MoDHX35, a DEAH-Box Protein, Is Required for Appressoria Formation and Full Virulence of the Rice Blast Fungus, Magnaporthe oryzae
Abstract
:1. Introduction
2. Results
2.1. Isolation and Analysis of the Gene Locus Inserted by T-DNA
2.2. MoDHX35 Is Up-Regulated during Appressoria Formation
2.3. Gene Replacement of MoDHX35 and Mutant Recovery
2.4. Loss of MoDHX35 Increases the Sensitivity of the Mutant to Doxorubicin
2.5. MoDHX35 Contributes to M. oryzae Appressorium Formation
2.6. MoDHX35 Is Required for M. oryzae Pathogenicity
2.7. Deletion of MoDHX35 Does Not Affect the Sexual Development of the Fungus
2.8. MoDHX35 Mutants Are Not Temperature Sensitive
2.9. Deletion of MoDHX35 Does Not Alter the Nutritional Utilization, Osmic STRESS or Resistance to Chemicals of the Fungus
3. Discussion
4. Material and Methods
4.1. Fungal Strains and Growth Conditions
4.2. MoDHX35 Isolation and Sequence Analysis
4.3. Vector Construction, Gene Deletion and Mutant Complementation
4.4. Vegetable Growth and Conidiation on Culture Media
4.5. Assay for Conidial Germination and Appressorial Formation
4.6. Pathogenicity Tests
4.7. Nucleic Acid Manipulations and Quantitative RT-PCR
4.8. Sexual Reproduction
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Ou, S.H. Rice Diseases; Kew Commonwealth Mycological Institute: Kew, UK, 1985. [Google Scholar]
- Dean, R.; Van Kan, J.A.; Pretorius, Z.A.; Hammond-Kosack, K.E.; Di Pietro, A.; Spanu, P.D.; Rudd, J.J.; Dickman, M.; Kahmann, R.; Ellis, J.; et al. The Top 10 fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 2012, 13, 414–430. [Google Scholar] [CrossRef] [PubMed]
- Sesma, A.; Osbourn, A.E. The rice leaf blast pathogen undergoes developmental processes typical of root-infecting fungi. Nature 2004, 431, 582–586. [Google Scholar] [CrossRef] [PubMed]
- Arun, K.; Singh, R.A. Host range of some isolates of Magnaporthe grisea and their grouping into forma-specialis. Indian Phytopathol. 1995, 48, 210–212. [Google Scholar]
- Talbot, N.J. Having a blast: Exploring the pathogenicity of Magnaporthe grisea. Trends Microbiol. 1995, 3, 9–16. [Google Scholar] [CrossRef]
- Talbot, N.J. On the trail of a cereal killer: Exploring the biology of Magnaporthe grisea. Annu. Rev. Microbiol. 2003, 57, 177–202. [Google Scholar] [CrossRef]
- Wilson, R.A.; Talbot, N.J. Under pressure: Investigating the biology of plant infection by Magnaporthe oryzae. Nat. Rev. Microbiol. 2009, 7, 185–195. [Google Scholar] [CrossRef] [PubMed]
- Dagdas, Y.F.; Yoshino, K.; Dagdas, G.; Ryder, L.S.; Bielska, E.; Steinberg, G.; Talbot, N.J. Septin-mediated plant cell invasion by the rice blast fungus, Magnaporthe oryzae. Science 2012, 336, 1590–1595. [Google Scholar] [CrossRef] [PubMed]
- Xu, J.R.; Hamer, J.E. MAP kinase and cAMP signaling regulate infection structure formation and pathogenic growth in the rice blast fungus Magnaporthe grisea. Genes Dev. 1996, 10, 2696–2706. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, J.; Orth, K. Rise of a cereal killer: The biology of Magnaporthe oryzae biotrophic growth. Trends Microbiol. 2018, 26, 582–597. [Google Scholar] [CrossRef] [PubMed]
