Differentiated PDGFRα-Positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase
Abstract
1. Introduction
2. Results
2.1. Differentiation of iMSCs into PDGFRα-Positive Cells
2.2. Differential Gene Expression of Extracellular Matrix Proteins in Fibroblasts, iMSCs and PDGFRα-Positive Cells
2.3. Gene and Protein Expression of Stem Cell Differentiation Markers in Fibroblasts, iMSCs, and PDGFRα-Positive Cells
2.4. Assessment of Gastrointestinal Surface Markers in Fibroblasts, iMSCs, and PDGFRα-Positive Cells
2.5. Effects of Nitric Oxide on the Survival Rate of PDGFRα-Positive Cells
2.6. Effects of Nitric Oxide Inhibition on the Survival Rate of PDGFRα-Positive Cells
2.7. Effects of Glucose on Gene Expression of Neuronal Nitric Oxide Synthase in PDGFRα-Positive Cells
3. Discussion
4. Materials and Methods
4.1. Cell Culture and Fibroblastic Differentiation
4.2. Gene Expression
4.3. Flow Cytometry Analysis
4.4. Cell Viability
4.5. Nitrite Measurement Assay for Functional Analysis
4.6. Protein Expression and Analysis
4.7. Scanning Electron Microscopy
4.8. Immunostaining and Confocal Microscopy
4.9. Statistical Analysis
4.10. Limitations
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
AGG | Aggrecan |
ALP | Alkaline Phosphatase |
COL I | Collagen type I. |
CTGF | Connective Tissue Growth Factor |
DEC | Decorin. |
DM | Diabetes Mellitus |
ECM | Extracellular Matrix |
EDTA | Ethylenediaminetetraacetic acid |
ELA | Elastin. |
PDGFRα-positive cells | Platelet-derived growth factor receptor-α-positive cells |
FSP-1 | Fibroblast Specific Protein-1 |
HAS3 | Hyaluronic Acid Synthase 3 |
iMSCs | Telomerase transformed mesenchymal stromal cells |
LAA | L-ascorbic acids |
LNNA | L-NG-Nitro-L-Arginine |
iMSCs | telomerase transformed mesenchymal stromal cells |
NO | Nitric Oxide |
nNOS | Neuronal Nitric Oxide Synthase |
PDGFRα | Platelet-Derived Growth Factor Receptor alpha |
SCD | Stem Cell Differentiation |
SK3 | Small conductance calcium-activated potassium channel |
SNAP | S-nitroso-N-Acetylpenicillamine |
TIMP1 | Tissue Inhibitor of Metalloproteinases 1 |
References
- Camilleri, M. Diabetic Gastroparesis. N. Engl. J. Med. 2007, 356, 820–829. [Google Scholar] [CrossRef] [PubMed]
- Parkman, H.P.; Fass, R.; Foxx-Orenstein, A.E. Treatment of Patients with Diabetic Gastroparesis. Gastroenterol. Hepatol. 2010, 6, 1–16. [Google Scholar]
- Homko, C.; Siraj, E.S.; Parkman, H.P. The impact of gastroparesis on diabetes control: Patient perceptions. J. Diabetes Complicat. 2016, 30, 826–829. [Google Scholar] [CrossRef]
- Talley, N.J.; Young, L.; Bytzer, P.; Bytzer, P.; Hammer, J.; Leemon, M.; Jones, M.; Horowitz, M. Impact of chronic gastrointestinal symptoms in diabetes mellitus on health-related quality of life. Am. J. Gastroenterol. 2001, 96, 71–76. [Google Scholar] [CrossRef]
- Mussa, B.M.; Sood, S.; Verberne, A.J. Implication of neurohormonal-coupled mechanisms of gastric emptying and pancre-atic secretory function in diabetic gastroparesis. World J. Gastroenterol. 2018, 24, 3821–3833. [Google Scholar] [CrossRef] [PubMed]
