Induction of Oxidative Stress and Mitochondrial Dysfunction by Juglone Affects the Development of Bovine Oocytes
Abstract
1. Introduction
2. Results
2.1. High Juglone Concentrations Negatively Affect Cumulus Expansion
2.2. Reduction of Oocyte Maturation following Exposure to Juglone
2.3. Juglone Administration during the IVM Reduces Embryonic Development
2.4. High Juglone Concentrations Induce ROS Accumulation in Oocytes
2.5. Juglone Affects the Distribution Pattern of Oocyte’s Mitochondria
2.6. Juglone Treatment Induces Apoptosis in Oocytes
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Oocyte Isolation and IVM
4.3. In Vitro Fertilization (IVF) and Development of Blastocysts
4.4. Estimation of Cumulus Cells Expansion and Oocyte Maturation
4.5. Measurement of ROS Levels in Oocytes
4.6. Assessment of Mitochondrial Distribution Pattern in Oocytes
4.7. RNA Extraction and RT–qPCR
4.8. Annexin V Staining
4.9. Immunofluorescence
4.10. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ahmad, T.; Suzuki, Y.J. Juglone in Oxidative Stress and Cell Signaling. Antioxidants 2019, 8, 91. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.L.; Yu, X.F.; Qu, S.C.; Qu, X.R.; Jiang, Y.F.; Sui da, Y. Juglone, from Juglans mandshruica Maxim, inhibits growth and induces apoptosis in human leukemia cell HL-60 through a reactive oxygen species-dependent mechanism. Food Chem. Toxicol. 2012, 50, 590–596. [Google Scholar] [CrossRef] [PubMed]
- Ji, Y.B.; Qu, Z.Y.; Zou, X. Juglone-induced apoptosis in human gastric cancer SGC-7901 cells via the mitochondrial pathway. Exp. Toxicol. Pathol. 2011, 63, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Delaviz, H.; Mohammadi, J.; Ghalamfarsa, G.; Mohammadi, B.; Farhadi, N. A Review Study on Phytochemistry and Pharmacology Applications of Juglans Regia Plant. Pharmacogn. Rev. 2017, 11, 145–152. [Google Scholar] [PubMed]
- Aithal, B.K.; Kumar, M.R.; Rao, B.N.; Udupa, N.; Rao, B.S. Juglone, a naphthoquinone from walnut, exerts cytotoxic and genotoxic effects against cultured melanoma tumor cells. Cell Biol. Int. 2009, 33, 1039–1049. [Google Scholar] [CrossRef]
- Jahanban-Esfahlan, A.; Ostadrahimi, A.; Tabibiazar, M.; Amarowicz, R. A Comprehensive Review on the Chemical Constituents and Functional Uses of Walnut (Juglans spp.) Husk. Int. J. Mol. Sci. 2019, 20, 3920. [Google Scholar] [CrossRef]
- Khalil, A.A.K.; Park, W.S.; Lee, J.; Kim, H.J.; Akter, K.M.; Goo, Y.M.; Bae, J.Y.; Chun, M.S.; Kim, J.H.; Ahn, M.J. A new anti-Helicobacter pylori juglone from Reynoutria japonica. Arch. Pharm. Res. 2019, 42, 505–511. [Google Scholar] [CrossRef]
- Islam, A.; Widhalm, J.R. Agricultural Uses of Juglone: Opportunities and Challenges. Agronomy 2020, 10, 1500. [Google Scholar] [CrossRef]
- Kim, N.H.; Kim, H.K.; Lee, J.H.; Jo, S.I.; Won, H.M.; Lee, G.S.; Lee, H.S.; Nam, K.W.; Kim, W.J.; Han, M.D. Juglone Suppresses LPS-induced Inflammatory Responses and NLRP3 Activation in Macrophages. Molecules 2020, 25, 3104. [Google Scholar] [CrossRef]
- Ferre, L.B.; Kjelland, M.E.; Strobech, L.B.; Hyttel, P.; Mermillod, P.; Ross, P.J. Review: Recent advances in bovine in vitro embryo production: Reproductive biotechnology history and methods. Animal 2020, 14, 991–1004. [Google Scholar] [CrossRef]