- Talbot, N.J.; Ebbole, D.J.; Hamer, J.E. Identification and characterization of MPG1, a gene involved in pathogenicity from the rice blast fungus Magnaporthe grisea. Plant Cell 1993, 5, 1575–1590. [Google Scholar] [PubMed]
- Beckerman, J.L.; Ebbole, D.J. MPG1, a gene encoding a fungal hydrophobin of Magnaporthe grisea, is involved in surface recognition. Mol. Plant-Microbe Interact. 1996, 9, 450–456. [Google Scholar] [CrossRef] [PubMed]
- Pham, C.L.L.; Rey, A.; Lo, V.; Soulès, M.; Ren, Q.; Meisl, G.; Knowles, T.P.J.; Kwan, A.H.; Sunde, M. Self-assembly of MPG1, a hydrophobin protein from the rice blast fungus that forms functional amyloid coatings, occurs by a surface-driven mechanism. Sci. Rep. 2016, 6, 25288. [Google Scholar] [CrossRef] [PubMed]
- Inoue, K.; Kitaoka, H.; Park, P.; Ikeda, K. Novel aspects of hydrophobins in wheat isolate of Magnaporthe oryzae: Mpg1, but not Mhp1, is essential for adhesion and pathogenicity. J. Gen. Plant Pathol. 2016, 82, 18–28. [Google Scholar] [CrossRef]
- Dezwaan, T.M.; Carroll, A.M.; Valent, B.; Sweigard, J.A. Magnaporthe grisea Pth11p is a novel plasma membrane protein that mediates appressorium differentiation in response to inductive substrate cues. Plant Cell 1999, 11, 2013–2030. [Google Scholar] [CrossRef]
- Kou, Y.; Tan, Y.H.; Ramanujam, R.; Naqvi, N.I. Structure–function analyses of the Pth11 receptor reveal an important role for CFEM motif and redox regulation in rice blast. New Phytol. 2017, 214, 330–342. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, T.K.; Dean, R.A. The cAMP-dependent protein kinase catalytic subunit is required for appressorium formation and pathogenesis by the rice blast pathogen Magnaporthe grisea. Plant Cell 1995, 7, 1869–1878. [Google Scholar]
- Xu, J.R.; Urban, M.; Sweigard, J.A.; Hamer, J.E. The CPKA gene of Magnaporthe grisea is essential for appressorial penetration. Mol. Plant-Microbe Interact. 1997, 10, 187–194. [Google Scholar] [CrossRef]
- Thines, E.; Weber, R.W.; Talbot, N.J. MAP kinase and protein kinase A-dependent mobilization of triacylglycerol and glycogen during appressorium turgor generation by Magnaporthe grisea. Plant Cell 2000, 12, 1703–1718. [Google Scholar]
- Adachi, K.; Hamer, J.E. Divergent cAMP signaling pathways regulate growth and pathogenesis in the rice blast fungus Magnaporthe grisea. Plant Cell 1998, 10, 1361–1373. [Google Scholar] [CrossRef]
- Jin, Q.; Li, C.; Li, Y.; Shang, J.; Li, D.; Chen, B.; Dong, H. Complexity of roles and regulation of the PMK1-MAPK pathway in mycelium development, conidiation and appressorium formation in Magnaporthe oryzae. Gene Expr. Patterns 2013, 13, 133–141. [Google Scholar] [CrossRef]
- Park, G.; Xue, C.; Zheng, L.; Lam, S.; Xu, J.R. MST12 regulates infectious growth but not appressorium formation in the rice blast fungus Magnaporthe grisea. Mol. Plant-Microbe Interact. 2002, 15, 183–192. [Google Scholar] [CrossRef] [PubMed]