- Sanders, K.M. A case for interstitial cells of Cajal as pacemakers and mediators of neurotransmission in the gastrointestinal tract. Gastroenterology 1996, 111, 492–515. [Google Scholar] [CrossRef] [PubMed]
- Vittal, H.; Farrugia, G.; Gomez, G.; Pasricha, P.J. Mechanisms of Disease: The pathological basis of gastroparesis—A review of experimental and clinical studies. Nat. Clin. Pr. Gastroenterol. Hepatol. 2007, 4, 336–346. [Google Scholar] [CrossRef]
- Sanders, K.M.; Koh, S.D.; Ward, S.M. Interstitial Cells of Cajal as Pacemakers in the Gastrointestinal Tract. Annu. Rev. Physiol. 2006, 68, 307–343. [Google Scholar] [CrossRef]
- Vannucchi, M.G. The Telocytes: Ten Years after Their Introduction in the Scientific Literature. An Update on Their Morphology, Distribution, and Potential Roles in the Gut. Int. J. Mol. Sci. 2020, 21, 4478. [Google Scholar] [CrossRef] [PubMed]
- Horiguchi, K.; Komuro, T. Ultrastructural observations of fibroblast-like cells forming gap junctions in the W/W(nu) mouse small intestine. J. Auton. Nerv. Syst. 2000, 80, 142–147. [Google Scholar] [CrossRef]
- Iino, S.; Horiguchi, K.; Horiguchi, S.; Nojyo, Y. c-Kit-negative PDGFRα-positive express platelet-derived growth factor receptor α in the murine gastrointestinal musculature. Histochem. Cell Biol. 2009, 131, 691–702. [Google Scholar] [CrossRef] [PubMed]
- Iino, S.; Nojyo, Y. Immunohistochemical demonstration of c-Kit-negative PDGFRα-positive in murine gastrointestinal musculature. Arch Histol. Cytol. 2009, 72, 107–115. [Google Scholar] [CrossRef]
- Kurahashi, M.; Zheng, H.; Dwyer, L.; Ward, S.M.; Koh, S.D.; Sanders, K.M. A functional role for the ‘fibroblast-like cells’ in gastrointestinal smooth muscles. J. Physiol. 2011, 589, 697–710. [Google Scholar] [CrossRef] [PubMed]
- Grover, M.; Bernard, C.E.; Pasricha, P.J.; Parkman, H.P.; Abell, T.L.; Nguyen, L.A.; Snape, W.; Shen, K.R.; Sarr, M.; Swain, J.; et al. Platelet-derived growth factor receptor α (PDGFRα)-expressing “fibro-blast-like cells” in diabetic and idiopathic gastroparesis of humans. J. Neurogastroenterol. Motil. 2012, 2, 844–852. [Google Scholar] [CrossRef] [PubMed]
- Gevaert, T.; Vanstreels, E.; Daelemans, D.; Franken, J.; Van Der Aa, F.; Roskams, T.; De Ridder, D. Identification of Different Phenotypes of Interstitial Cells in the Upper and Deep Lamina Propria of the Human Bladder Dome. J. Urol. 2014, 192, 1555–1563. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.; Huang, X.; Lu, H.L.; Liu, S.-H.; Zang, J.-Y.; Li, Y.-J.; Chen, J.; Xu, W.-X. Different distributions of interstitial cells of Cajal and platelet-derived growth factor receptor-α positive cells in colonic smooth muscle cell/interstitial cell of Cajal/platelet-derived growth factor receptor-α positive cell syncytium in mice. World J. Gastroenterol. 2018, 24, 4989–5004. [Google Scholar] [CrossRef]
- Kurahashi, M.; Nakano, Y.; Hennig, G.W.; Ward, S.W.; Sanders, K.M. Platelet-derived growth factor receptor α-positive cells in the tunica mus-cularis of human colon. J. Cell Mol. Med. 2012, 16, 1397–1404. [Google Scholar] [CrossRef] [PubMed]