- Yu, Y.; Dumollard, R.; Rossbach, A.; Lai, F.A.; Swann, K. Redistribution of mitochondria leads to bursts of ATP production during spontaneous mouse oocyte maturation. J. Cell. Physiol. 2010, 224, 672–680. [Google Scholar] [CrossRef] [PubMed]
- Mesalam, A.; Khan, I.; Lee, K.L.; Song, S.H.; Chowdhury, M.M.R.; Uddin, Z.; Park, K.H.; Kong, I.K. 2-Methoxystypandrone improves in vitro-produced bovine embryo quality through inhibition of IKBKB. Theriogenology 2017, 99, 10–20. [Google Scholar] [CrossRef] [PubMed]
- Lonergan, P.; Monaghan, P.; Rizos, D.; Boland, M.P.; Gordon, I. Effect of follicle size on bovine oocyte quality and developmental competence following maturation, fertilization, and culture in vitro. Mol. Reprod. Dev. 1994, 37, 48–53. [Google Scholar] [CrossRef] [PubMed]
- Austin, E.J.; Mihm, M.; Ryan, M.P.; Williams, D.H.; Roche, J.F. Effect of duration of dominance of the ovulatory follicle on onset of estrus and fertility in heifers. J. Anim. Sci. 1999, 77, 2219–2226. [Google Scholar] [CrossRef] [PubMed]
- Schatten, H.; Sun, Q.Y.; Prather, R. The impact of mitochondrial function/dysfunction on IVF and new treatment possibilities for infertility. Reprod. Biol. Endocrinol. 2014, 12, 111. [Google Scholar] [CrossRef]
- Torner, H.; Brussow, K.P.; Alm, H.; Ratky, J.; Pohland, R.; Tuchscherer, A.; Kanitz, W. Mitochondrial aggregation patterns and activity in porcine oocytes and apoptosis in surrounding cumulus cells depends on the stage of pre-ovulatory maturation. Theriogenology 2004, 61, 1675–1689. [Google Scholar] [CrossRef]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef]
- Turker, F.S.; Dogan, A.; Ozan, G.; Kibar, K.; Erisir, M. Change in Free Radical and Antioxidant Enzyme Levels in the Patients Undergoing Open Heart Surgery with Cardiopulmonary Bypass. Oxid. Med. Cell. Longev. 2016, 2016, 1783728. [Google Scholar] [CrossRef]
- Agarwal, A.; Said, T.M.; Bedaiwy, M.A.; Banerjee, J.; Alvarez, J.G. Oxidative stress in an assisted reproductive techniques setting. Fertil. Steril. 2006, 86, 503–512. [Google Scholar] [CrossRef]
- Goto, Y.; Noda, Y.; Mori, T.; Nakano, M. Increased generation of reactive oxygen species in embryos cultured in vitro. Free Radic. Biol. Med. 1993, 15, 69–75. [Google Scholar] [CrossRef]
- Wang, F.; Tian, X.; Zhang, L.; He, C.; Ji, P.; Li, Y.; Tan, D.; Liu, G. Beneficial effect of resveratrol on bovine oocyte maturation and subsequent embryonic development after in vitro fertilization. Fertil. Steril. 2014, 101, 577–586. [Google Scholar] [CrossRef] [PubMed]
- Pang, Y.W.; Jiang, X.L.; Wang, Y.C.; Wang, Y.Y.; Hao, H.S.; Zhao, S.J.; Du, W.H.; Zhao, X.M.; Wang, L.; Zhu, H.B. Melatonin protects against paraquat-induced damage during in vitro maturation of bovine oocytes. J. Pineal Res. 2019, 66, e12532. [Google Scholar] [CrossRef]
- El Sheikh, M.; Mesalam, A.; Mesalam, A.A.; Idrees, M.; Lee, K.L.; Kong, I.K. Melatonin Abrogates the Anti-Developmental Effect of the AKT Inhibitor SH6 in Bovine Oocytes and Embryos. Int. J. Mol. Sci. 2019, 20, 2956. [Google Scholar] [CrossRef] [PubMed]