- Park, G.; Bruno, K.S.; Staiger, C.J.; Talbot, N.J.; Xu, J.R. Independent genetic mechanisms mediate turgor generation and penetration peg formation during plant infection in the rice blast fungus. Mol. Microbiol. 2004, 53, 1695–1707. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Dean, R.A. G protein α subunit genes control growth, development, and pathogenicity of Magnaporthe grisea. Mol. Plant-Microbe Interact. 1997, 10, 1075–1086. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zheng, W.; Zheng, S.; Zhang, D.; Sang, W.; Chen, X.; Li, G.; Lu, G.; Wang, Z. Rac1 is required for pathogenicity and Chm1-dependent conidiogenesis in rice fungal pathogen Magnaporthe grisea. PLoS Pathog. 2008, 4, e1000202. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Wang, Y.; Li, C.; Zheng, X. Ca2+ signaling pathway involved in Magnaporthe grisea conidium germination and appressorium formation. Mycosystema 2003, 22, 457–465. [Google Scholar]
- Liu, H.; Suresh, A.; Willard, F.S.; Siderovski, D.P.; Lu, S.; Naqvi, N.I. Rgs1 regulates multiple Galpha subunits in Magnaporthe pathogenesis, asexual growth and thigmotropism. EMBO J. 2007, 26, 690–700. [Google Scholar] [CrossRef] [PubMed]
- Wu, C.G.; Spies, M. Overview: What Are Helicases? In DNA Helicases and DNA Motor Proteins; Spies, M., Ed.; Springer: New York, NY, USA, 2013; pp. 1–16. [Google Scholar]
- Patel, S.S.; Donmez, I. Mechanisms of helicases. J. Biol. Chem. 2006, 281, 18265–18268. [Google Scholar] [CrossRef] [PubMed]
- Abdelhaleem, M. Helicases: An Overview; Methods in Molecular Biology; Humana Press Inc: Totowa, NJ, USA, 2010; Volume 587, pp. 1–12. [Google Scholar]
- Granneman, S.; Bernstein, K.A.; Bleichert, F.; Baserga, S.J. Comprehensive mutational analysis of yeast DEXD/H box RNA helicases required for small ribosomal subunit synthesis. Mol. Cell Biol. 2006, 26, 1183–1194. [Google Scholar] [CrossRef] [PubMed]
- Fuller-Pace, F.V. DExD/H box RNA helicases: Multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res. 2006, 34, 4206–4215. [Google Scholar] [CrossRef]
- Chang, T.-H.; Tung, L.; Yeh, F.-L.; Chen, J.-H.; Chang, S.-L. Functions of the DExD/H-box proteins in nuclear pre-mRNA splicing. Biochim. Biophys. Acta BBA Gene Regul. Mech. 2013, 1829, 764–774. [Google Scholar] [CrossRef]
- Martin, R.; Straub, A.U.; Doebele, C.; Bohnsack, M.T. DExD/H-box RNA helicases in ribosome biogenesis. RNA Biol. 2013, 10, 4–18. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; You, J.; Wang, X.; Weber, J. The DHX33 RNA Helicase Promotes mRNA Translation Initiation. Mol. Cell Biol. 2015, 35, 2918–2931. [Google Scholar] [CrossRef] [PubMed]
- Bakari-Soale, M.; Ikenga, N.J.; Scheibe, M.; Butter, F.; Jones, N.G.; Kramer, S.; Engstler, M. The nucleolar DExD/H protein Hel66 is involved in ribosome biogenesis in Trypanosoma brucei. Sci. Rep. 2021, 11, 18325. [Google Scholar] [CrossRef] [PubMed]
- Kadotani, N.; Nakayashiki, H.; Tosa, Y.; Mayama, S. One of the Two Dicer-like Proteins in the Filamentous Fungi Magnaporthe oryzae Genome Is Responsible for Hairpin RNA-triggered RNA Silencing and Related Small Interfering RNA Accumulation. J. Biol. Chem. 2004, 279, 44467–44474. [Google Scholar] [CrossRef] [PubMed]
- Brai, A.; Fazi, R.; Tintori, C.; Zamperini, C.; Bugli, F.; Sanguinetti, M.; Stigliano, E.; Esté, J.; Badia, R.; Franco, S.; et al. Human DDX3 protein is a valuable target to develop broad spectrum antiviral agents. Proc. Natl. Acad. Sci. USA 2016, 113, 5388–5393. [Google Scholar] [CrossRef] [PubMed]
- Wagner, J.D.O.; Jankowsky, E.; Company, M.; Pyle, A.M.; Abelson, J.N. The DEAH-box protein PRP22 is an ATPase that mediates ATP-dependent mRNA release from the spliceosome and unwinds RNA duplexes. EMBO J. 1998, 17, 2926–2937. [Google Scholar] [CrossRef] [PubMed]
