Crosstalk of Diabetic Conditions with Static Versus Dynamic Flow Environment—Impact on Aortic Valve Remodeling
Abstract
1. Introduction
2. Results
2.1. Differentiation of VIC
2.2. Fibrosis of AV Leaflet Tissue
2.3. ECM Remodeling
2.4. Activation of Insulin Pathways
3. Discussion
3.1. Impact of Diabetic Conditions on Degeneration of Native AV Leaflets
3.2. Insulin-Dependent Signaling in AV Leaflet Tissue
3.3. Limitations of the Study
4. Materials and Methods
4.1. Ovine AV Tissue
4.2. In Vitro Cultivation under Static Conditions
4.3. Ex Vivo Cultivation in a Bioreactor System under Dynamic Flow Conditions
4.4. Tissue Density
4.5. Histochemical and Immunohistochemical Staining
4.6. RNA Isolation and Determination of RNA Integrity
4.7. Gene Expression Analysis
4.8. Protein Isolation and Quantification
4.9. Western Blot Analysis
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lerman, D.; Prasad, S.; Alotti, N. Calcific Aortic Valve Disease: Molecular Mechanisms And Therapeutic Approaches. Eur. Cardiol. Rev. 2015, 10, 108–112. [Google Scholar] [CrossRef] [Scilit]
- Liu, A.C.; Joag, V.R.; Gotlieb, A.I. The Emerging Role of Valve Interstitial Cell Phenotypes in Regulating Heart Valve Pathobiology. Am. J. Pathol. 2007, 171, 1407–1418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kamath, A.R.; Pai, R.G. Risk factors for progression of calcific aortic stenosis and potential therapeutic targets. Int. J. Angiol. 2008, 17, 63–70. [Google Scholar] [CrossRef] [Scilit]
- Katz, R.; Wong, N.D.; Kronmal, R.; Takasu, J.; Shavelle, D.M.; Probstfield, J.L.; Bertoni, A.; Budoff, M.J.; O’Brien, K. Features of the Metabolic Syndrome and Diabetes Mellitus as Predictors of Aortic Valve Calcification in the Multi-Ethnic Study of Atherosclerosis. Circulation 2006, 113, 2113–2119. [Google Scholar] [CrossRef] [Scilit]
- Kamalesh, M.; Ng, C.; El Masry, H.; Eckert, G.; Sawada, S. Does diabetes accelerate progression of calcific aortic stenosis? Eur. J. Echocardiogr. 2009, 10, 723–725. [Google Scholar] [CrossRef] [Scilit]
- Ljungberg, J.; Johansson, B.; Engström, K.G.; Albertsson, E.; Holmer, P.; Norberg, M.; Bergdahl, I.A.; Söderberg, S. Traditional Cardiovascular Risk Factors and Their Relation to Future Surgery for Valvular Heart Disease or Ascending Aortic Disease: A Case—Referent Study. J. Am. Hear. Assoc. 2017, 6, e005133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yan, A.T.; Koh, M.; Chan, K.K.; Guo, H.; Alter, D.A.; Austin, P.C.; Tu, J.V.; Wijeysundera, H.C.; Ko, D.T. Association Between Cardiovascular Risk Factors and Aortic Stenosis. J. Am. Coll. Cardiol. 2017, 69, 1523–1532. [Google Scholar] [CrossRef] [Scilit]
- Larsson, S.C.; Wallin, A.; Håkansson, N.; Stackelberg, O.; Bäck, M.; Wolk, A. Type 1 and type 2 diabetes mellitus and incidence of seven cardiovascular diseases. Int. J. Cardiol. 2018, 262, 66–70. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- World Health Organization. Global Report on Diabetes; WHO: Geneva, Switzerland, 2016. [Google Scholar]
- Zhou, B.; Lu, Y.; Hajifathalian, K.; Bentham, J.; Di Cesare, M.; Danaei, G.; Bixby, H.; Cowan, M.; Ali, M.; Taddei, C.; et al. Worldwide trends in diabetes since 1980: A pooled analysis of 751 population-based studies with 4·4 million participants. Lancet 2016, 387, 1513–1530. [Google Scholar] [CrossRef] [Scilit]