- Blair, P.J.; Rhee, P.-L.; Sanders, K.M.; Ward, A.S.M. The Significance of Interstitial Cells in Neurogastroenterology. J. Neurogastroenterol. Motil. 2014, 20, 294–317. [Google Scholar] [CrossRef] [PubMed]
- Groneberg, D.; Voussen, B.; Friebe, A. Integrative Control of Gastrointestinal Motility by Nitric Oxide. Curr. Med. Chem. 2016, 23, 2715–2735. [Google Scholar] [CrossRef] [PubMed]
- Groneberg, D.; König, P.; Koesling, D.; Friebe, A. Nitric Oxide–Sensitive Guanylyl Cyclase Is Dispensable for Nitrergic Signaling and Gut Motility in Mouse Intestinal Smooth Muscle. Gastroenterology 2011, 140, 1608–1617. [Google Scholar] [CrossRef]
- Mussa, B.M.; Sartor, D.M.; Rantzau, C.; Verberne, A.J. Effects of nitric oxide synthase blockade on dorsal vagal stimulation-induced pancreatic insulin secretion. Brain Res. 2011, 1394, 62–70. [Google Scholar] [CrossRef]
- Watkins, C.C.; Sawa, A.; Jaffrey, S.; Blackshaw, S.; Barrow, R.K.; Snyder, S.H.; Ferris, C.D. Insulin restores neuronal nitric oxide synthase expression and function that is lost in diabetic gastropathy. J. Clin. Investig. 2000, 106, 373–384. [Google Scholar] [CrossRef]
- Choi, K.M.; Gibbons, S.J.; Roeder, J.L.; Lurken, M.S.; Zhu, J.; Wouters, M.M.; Miller, S.M.; Szurszewski, J.H.; Farrugia, G. Regulation of interstitial cells of Cajal in the mouse gastric body by neuronal nitric oxide. Neurogastroenterol. Motil. 2007, 19, 585–595. [Google Scholar] [CrossRef] [PubMed]
- Choi, K.M.; Gibbons, S.J.; Nguyen, T.V.; Stoltz, G.J.; Lurken, M.S.; Ordog, T.; Szurszewski, J.H.; Farrugia, G. Heme Oxygenase-1 Protects Interstitial Cells of Cajal From Oxidative Stress and Reverses Diabetic Gastroparesis. Gastroenterology 2008, 135, 2055–2064.e2. [Google Scholar] [CrossRef]
- Tong, Z.; Sant, S.; Khademhosseini, A.; Jia, X. Controlling the Fibroblastic Differentiation of Mesenchymal Stem Cells Via the Combination of Fibrous Scaffolds and Connective Tissue Growth Factor. Tissue Eng. Part A 2011, 17, 2773–2785. [Google Scholar] [CrossRef]
- Xu, C.; Jiang, J.; Sottile, V.; McWhir, J.; Lebkowski, J.; Carpenter, M.K. Immortalized Fibroblast-Like Cells Derived from Human Embryonic Stem Cells Support Undifferentiated Cell Growth. Stem Cells 2004, 22, 972–980. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Zhang, W.; He, G.; Sha, H.; Quan, Z. Method for in vitro differentiation of bone marrow mesenchymal stem cells into endothe-lial progenitor cells and vascular endothelial cells. Mol. Med. Rep. 2016, 14, 5551–5555. [Google Scholar] [CrossRef] [PubMed]
- Ozen, A.; Sancak, I.G.; Tiryaki, M.; Ceylan, A.; Pinarli, F.A.; Delibasi, T. Mesenchymal Stem Cells (Mscs) in Scanning Electron Microscopy (SEM) World. Niche 2014, 2, 22–24. [Google Scholar] [CrossRef]
- Denu, R.A.; Nemcek, S.; Bloom, D.D.; Goodrich, A.D.; Kim, D.F.; Hematti, P. Fibroblasts and Mesenchymal Stromal/Stem Cells Are Phenotypically Indistinguishable. Acta Haematol. 2016, 136, 85–97. [Google Scholar] [CrossRef]
