probiotic Bifidobacterium breve Strain for Anxiety and Depressive Symptoms in Schizophrenia. J. Pers. Med. 2021, 11, 987. [Google Scholar] [CrossRef] [PubMed]
- Ghaderi, A.; Banafshe, H.R.; Mirhosseini, N.; Moradi, M.; Karimi, M.-A.; Mehrzad, F.; Bahmani, F.; Asemi, Z. Clinical and metabolic response to vitamin D plus probiotic in schizophrenia patients. BMC Psychiatry 2019, 19, 77. [Google Scholar] [CrossRef] [PubMed]
- Jamilian, H.; Ghaderi, A. The Effects of Probiotic and Selenium Co-supplementation on Clinical and Metabolic Scales in Chronic Schizophrenia: A Randomized, Double-blind, Placebo-Controlled Trial. Biol. Trace Elem. Res. 2021, 199, 4430–4438. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Long, Y.; Kang, D.; Liu, C.; Xiao, J.; Wu, R.; Zhao, J. Effect of Bifidobacterium on olanzapine-induced body weight and appetite changes in patients with psychosis. Psychopharmacology 2021, 238, 2449–2457. [Google Scholar] [CrossRef]
- Huang, J.; Kang, D.; Zhang, F.; Yang, Y.; Liu, C.; Xiao, J.; Long, Y.; Lang, B.; Peng, X.; Wang, W.; et al. Probiotics Plus Dietary Fiber Supplements Attenuate Olanzapine-Induced Weight Gain in Drug-Naïve First-Episode Schizophrenia Patients: Two Randomized Clinical Trials. Schizophr. Bull. 2022, 48, 850–859. [Google Scholar] [CrossRef]
- Yuan, X.; Zhang, P.; Wang, Y.; Liu, Y.; Li, X.; Kumar, B.U.; Hei, G.; Lv, L.; Huang, X.-F.; Fan, X.; et al. Changes in metabolism and microbiota after 24-week risperidone treatment in drug naïve, normal weight patients with first episode schizophrenia. Schizophr. Res. 2018, 201, 299–306. [Google Scholar] [CrossRef]
- Zheng, J.; Lin, Z.; Ko, C.-Y.; Xu, J.-H.; Lin, Y.; Wang, J. Analysis of Gut Microbiota in Patients with Exacerbated Symptoms of Schizophrenia following Therapy with Amisulpride: A Pilot Study. Behav. Neurol. 2022, 2022, 4262094. [Google Scholar] [CrossRef]
- Gorbovskaya, I.; Kanji, S.; Liu, J.C.W.; MacKenzie, N.E.; Agarwal, S.M.; Marshe, V.S.; Sriretnakumar, V.; Verdu, E.F.; Bercik, P.; De Palma, G.; et al. Investigation of the Gut Microbiome in Patients with Schizophrenia and Clozapine-Induced Weight Gain: Protocol and Clinical Characteristics of First Patient Cohorts. Neuropsychobiology 2020, 79, 5–12. [Google Scholar] [CrossRef]
- Li, X.; Yuan, X.; Pang, L.; Zhang, S.; Li, Y.; Huang, X.; Fan, X.; Song, X. The effect of serum lipids and short-chain fatty acids on cognitive functioning in drug-naïve, first episode schizophrenia patients. Psychiatry Res. 2022, 313, 114582. [Google Scholar] [CrossRef]
- Jansma, J.; van Essen, R.; Haarman, B.C.M.; Chatziioannou, A.C.; Borkent, J.; Ioannou, M.; van Hemert, S.; Sommer, I.E.C.; El Aidy, S. Metabolic phenotyping reveals a potential link between elevated faecal amino acids, diet and symptom severity in individuals with severe mental illness. J. Psychiatr. Res. 2022, 151, 507–515. [Google Scholar] [CrossRef]
- Yi, W.; Ji, Y.; Gao, H.; Pan, R.; Wei, Q.; Cheng, J.; Song, J.; He, Y.; Tang, C.; Liu, X.; et al. Does the gut microbiome partially mediate the impact of air pollutants exposure on liver function? Evidence based on schizophrenia patients. Environ. Pollut. 2021, 291, 118135. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Ju, Y.; Wang, W.; Wang, Q.; Guo, R.; Ma, Q.; Sun, Q.; Fan, Y.; Xie, Y.; Yang, Z.; et al. Metagenome-wide association of gut microbiome features for schizophrenia. Nat. Commun. 2020, 11, 1612. [Google Scholar] [CrossRef] [PubMed]
- Zheng, P.; Zeng, B.; Liu, M.; Chen, J.; Pan, J.; Han, Y.; Liu, Y.; Cheng, K.; Zhou, C.; Wang, H.; et al. The gut microbiome from patients with schizophrenia modulates the glutamate-glutamine-GABA cycle and schizophrenia-relevant behaviors in mice. Sci. Adv. 2022, 5, eaau8317. [Google Scholar] [CrossRef] [PubMed]
- Gronier, B.; Savignac, H.M.; Di Miceli, M.; Idriss, S.M.; Tzortzis, G.; Anthony, D.; Burnet, P.W.J. Increased cortical neuronal responses to NMDA and improved attentional set-shifting performance in rats following prebiotic (B-GOS®) ingestion. Eur. Neuropsychopharmacol. 2018, 28, 211–224. [Google Scholar] [CrossRef] [PubMed]