- International Diabetes Federation. IDF Diabetes Atlas, 8th ed.; International Diabetes Federation: Brussels, Belgium, 2017. [Google Scholar]
- Boucher, J.; Kleinridders, A.; Kahn, C.R. Insulin Receptor Signaling in Normal and Insulin-Resistant States. Cold Spring Harb. Perspect. Biol. 2014, 6, a009191. [Google Scholar] [CrossRef] [Scilit]
- Godsland, I.F. Insulin resistance and hyperinsulinaemia in the development and progression of cancer. Clin. Sci. 2009, 118, 315–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gowd, V.; Gurukar, A.; Chilkunda, N.D. Glycosaminoglycan remodeling during diabetes and the role of dietary factors in their modulation. World J. Diabetes 2016, 7, 67–73. [Google Scholar] [CrossRef] [Scilit]
- Hiebert, L.M. Proteoglycans and Diabetes. Curr. Pharm. Des. 2017, 23, 1500–1509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Selig, J.I.; Ouwens, D.M.; Raschke, S.; Thoresen, G.H.; Fischer, J.W.; Lichtenberg, A.; Akhyari, P.; Barth, M. Impact of hyperinsulinemia and hyperglycemia on valvular interstitial cells—A link between aortic heart valve degeneration and type 2 diabetes. Biochim. Biophys. Acta (BBA) Mol. Basis Dis. 2019, 1865, 2526–2537. [Google Scholar] [CrossRef] [Scilit]
- Barth, M.; Selig, J.I.; Klose, S.; Schomakers, A.; Kiene, L.S.; Raschke, S.; Boeken, U.; Akhyari, P.; Fischer, J.W.; Lichtenberg, A. Degenerative aortic valve disease and diabetes: Implications for a link between proteoglycans and diabetic disorders in the aortic valve. Diabetes Vasc. Dis. Res. 2018, 16, 254–269. [Google Scholar] [CrossRef] [Scilit]
- Song, R.; Zeng, Q.; Ao, L.; Jessica, A.Y.; Cleveland, J.C.; Zhao, K.-s.; Fullerton, D.A.; Meng, X. Biglycan induces the expres-sion of osteogenic factors in human aortic valve interstitial cells via Toll-like receptor-Atertio. Thromb. Vasc. Biol. 2012, 32, 2711–2720. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, R.; Fullerton, D.A.; Ao, L.; Zheng, D.; Zhao, K.-S.; Meng, X. BMP-2 and TGF-β1 mediate biglycan-induced pro-osteogenic reprogramming in aortic valve interstitial cells. J. Mol. Med. 2015, 93, 403–412. [Google Scholar] [CrossRef] [Scilit]
- Lehmann, S.; Walther, T.; Kempfert, J.; Rastan, A.; Garbade, J.; Dhein, S.; Mohr, F.W. Mechanical Strain and the Aortic Valve: Influence on Fibroblasts, Extracellular Matrix, and Potential Stenosis. Ann. Thorac. Surg. 2009, 88, 1476–1483. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Rajamannan, N.M.; Sucosky, P. Design and Validation of a Novel Bioreactor to Subject Aortic Valve Leaflets to Side-Specific Shear Stress. Ann. Biomed. Eng. 2011, 39, 2174–2185. [Google Scholar] [CrossRef] [Scilit]
- Sun, L.; Rajamannan, N.M.; Sucosky, P. Defining the Role of Fluid Shear Stress in the Expression of Early Signaling Markers for Calcific Aortic Valve Disease. PLoS ONE 2013, 8, e84433. [Google Scholar] [CrossRef] [Scilit]