- Budani, M.C.; Tiboni, G.M. Effects of Supplementation with Natural Antioxidants on Oocytes and Preimplantation Embryos. Antioxidants 2020, 9, 612. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, W.; Sun, X.; Li, J.; Wu, W.; Liu, H. Vitamin C protects against defects induced by juglone during porcine oocyte maturation. J. Cell. Physiol. 2019, 234, 19574–19581. [Google Scholar] [CrossRef]
- Seshadri, P.; Rajaram, A.; Rajaram, R. Plumbagin and juglone induce caspase-3-dependent apoptosis involving the mitochondria through ROS generation in human peripheral blood lymphocytes. Free Radic. Biol. Med. 2011, 51, 2090–2107. [Google Scholar] [CrossRef]
- Jha, B.K.; Jung, H.J.; Seo, I.; Suh, S.I.; Suh, M.H.; Baek, W.K. Juglone induces cell death of Acanthamoeba through increased production of reactive oxygen species. Exp. Parasitol. 2015, 159, 100–106. [Google Scholar] [CrossRef]
- Paulsen, M.T.; Ljungman, M. The natural toxin juglone causes degradation of p53 and induces rapid H2AX phosphorylation and cell death in human fibroblasts. Toxicol. Appl. Pharmacol. 2005, 209, 1–9. [Google Scholar] [CrossRef]
- Varga, Z.; Bene, L.; Pieri, C.; Damjanovich, S.; Gaspar, R., Jr. The effect of juglone on the membrane potential and whole-cell K+ currents of human lymphocytes. Biochem. Biophys. Res. Commun. 1996, 218, 828–832. [Google Scholar] [CrossRef]
- Zhang, X.; Zhou, C.; Cheng, W.; Tao, R.; Xu, H.; Liu, H. Vitamin C protects early mouse embryos against juglone toxicity. Reprod. Toxicol. 2020, 98, 200–208. [Google Scholar] [CrossRef]
- Tian, X.; Wang, F.; He, C.; Zhang, L.; Tan, D.; Reiter, R.J.; Xu, J.; Ji, P.; Liu, G. Beneficial effects of melatonin on bovine oocytes maturation: A mechanistic approach. J. Pineal Res. 2014, 57, 239–247. [Google Scholar] [CrossRef] [PubMed]
- Park, H.J.; Song, B.S.; Kim, J.W.; Yang, S.G.; Kim, S.U.; Koo, D.B. Exposure of Triclosan in Porcine Oocyte Leads to Superoxide Production and Mitochondrial-Mediated Apoptosis During In Vitro Maturation. Int. J. Mol. Sci. 2020, 21, 3050. [Google Scholar] [CrossRef] [PubMed]
- Yuan, B.; Liang, S.; Jin, Y.X.; Zhang, M.J.; Zhang, J.B.; Kim, N.H. Toxic effects of atrazine on porcine oocytes and possible mechanisms of action. PLoS ONE 2017, 12, e0179861. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.J.; Wu, S.N.; Shen, J.P.; Wang, D.H.; Kong, X.W.; Lu, A.; Li, Y.J.; Zhou, H.X.; Zhao, Y.F.; Liang, C.G. The beneficial effects of cumulus cells and oocyte-cumulus cell gap junctions depends on oocyte maturation and fertilization methods in mice. PeerJ 2016, 4, e1761. [Google Scholar] [CrossRef]
- Zhao, X.M.; Min, J.T.; Du, W.H.; Hao, H.S.; Liu, Y.; Qin, T.; Wang, D.; Zhu, H.B. Melatonin enhances the in vitro maturation and developmental potential of bovine oocytes denuded of the cumulus oophorus. Zygote 2015, 23, 525–536. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.Q.; Sugiura, K.; Sun, F.; Pendola, J.K.; Cox, G.A.; Handel, M.A.; Schimenti, J.C.; Eppig, J.J. MARF1 regulates essential oogenic processes in mice. Science 2012, 335, 1496–1499. [Google Scholar] [CrossRef]
- Su, Y.Q.; Sun, F.; Handel, M.A.; Schimenti, J.C.; Eppig, J.J. Meiosis arrest female 1 (MARF1) has nuage-like function in mammalian oocytes. Proc. Natl. Acad. Sci. USA 2012, 109, 18653–18660. [Google Scholar] [CrossRef]