- Ichim, T.E.; O’Heeron, P.; Kesari, S. Fibroblasts as a practical alternative to mesenchymal stem cells. J. Transl. Med. 2018, 16, 1–9. [Google Scholar] [CrossRef]
- Yoon, D.; Sim, H.; Hwag, I.; Lee, J.-S.; Chun, W. Accelerated Wound Healing by Fibroblasts Differentiated from Human Embryonic Stem Cell-Derived Mesenchymal Stem Cells in a Pressure Ulcer Animal Model. Stem Cells Int. 2018, 2018, 4789568. [Google Scholar] [CrossRef] [PubMed]
- Heng, E.C.; Huang, Y.; Black, S.A.; Trackman, P.C. CCN2, connective tissue growth factor, stimulates collagen deposition by gingival fibroblasts via module 3 and alpha6- and beta1 integrins. J. Cell Biochem. 2006, 98, 409–420. [Google Scholar] [CrossRef] [PubMed]
- Tajima, S.; Izumi, T. Differential in vitro responses of elastin expression to basic fibroblast growth factor and transforming growth factor beta 1 in upper, middle and lower dermal fibroblasts. Arch. Dermatol. Res. 1996, 288, 753–756. [Google Scholar] [CrossRef]
- Droguett, R.; Cabello-Verrugio, C.; Riquelme, C.; Brandan, E. Extracellular proteoglycans modify TGF-β bio-availability attenuating its signaling during skeletal muscle differentiation. Matrix Biol. 2006, 25, 332–341. [Google Scholar] [CrossRef] [PubMed]
- Vial, C.; Gutiérrez, J.; Santander, C.; Cabrera, D.; Brandan, E. Decorin Interacts with Connective Tissue Growth Factor (CTGF)/CCN2 by LRR12 Inhibiting Its Biological Activity. J. Biol. Chem. 2011, 286, 24242–24252. [Google Scholar] [CrossRef]
- Rilla, K.; Pasonen-Seppänen, S.; Deen, A.J.; Koistinen, V.V.; Wojciechowski, S.; Oikari, S.; Kärnä, R.; Bart, G.; Törrönen, K.; Tammi, R.H.; et al. Hyaluronan production enhances shedding of plasma membrane-derived microvesicles. Exp. Cell Res. 2013, 319, 2006–2018. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Huang, H.; Li, J.; Huang, W.; Wang, H. Connective tissue growth factor increases matrix metalloproteinase-2 and suppresses tissue inhibitor of matrix metalloproteinase-2 production by cultured renal interstitial fibroblasts. Wound Repair Regen. 2007, 15, 817–824. [Google Scholar] [CrossRef]
- Yamamoto, K.; Kishida, T.; Sato, Y.; Nishioka, K.; Ejima, A.; Fujiwara, H.; Kubo, T.; Yamamoto, T.; Kanamura, N.; Mazda, O. Direct conversion of human fibroblasts into functional osteoblasts by defined factors. Proc. Natl. Acad. Sci. USA 2015, 112, 6152–6157. [Google Scholar] [CrossRef] [PubMed]
- Qian, H.; Le Blanc, K.; Sigvardsson, M. Primary Mesenchymal Stem and Progenitor Cells from Bone Marrow Lack Expression of CD44 Protein. J. Biol. Chem. 2012, 287, 25795–25807. [Google Scholar] [CrossRef]
- Iwano, M.; Plieth, D.; Danoff, T.M.; Xue, C.; Okada, H.; Nelison, E.C. Evidence that fibroblasts derive from epithelium during tissue fibrosis. J. Clin. Investig. 2002, 110, 341–350. [Google Scholar] [CrossRef]
- Zhou, D.; Zhang, Z.; He, L.-M.; Du, J.; Zhang, F.; Sun, C.-K.; Zhou, Y.; Wang, X.-W.; Lin, G.; Song, K.-M.; et al. Conversion of fibroblasts to neural cells by p53 depletion. Cell Rep. 2014, 9, 2034–2042. [Google Scholar] [CrossRef]