- Law, B.; Fowlkes, V.; Goldsmith, J.G.; Carver, W.; Goldsmith, E.C. Diabetes-Induced Alterations in the Extracellular Matrix and Their Impact on Myocardial Function. Microsc. Microanal. 2012, 18, 22–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ciortan, L.; Macarie, R.D.; Cecoltan, S.; Vadana, M.; Tucureanu, M.M.; Mihaila, A.C.; Droc, I.; Butoi, E.; Manduteanu, I. Chronic High Glucose Concentration Induces Inflammatory and Remodeling Changes in Valvular Endothelial Cells and Valvular Interstitial Cells in a Gelatin Methacrylate 3D Model of the Human Aortic Valve. Polymers 2020, 12, 2786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gorski, D.J.; Petz, A.; Reichert, C.; Twarock, S.; Grandoch, M.; Fischer, J.W. Cardiac fibroblast activation and hyaluronan synthesis in response to hyperglycemia and diet-induced insulin resistance. Sci. Rep. 2019, 9, 1827. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Balachandran, K.; Konduri, S.; Sucosky, P.; Jo, H.; Yoganathan, A.P. An Ex Vivo Study of the Biological Properties of Porcine Aortic Valves in Response to Circumferential Cyclic Stretch. Ann. Biomed. Eng. 2006, 34, 1655–1665. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thayer, P.; Balachandran, K.; Rathan, S.; Yap, C.H.; Arjunon, S.; Jo, H.; Yoganathan, A.P. The Effects of Combined Cyclic Stretch and Pressure on the Aortic Valve Interstitial Cell Phenotype. Ann. Biomed. Eng. 2011, 39, 1654–1667. [Google Scholar] [CrossRef] [Scilit]
- Niazy, N.; Barth, M.; Selig, J.; Feichtner, S.; Shakiba, B.; Candan, A.; Albert, A.; Preuß, K.; Lichtenberg, A.; Akhyari, P. Degeneration of Aortic Valves in a Bioreactor System with Pulsatile Flow. Biomedicines 2021, 9, 462. [Google Scholar] [CrossRef] [Scilit]
- Liu, A.C.; Gotlieb, A.I. Transforming Growth Factor-β Regulates in Vitro Heart Valve Repair by Activated Valve Interstitial Cells. Am. J. Pathol. 2008, 173, 1275–1285. [Google Scholar] [CrossRef] [Scilit]
- Walker, G.A.; Masters, K.S.; Shah, D.N.; Anseth, K.S.; Leinwand, L.A. Valvular Myofibroblast Activation by Transforming Growth Factor-β. Circ. Res. 2004, 95, 253–260. [Google Scholar] [CrossRef] [Scilit]
- Vadana, M.; Cecoltan, S.; Ciortan, L.; Macarie, R.D.; Tucureanu, M.M.; Mihaila, A.C.; Droc, I.; Butoi, E.; Manduteanu, I. Molecular mechanisms involved in high glucose-induced valve calcification in a 3D valve model with human valvular cells. J. Cell. Mol. Med. 2020, 24, 6350–6361. [Google Scholar] [CrossRef] [Scilit]
- Hjortnaes, J.; Shapero, K.; Goettsch, C.; Hutcheson, J.D.; Keegan, J.; Kluin, J.; Mayer, J.E.; Bischoff, J.; Aikawa, E. Valvular interstitial cells suppress calcification of valvular endothelial cells. Atherosclerosis 2015, 242, 251–260. [Google Scholar] [CrossRef] [Scilit]
- Rabkin, E.; Aikawa, E.; Stone, J.R.; Fukumoto, Y.; Libby, P.; Schoen, F.J. Activated Interstitial Myofibroblasts Express Catabolic Enzymes and Mediate Matrix Remodeling in Myxomatous Heart Valves. Circulation 2001, 104, 2525–2532. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pasta, S.; Agnese, V.; Gallo, A.; Cosentino, F.; Di Giuseppe, M.; Gentile, G.; Raffa, G.M.; Maalouf, J.F.; Michelena, H.I.; Bellavia, D.; et al. Shear Stress and Aortic Strain Associations with Biomarkers of Ascending Thoracic Aortic Aneurysm. Ann. Thorac. Surg. 2020, 110, 1595–1604. [Google Scholar] [CrossRef] [Scilit]