- Su, Y.Q.; Wu, X.; O’Brien, M.J.; Pendola, F.L.; Denegre, J.N.; Matzuk, M.M.; Eppig, J.J. Synergistic roles of BMP15 and GDF9 in the development and function of the oocyte-cumulus cell complex in mice: Genetic evidence for an oocyte-granulosa cell regulatory loop. Dev. Biol. 2004, 276, 64–73. [Google Scholar] [CrossRef]
- Chen, L.; Zhang, J.J.; Zhang, X.; Liu, X.; Zhao, S.; Huo, L.J.; Zhou, J.; Miao, Y.L. Melatonin protects against defects induced by malathion during porcine oocyte maturation. J. Cell. Physiol. 2020, 235, 2836–2846. [Google Scholar] [CrossRef]
- Niu, Y.J.; Zhou, W.; Nie, Z.W.; Shin, K.T.; Cui, X.S. Melatonin enhances mitochondrial biogenesis and protects against rotenone-induced mitochondrial deficiency in early porcine embryos. J. Pineal Res. 2020, 68, e12627. [Google Scholar] [CrossRef]
- Eppig, J.J.; O’Brien, M.J. Comparison of preimplantation developmental competence after mouse oocyte growth and development in vitro and in vivo. Theriogenology 1998, 49, 415–422. [Google Scholar] [CrossRef]
- Jiang, W.J.; Hu, L.L.; Ren, Y.P.; Lu, X.; Luo, X.Q.; Li, Y.H.; Xu, Y.N. Podophyllotoxin affects porcine oocyte maturation by inducing oxidative stress-mediated early apoptosis. Toxicon 2020, 176, 15–20. [Google Scholar] [CrossRef] [PubMed]
- He, C.; Wang, J.; Zhang, Z.; Yang, M.; Li, Y.; Tian, X.; Ma, T.; Tao, J.; Zhu, K.; Song, Y.; et al. Mitochondria Synthesize Melatonin to Ameliorate Its Function and Improve Mice Oocyte’s Quality under in Vitro Conditions. Int. J. Mol. Sci. 2016, 17, 939. [Google Scholar] [CrossRef]
- Shi, J.Y.; Huang, Z.R.; Gao, H.Y.; Xu, X.L. Anticancer effects of juglone in OVCAR-3 human ovarian carcinoma are facilitated through programmed cell death, endogenous ROS production, inhibition of cell migration and invasion and cell cycle arrest. J. BUON 2020, 25, 779–784. [Google Scholar] [PubMed]
- Guo, C.; Sun, L.; Chen, X.; Zhang, D. Oxidative stress, mitochondrial damage and neurodegenerative diseases. Neural Regen. Res. 2013, 8, 2003–2014. [Google Scholar]
- Reader, K.L.; Stanton, J.L.; Juengel, J.L. The Role of Oocyte Organelles in Determining Developmental Competence. Biology 2017, 6, 35. [Google Scholar] [CrossRef]
- Fang, F.; Qin, Y.; Qi, L.; Fang, Q.; Zhao, L.; Chen, S.; Li, Q.; Zhang, D.; Wang, L. Juglone exerts antitumor effect in ovarian cancer cells. Iran. J. Basic Med. Sci. 2015, 18, 544–548. [Google Scholar]
- Zhang, J.W.; Xu, D.Q.; Feng, X.Z. The toxic effects and possible mechanisms of glyphosate on mouse oocytes. Chemosphere 2019, 237, 124435. [Google Scholar] [CrossRef]
- Duan, X.; Dai, X.X.; Wang, T.; Liu, H.L.; Sun, S.C. Melamine negatively affects oocyte architecture, oocyte development and fertility in mice. Hum. Reprod. 2015, 30, 1643–1652. [Google Scholar] [CrossRef]
- El Sheikh, M.; Mesalam, A.A.; Idrees, M.; Sidrat, T.; Mesalam, A.; Lee, K.L.; Kong, I.K. Nicotinamide Supplementation during the In Vitro Maturation of Oocytes Improves the Developmental Competence of Preimplantation Embryos: Potential Link to SIRT1/AKT Signaling. Cells 2020, 9, 1550. [Google Scholar] [CrossRef]