- Houlihan, D.D.; Mabuchi, Y.; Morikawa, S.; Niibe, K.; Araki, D.; Suzuki, S.; Okano, H.; Matsuzaki, Y. Isolation of mouse mesenchymal stem cells on the basis of expression of Sca-1 and PDGFR-α. Nat. Protoc. 2012, 7, 2103–2111. [Google Scholar] [CrossRef]
- Lin, C.-S.; Ning, H.; Lin, G.; Lue, T.F. Is CD34 truly a negative marker for mesenchymal stromal cells? Cytotherapy 2012, 14, 1159–1163. [Google Scholar] [CrossRef]
- Scherberich, A.; Di Di Maggio, N.; McNagny, K.M. A familiar stranger: CD34 expression and putative functions in SVF cells of adipose tissue. World J. Stem Cells 2013, 5, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Liebau, S.; Tischendorf, M.; Ansorge, D.; Linta, L.; Stockmann, M.; Weidgang, C.; Iacovino, M.; Boeckers, T.; Von Wichert, G.; Kyba, M.; et al. An Inducible Expression System of the Calcium-Activated Potassium Channel 4 to Study the Differential Impact on Embryonic Stem Cells. Stem Cells Int. 2011, 2011, 1–12. [Google Scholar] [CrossRef]
- Pchelintseva, E.; Djamgoz, M.B.M.B.A. Mesenchymal stem cell differentiation: Control by calcium-activated potassium channels. J. Cell. Physiol. 2018, 233, 3755–3768. [Google Scholar] [CrossRef] [PubMed]
- Iino, S.; Horiguchi, K.; Nojyo, Y. Interstitial cells of Cajal are innervated by nitrergic nerves and express nitric ox-ide-sensitive guanylate cyclase in the guinea-pig gastrointestinal tract. Neuroscience 2008, 152, 437–448. [Google Scholar] [CrossRef] [PubMed]
- Kwesiga, M.P.; Cook, E.; Hannon, J.; Wayward, S.; Gwaltney, C.; Rao, S.; Frost, M.C. Investigative Study on Nitric Oxide Production in Human Dermal Fibroblast Cells under Normal and High Glucose Conditions. Med. Sci. 2018, 6, 99. [Google Scholar] [CrossRef] [PubMed]
- Mu, K.; Yu, S.; Kitts, D.D. The Role of Nitric Oxide in Regulating Intestinal Redox Status and Intestinal Epithelial Cell Functionality. Int. J. Mol. Sci. 2019, 20, 1755. [Google Scholar] [CrossRef]
- Murphy, M.P. Nitric oxide and cell death. Biochim. Biophys. Acta (BBA)-Bioenerg. 1999, 1411, 401–414. [Google Scholar] [CrossRef]
- Gross, S.S.; Wolin, M.S. Nitric oxide: Pathophysiological mechanisms. Ann. Rev. Physiol. 1995, 57, 737–769. [Google Scholar] [CrossRef]
- Kröncke, K.-D.; Fehsel, K.; Kolb-Bachofen, V. Nitric Oxide: Cytotoxicity versus Cytoprotection—How, Why, When, and Where? Nitric Oxide 1997, 1, 107–120. [Google Scholar] [CrossRef]
- Iadecola, C. Bright and dark sides of nitric oxide in ischemic brain injury. Trends Neurosci. 1997, 20, 132–139. [Google Scholar] [CrossRef]
- Stark, M.E.; Szurszewski, J.H. Role of nitric oxide in gastrointestinal and hepatic function and disease. Gastroenterology 1992, 103, 1928–1949. [Google Scholar] [CrossRef]