- Scuruchi, M.; Potì, F.; Rodríguez-Carrio, J.; Campo, G.M.; Mandraffino, G. Biglycan and atherosclerosis: Lessons from high cardiovascular risk conditions. Biochim. Biophys. Acta (BBA) Mol. Cell Biol. Lipids 2020, 1865, 158545. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Henao-Murillo, L.; Pastrama, M.-I.; Ito, K.; Van Donkelaar, C.C. The Relationship Between Proteoglycan Loss, Overloading-Induced Collagen Damage, and Cyclic Loading in Articular Cartilage. Cartilage 2019. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abel, E.D. Glucose transport in the heart. Front. Biosci. 2004, 9, 201–215. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Su, D.; Zhou, Y.; Hu, S.; Guan, L.; Shi, C.; Wang, Q.; Chen, Y.; Lu, C.; Li, Q.; Ma, X. Role of GAB1/PI3K/AKT signaling high glucose-induced cardiomyocyte apoptosis. Biomed. Pharmacother. 2017, 93, 1197–1204. [Google Scholar] [CrossRef] [Scilit]
- Tanaka, R.; Umemura, M.; Narikawa, M.; Fujita, T.; Yokoyama, U.; Ishigami, T.; Kimura, K.; Tamura, K.; Ishikawa, Y. Hydrostatic pressure suppresses fibrotic changes via Akt/GSK-3 signaling in human cardiac fibroblasts. Physiol. Rep. 2018, 6, e13687. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, B.-S.; Guo, W.-J.; Hong, L.; Liu, Y.-D.; Liu, C.; Hong, S.-S.; Wu, D.-B.; Min, J. Role of mechanical strain-activated PI3K/Akt signaling pathway in pelvic organ prolapse. Mol. Med. Rep. 2016, 14, 243–253. [Google Scholar] [CrossRef] [Scilit]
- Zhang, K.; Guo, X.; Yan, H.; Wu, Y.; Pan, Q.; Shen, J.Z.; Li, X.; Chen, Y.; Li, L.; Qi, Y.; et al. Phosphorylation of Forkhead Protein FoxO1 at S253 Regulates Glucose Homeostasis in Mice. Endocrinology 2019, 160, 1333–1347. [Google Scholar] [CrossRef] [Scilit]
- Wu, Y.; Pan, Q.; Yan, H.; Zhang, K.; Guo, X.; Xu, Z.; Yang, W.; Qi, Y.; Guo, C.A.; Hornsby, C.; et al. Novel Mechanism of Foxo1 Phosphorylation in Glucagon Signaling in Control of Glucose Homeostasis. Diabetes 2018, 67, 2167–2182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mutlak, M.; Kehat, I. Extracellular signal-regulated kinases 1/2 as regulators of cardiac hypertrophy. Front. Pharmacol. 2015, 6, 149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, Z.; Sun, J.; Tong, Q.; Lin, Q.; Qian, L.; Park, Y.; Zheng, Y. The Role of ERK1/2 in the Development of Diabetic Cardiomyopathy. Int. J. Mol. Sci. 2016, 17, 2001. [Google Scholar] [CrossRef] [Scilit]
- Monzack, E.L.; Masters, K.S. Can valvular interstitial cells become true osteoblasts? A side-by-side comparison. J. Hear. Valve Dis. 2011, 20, 449–463. [Google Scholar]
- Cloyd, K.L.; El-Hamamsy, I.; Boonrungsiman, S.; Hedegaard, M.A.; Gentleman, E.; Sarathchandra, P.; Colazzo, F.; Gentleman, M.M.; Yacoub, M.H.; Chester, A.H.; et al. Characterization of Porcine Aortic Valvular Interstitial Cell ‘Calcified’ Nodules. PLoS ONE 2012, 7, e48154. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matheus, A.S.D.M.; Tannus, L.R.M.; Cobas, R.A.; Palma, C.C.S.; Negrato, C.A.; Gomes, M.D.B. Impact of Diabetes on Cardiovascular Disease: An Update. Int. J. Hypertens. 2013, 2013, 653789. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jenke, A.; Kistner, J.; Saradar, S.; Chekhoeva, A.; Yazdanyar, M.; Bergmann, A.K.; Rötepohl, M.V.; Lichtenberg, A.; Akhyari, P. Transforming growth factor-β1 promotes fibrosis but attenuates calcification of valvular tissue applied as a three-dimensional calcific aortic valve disease model. Am. J. Physiol. Circ. Physiol. 