- Keefe, R.S.E.; Harvey, P.D.; Goldberg, T.E.; Gold, J.M.; Walker, T.M.; Kennel, C.; Hawkins, K. Norms and standardization of the Brief Assessment of Cognition in Schizophrenia (BACS). Schizophr. Res. 2008, 102, 108–115. [Google Scholar] [CrossRef]
- Kao, A.C.-C.; Safarikova, J.; Marquardt, T.; Mullins, B.; Lennox, B.R.; Burnet, P.W.J. Pro-cognitive effect of a prebiotic in psychosis: A double blind placebo controlled cross-over study. Schizophr. Res. 2019, 208, 460–461. [Google Scholar] [CrossRef] [PubMed]
- Savignac, H.M.; Corona, G.; Mills, H.; Chen, L.; Spencer, J.P.E.; Tzortzis, G.; Burnet, P.W.J. Prebiotic feeding elevates central brain derived neurotrophic factor, N-methyl-d-aspartate receptor subunits and d-serine. Neurochem. Int. 2013, 63, 756–764. [Google Scholar] [CrossRef] [PubMed]
- Zhu, F.; Guo, R.; Wang, W.; Ju, Y.; Wang, Q.; Ma, Q.; Sun, Q.; Fan, Y.; Xie, Y.; Yang, Z.; et al. Transplantation of microbiota from drug-free patients with schizophrenia causes schizophrenia-like abnormal behaviors and dysregulated kynurenine metabolism in mice. Mol. Psychiatry 2020, 25, 2905–2918. [Google Scholar] [CrossRef]
- Qu, Y.; Yang, C.; Ren, Q.; Ma, M.; Dong, C.; Hashimoto, K. Comparison of (R)-ketamine and lanicemine on depression-like phenotype and abnormal composition of gut microbiota in a social defeat stress model. Sci. Rep. 2017, 7, 15725. [Google Scholar] [CrossRef]
- Yang, C.; Qu, Y.; Fujita, Y.; Ren, Q.; Ma, M.; Dong, C.; Hashimoto, K. Possible role of the gut microbiota–brain axis in the antidepressant effects of (R)-ketamine in a social defeat stress model. Transl. Psychiatry 2017, 7, 1294. [Google Scholar] [CrossRef]
- Huang, N.; Hua, D.; Zhan, G.; Li, S.; Zhu, B.; Jiang, R.; Yang, L.; Bi, J.; Xu, H.; Hashimoto, K.; et al. Role of Actinobacteria and Coriobacteriia in the antidepressant effects of ketamine in an inflammation model of depression. Pharmacol. Biochem. Behav. 2019, 176, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Getachew, B.; Aubee, J.I.; Schottenfeld, R.S.; Csoka, A.B.; Thompson, K.M.; Tizabi, Y. Ketamine interactions with gut-microbiota in rats: Relevance to its antidepressant and anti-inflammatory properties. BMC Microbiol. 2018, 18, 222. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Yu, X.; Liu, X.; Liu, G.; Zeng, K.; Wang, G. Altered fecal microbiota composition in individuals who abuse methamphetamine. Sci. Rep. 2021, 11, 18178. [Google Scholar] [CrossRef] [PubMed]
- Pyndt Jørgensen, B.; Krych, L.; Pedersen, T.B.; Plath, N.; Redrobe, J.P.; Hansen, A.K.; Nielsen, D.S.; Pedersen, C.S.; Larsen, C.; Sørensen, D.B. Investigating the long-term effect of subchronic phencyclidine-treatment on novel object recognition and the association between the gut microbiota and behavior in the animal model of schizophrenia. Physiol. Behav. 2015, 141, 32–39. [Google Scholar] [CrossRef] [PubMed]

| Vitamin D and Selenium | Reference |
|---|---|
| [44,45] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nita, I.-B.; Ilie, O.-D.; Ciobica, A.; Hritcu, L.-D.; Dobrin, I.; Doroftei, B.; Dobrin, R. Reviewing the Potential Therapeutic Approaches Targeting the Modulation of Gastrointestinal Microflora in Schizophrenia. Int. J. Mol. Sci. 2022, 23, 16129. https://doi.org/10.3390/ijms232416129
Nita I-B, Ilie O-D, Ciobica A, Hritcu L-D, Dobrin I, Doroftei B, Dobrin R. Reviewing the Potential Therapeutic Approaches Targeting the Modulation of Gastrointestinal Microflora in Schizophrenia. International Journal of Molecular Sciences. 2022; 23(24):16129. https://doi.org/10.3390/ijms232416129
Chicago/Turabian StyleNita, Ilinca-Bianca, Ovidiu-Dumitru Ilie, Alin Ciobica, Luminita-Diana Hritcu, Irina Dobrin, Bogdan Doroftei, and Romeo Dobrin. 2022. "Reviewing the Potential Therapeutic Approaches Targeting the Modulation of Gastrointestinal Microflora in Schizophrenia" International Journal of Molecular Sciences 23, no. 24: 16129. https://doi.org/10.3390/ijms232416129
APA StyleNita, I.-B., Ilie, O.-D., Ciobica, A., Hritcu, L.-D., Dobrin, I., Doroftei, B., & Dobrin, R. (2022). Reviewing the Potential Therapeutic Approaches Targeting the Modulation of Gastrointestinal Microflora in Schizophrenia. International Journal of Molecular Sciences, 23(24), 16129. https://doi.org/10.3390/ijms232416129