- Trento, C.; Marigo, I.; Pievani, A.; Galleu, A.; Dolcetti, L.; Wang, C.-Y.; Serafini, M.; Bronte, V.; Dazzi, F. Bone marrow mesenchymal stromal cells induce nitric oxide synthase-dependent differentiation of CD11b+ cells that expedite hematopoietic recovery. Haematologica 2017, 102, 818–825. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Chen, L.; Zhang, Y.; Tao, L.; Yang, Z.; Wang, L. Mesenchymal Stem Cells with eNOS Over-Expression Enhance Cardiac Repair in Rats with Myocardial Infarction. Cardiovasc. Drugs Ther. 2016, 31, 9–18. [Google Scholar] [CrossRef] [PubMed]
- Pacher, P.; Beckman, J.S.; Liaudet, L. Nitric Oxide and Peroxynitrite in Health and Disease. Physiol. Rev. 2007, 87, 315–424. [Google Scholar] [CrossRef]
- Adela, R.; Nethi, S.K.; Bagul, P.K.; Barui, A.K.; Mattapally, S.; Kuncha, M.; Patra, C.R.; Reddy, P.N.C.; Banerjee, S.K. Hyperglycaemia Enhances Nitric Oxide Production in Diabetes: A Study from South Indian Patients. PLoS ONE 2015, 10, e0125270. [Google Scholar] [CrossRef]
- Hameed, M.; Panicker, S.; Abdallah, S.H.; Khan, A.A.; Han, C.; Chehimi, M.M.; Mohamed, A.A. Protein-Coated Aryl Modified Gold Nanoparticles for Cellular Uptake Study by Osteosarcoma Cancer Cells. Langmuir 2020, 36, 11765–11775. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′–3′) | Reverse Primer (5′–3′) | GenBank No. | Product Size (bp) |
---|---|---|---|---|
COL I | AACAAATAAGCCATCACGCCT | TGAAACAGACTGGGCCAATGTC | NM_000089 | 101 |
ELA | AAAGCAGCAGCAAAGTTCGG | ACCTGGGAC AACTGGAATCC | NM_001081755 | 274 |
DEC | GATGCAGCTAGC CTGAAAGG | TCACACCCGAATAAGAAGCC | NM_133503 | 274 |
TIMP1 | TTTCTTGGTTCCCCAGAATG | CAGAGCTGCAGAGCAACAAG | NG_012533 | 99 |
HAS3 | TGTGCAGTGTATTAGTGGGCCCTT | TTGGAGCGCGTATACTTAGTT | NM_005329 | 177 |
CD44 | TGCCGCTTTGCAGGTGTAT | GGCCTCCGTCCGAGAGA | NM_001001392 | 70 |
FSP-1 | AGCTTCTTGGGGAAAAGGAC | CCCCAACCACAT CAGAGG | NM_019554 | 200 |
ALP | TGGAGCTTCAGAAGCTCAACACCA | ATCTCGTTGTCTGAGTACCAGTCC | NM_000478 | 454 |
AGG | TCGAGGACAGCGAGGCC | TCGAGGGTGTAGCGTGTAGAGA | NM_013227 | 85 |
p53 | TGCGTGTGGAGTATTTGGATG | GTGTGATGATGGTGAGGATGG | NM_000546 | 168 |
GAPDH | GAAATCCCATCACCATCTTCCAGG | GAGCCCCAGCCTTCTCCATG | NM_002046 | 120 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mussa, B.M.; Khan, A.A.; Srivastava, A.; Abdallah, S.H. Differentiated PDGFRα-Positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase. Int. J. Mol. Sci. 2021, 22, 3514. https://doi.org/10.3390/ijms22073514
Mussa BM, Khan AA, Srivastava A, Abdallah SH. Differentiated PDGFRα-Positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase. International Journal of Molecular Sciences. 2021; 22(7):3514. https://doi.org/10.3390/ijms22073514
Chicago/Turabian StyleMussa, Bashair M., Amir Ali Khan, Ankita Srivastava, and Sallam Hasan Abdallah. 2021. "Differentiated PDGFRα-Positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase" International Journal of Molecular Sciences 22, no. 7: 3514. https://doi.org/10.3390/ijms22073514
APA StyleMussa, B. M., Khan, A. A., Srivastava, A., & Abdallah, S. H. (2021). Differentiated PDGFRα-Positive Cells: A Novel In-Vitro Model for Functional Studies of Neuronal Nitric Oxide Synthase. International Journal of Molecular Sciences, 22(7), 3514. https://doi.org/10.3390/ijms22073514