2020, 319, H1123–H1141. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weber, A.; Pfaff, M.; Schöttler, F.; Schmidt, V.; Lichtenberg, A.; Akhyari, P. Reproducible In Vitro Tissue Culture Model to Study Basic Mechanisms of Calcific Aortic Valve Disease: Comparative Analysis to Valvular Interstitials Cells. Biomedicines 2021, 9, 474. [Google Scholar] [CrossRef] [Scilit]
- Assmann, A.; Zwirnmann, K.; Heidelberg, F.; Schiffer, F.; Horstkötter, K.; Munakata, H.; Gremse, F.; Barth, M.; Lichtenberg, A.; Akhyari, P. The degeneration of biological cardiovascular prostheses under pro-calcific metabolic conditions in a small animal model. Biomedicines 2014, 35, 7416–7428. [Google Scholar] [CrossRef] [Scilit]
- Chomczynski, P.; Sacchi, N. Single-Step Method of RNA Isolation by Acid Guanidinium Thiocyanate-Phenol-Chloroform Extraction. Anal. Biochem. 1987, 162, 156–159. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]










| Gene | Forward Sequence (5′ → 3′) | Reverse Sequence (5′ → 3′) |
|---|---|---|
| ACTA2 | GATAGAGCACGGCATCATCA | GAAGGGTTGGATGCTCTTCA |
| BGN | TCTGCTCCGCTACTCCAAGT | TTGTTGTCCAAGTGCAGCTC |
| COL1A1 | AAGACATCCCACCAGTCACC | TAAGTTCGTCGCAGATCACG |
| DCN | CCAAAGTGCGAAAGTCTGTG | TTCAATGCCTGAGCTCTTCA |
| MMP2 | TGACAAGGACGGCAAGTATG | GTAAGATGTGCCCTGGAAGC |
| RPL13a | GATCCCACCACCCTATGACA | CTTCAGACGCACAACCTTGA |
| RPL29 | CCAAGTCCAAGAACCACACC | TATCGTTGTGATCGGGGTTT |
| SPP1 | GATGGCCGAGGTGATAGTGT | TCGTCTTCTTAGGTGCGTCA |
| TGFβ | GAGCCAGAGGCGGACTACTA | TCGGACGTGTTGAAGAACAT |
| TUBB | CCTACAACTGGACCGCATCT | AAAGGACCTGAGCGAACAGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Selig, J.I.; Boulgaropoulos, J.; Niazy, N.; Ouwens, D.M.; Preuß, K.; Horn, P.; Westenfeld, R.; Lichtenberg, A.; Akhyari, P.; Barth, M. Crosstalk of Diabetic Conditions with Static Versus Dynamic Flow Environment—Impact on Aortic Valve Remodeling. Int. J. Mol. Sci. 2021, 22, 6976. https://doi.org/10.3390/ijms22136976
Selig JI, Boulgaropoulos J, Niazy N, Ouwens DM, Preuß K, Horn P, Westenfeld R, Lichtenberg A, Akhyari P, Barth M. Crosstalk of Diabetic Conditions with Static Versus Dynamic Flow Environment—Impact on Aortic Valve Remodeling. International Journal of Molecular Sciences. 2021; 22(13):6976. https://doi.org/10.3390/ijms22136976
Chicago/Turabian StyleSelig, Jessica I., Joana Boulgaropoulos, Naima Niazy, D. Margriet Ouwens, Karlheinz Preuß, Patrick Horn, Ralf Westenfeld, Artur Lichtenberg, Payam Akhyari, and Mareike Barth. 2021. "Crosstalk of Diabetic Conditions with Static Versus Dynamic Flow Environment—Impact on Aortic Valve Remodeling" International Journal of Molecular Sciences 22, no. 13: 6976. https://doi.org/10.3390/ijms22136976
APA StyleSelig, J. I., Boulgaropoulos, J., Niazy, N., Ouwens, D. M., Preuß, K., Horn, P., Westenfeld, R., Lichtenberg, A., Akhyari, P., & Barth, M. (2021). Crosstalk of Diabetic Conditions with Static Versus Dynamic Flow Environment—Impact on Aortic Valve Remodeling. International Journal of Molecular Sciences, 22(13), 6976. https://doi.org/10.3390/ijms22136976