- Mesalam, A.; Lee, K.L.; Khan, I.; Chowdhury, M.M.R.; Zhang, S.; Song, S.H.; Joo, M.D.; Lee, J.H.; Jin, J.I.; Kong, I.K. A combination of bovine serum albumin with insulin-transferrin-sodium selenite and/or epidermal growth factor as alternatives to fetal bovine serum in culture medium improves bovine embryo quality and trophoblast invasion by induction of matrix metalloproteinases. Reprod. Fertil. Dev. 2019, 31, 333–346. [Google Scholar] [PubMed]
- Huang, Z.; Pang, Y.; Hao, H.; Du, W.; Zhao, X.; Zhu, H. Effects of epigallocatechin-3-gallate on bovine oocytes matured in vitro. Asian Australas. J. Anim. Sci 2018, 31, 1420–1430. [Google Scholar] [CrossRef] [PubMed]
- Yang, M.; Tao, J.; Chai, M.; Wu, H.; Wang, J.; Li, G.; He, C.; Xie, L.; Ji, P.; Dai, Y.; et al. Melatonin Improves the Quality of Inferior Bovine Oocytes and Promoted Their Subsequent IVF Embryo Development: Mechanisms and Results. Molecules 2017, 22, 2059. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, M.M.R.; Mesalam, A.; Khan, I.; Joo, M.D.; Lee, K.L.; Xu, L.; Afrin, F.; Kong, I.K. Improved developmental competence in embryos treated with lycopene during in vitro culture system. Mol. Reprod. Dev. 2018, 85, 46–61. [Google Scholar] [CrossRef]
Genes Names | Sequences | PCR Products (bp) | References |
---|---|---|---|
HAS2 | F: GGATCTCCTTCCTCAGCAGTGT R: ATTCCCAGAGGTCCGCTAATG | 106 | [22] |
TNFAIP6 | F: TGAAAGATGGGATGCATATTGC R: CATTTGGGAAGCCTGGAGATT | 101 | [52] |
PTGS2 | F: CTTAAACAAGAGCATCCAGAATGG R: GCTGTACGTAGTCTTCAATCACAATCT | 106 | [52] |
PTX3 | F: CATGTATGTGAATTTGGACAACGA R: GCTTGTCCCACTCGGAGTTC | 101 | [52] |
DNMT1A | F: ACGAATGGTGGATTGCTGGT R: CAGGTCTTCGTAGGTGGAGTC | 197 | [22] |
MARF1 | F: GCAGAGCACCAGGACAATCA R: GAAATAGCCCGCAGAGGAAG | 262 | [31] |
ATPase6 | F: GAACACCCACTCCACTAATCCCAAT R: GTGCAAGTGTAGCTCCTCCGATT | 147 | [53] |
ATP5F1E | F: CAGGCTGGACTCAGCTACATC R: AGTCTTCATGGCGTTTGCTT | 96 | [23] |
POLG2 | F: CTTCTGGGAAACTACGGGAGAAC R: GTAGCCTCTTGTTTACCAGATCCA | 84 | [23] |
GADPH | F: CCCAGAATATCATCCCTGCT R: CTGCTTCACCACCTTCTTGA | 185 | [50] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mesalam, A.A.; El-Sheikh, M.; Joo, M.-D.; Khalil, A.A.K.; Mesalam, A.; Ahn, M.-J.; Kong, I.-K. Induction of Oxidative Stress and Mitochondrial Dysfunction by Juglone Affects the Development of Bovine Oocytes. Int. J. Mol. Sci. 2021, 22, 168. https://doi.org/10.3390/ijms22010168
Mesalam AA, El-Sheikh M, Joo M-D, Khalil AAK, Mesalam A, Ahn M-J, Kong I-K. Induction of Oxidative Stress and Mitochondrial Dysfunction by Juglone Affects the Development of Bovine Oocytes. International Journal of Molecular Sciences. 2021; 22(1):168. https://doi.org/10.3390/ijms22010168
Chicago/Turabian StyleMesalam, Ahmed Atef, Marwa El-Sheikh, Myeong-Don Joo, Atif Ali Khan Khalil, Ayman Mesalam, Mi-Jeong Ahn, and Il-Keun Kong. 2021. "Induction of Oxidative Stress and Mitochondrial Dysfunction by Juglone Affects the Development of Bovine Oocytes" International Journal of Molecular Sciences 22, no. 1: 168. https://doi.org/10.3390/ijms22010168
APA StyleMesalam, A. A., El-Sheikh, M., Joo, M.-D., Khalil, A. A. K., Mesalam, A., Ahn, M.-J., & Kong, I.-K. (2021). Induction of Oxidative Stress and Mitochondrial Dysfunction by Juglone Affects the Development of Bovine Oocytes. International Journal of Molecular Sciences, 22(1), 168. https://doi.org/10.3390/ijms22010168