- English, M.A.; Lei, L.; Blake, T.; Sood, R.; Liu, P.P. Mutation in the Zebrafish Homolog of the RNA Helicase DHX8 Result in Hematopoietic Defects. Blood 2005, 106, 126. [Google Scholar] [CrossRef]
- Boneberg, F.M.; Brandmann, T.; Kobel, L.; Heuvel, J.; Bargsten, K.; Bammert, U.K.; Jinek, M. Molecular mechanism of the RNA helicase DHX37 and its activation by UTP14 in ribosome biogenesis. RNA 2019, 25, 685–701. [Google Scholar] [CrossRef] [PubMed]
- Green, M.R.; Sambrook, J. Molecular Cloning: A Laboratory Manual, 4th ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2014; Volume 33, pp. 721–722. [Google Scholar]
Strains | Description |
---|---|
Guy11 | Wild type |
MoDHX35-6 | Null mutant |
MoDHX35-7 | Null mutant |
MoDHX35-8 | Null mutant |
MoDHX35-9 | Null mutant |
MoDHX35-5 | Random-inserted-transformant |
MoDHX35-9-10 | Complementary transformant |
MoDHX35-9-16 | Complementary transformant |
Primer Name | Primer Sequence |
---|---|
MoDHX35-CDS-F1 | CGGAATTCTTTTACCTGGTAAAAGTVGGGCGC |
MoDHX35-CDS-R1 | TCCCCCGGGATGGCCGACTTTGATCTGGGTGCA |
MoDHX35-Com-F1 | GCTCTAGAAGCTCAAGCAGACAGACCTAGTTG |
MoDHX35-Com-R1 | TCCCCCGGGGACGATAATGTCAATCTCCGAGGA |
MoDHX35-Up-F1 | GATGGRGCGCCGGATGTGATGAC |
MoDHX35-Up-R1 | GTATTGATTATTTGGGAGGCTTCT |
MoDHX35-Down-F1 | CGGGATCCAAGTACCCTGCGGAAACATC |
MoDHX35-Down-R1 | AAGTTTCTCTCCTCCAAAAAGCTT |
MoDHX35-Genecheck-F1 | CAGTGACAGTTGTCGTTGGA |
MoDHX35-Genecheck-R1 | GTGCTGGATTCTAGTTCTAG |
HPH-Check-F1 | TGGAGGTCAACACATCAATGCTATT |
HPH-Check-R1 | CTACTCTATTCCTTTGCCCTCGGAC |
Sequence-Up | ACTCGCCGATAGTGGAAACC |
MoDHX35-Upcheck-F1 | CGGTCTGTATTTGGCATACG |
Sequence-Down | CCAGTTGCCTAAATGAACCA |
MoDHX35-Downcheck-R1 | TCCTCGTTGTGCAGAGTCTT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ying, S.; Zhang, Z.; Zhang, Y.; Hao, Z.; Chai, R.; Qiu, H.; Wang, Y.; Zhu, X.; Wang, J.; Sun, G.; et al. MoDHX35, a DEAH-Box Protein, Is Required for Appressoria Formation and Full Virulence of the Rice Blast Fungus, Magnaporthe oryzae. Int. J. Mol. Sci. 2022, 23, 9015. https://doi.org/10.3390/ijms23169015
Ying S, Zhang Z, Zhang Y, Hao Z, Chai R, Qiu H, Wang Y, Zhu X, Wang J, Sun G, et al. MoDHX35, a DEAH-Box Protein, Is Required for Appressoria Formation and Full Virulence of the Rice Blast Fungus, Magnaporthe oryzae. International Journal of Molecular Sciences. 2022; 23(16):9015. https://doi.org/10.3390/ijms23169015
Chicago/Turabian StyleYing, Shumin, Zhen Zhang, Yanan Zhang, Zhongna Hao, Rongyao Chai, Haiping Qiu, Yanli Wang, Xueming Zhu, Jiaoyu Wang, Guochang Sun, and et al. 2022. "MoDHX35, a DEAH-Box Protein, Is Required for Appressoria Formation and Full Virulence of the Rice Blast Fungus, Magnaporthe oryzae" International Journal of Molecular Sciences 23, no. 16: 9015. https://doi.org/10.3390/ijms23169015
APA StyleYing, S., Zhang, Z., Zhang, Y., Hao, Z., Chai, R., Qiu, H., Wang, Y., Zhu, X., Wang, J., Sun, G., & Lin, F. (2022). MoDHX35, a DEAH-Box Protein, Is Required for Appressoria Formation and Full Virulence of the Rice Blast Fungus, Magnaporthe oryzae. International Journal of Molecular Sciences, 23(16), 9015. https://doi.org/10.3390/ijms23169015