Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs
Abstract
1. Introduction
2. Results
2.1. Cytotoxic Effect of Sinomenine on A549 Cells
2.2. Effects of Sinomenine on Migration and Invasion of A549 Cells
2.3. Sinomenine Decreases Expression of MMP-2, MMP-9, EMMPRIN/CD147 and Vimentin But Induces Expression of RECK, TIMP-1, TIMP-2 and E-Cadherin in A549 Cells
2.4. Sinomenine Downregulates Expression of miR-21
2.5. Silencing miR-21 Decreases Expression of MMP-2, MMP-9, EMMPRIN/CD147, and Vimentin but Induces Expression of RECK, TIMP-1, TIMP-2, and E-Cadherin in A549 Cells
3. Discussion
4. Materials and Methods
4.1. Reagents and Cell Culture
4.2. Cell Viability Assay
4.3. Wound Healing Migration Assay
4.4. Boyden Chamber Invasion Assay
4.5. Gene Expression Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Shivapurkar, N.; Reddy, J.; Chaudhary, P.M.; Gazdar, A.F. Apoptosis and lung cancer: A review. J. Cell. Biochem. 2003, 88, 885–898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, G.P.; Massague, J. Cancer metastasis: Building a framework. Cell 2006, 127, 679–695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meyer, T.; Hart, I.R. Mechanisms of tumour metastasis. Eur. J. Cancer 1998, 34, 214–221. [Google Scholar] [CrossRef] [Scilit]
- Itoh, Y.; Nagase, H. Matrix metalloproteinases in cancer. Essays Biochem. 2002, 38, 21–36. [Google Scholar] [PubMed]
- Bernhard, E.J.; Gruber, S.B.; Muschel, R.J. Direct evidence linking expression of matrix metalloproteinase 9 (92-kDa gelatinase/collagenase) to the metastatic phenotype in transformed rat embryo cells. Proc. Natl. Acad. Sci. USA 1994, 91, 4293–4297. [Google Scholar] [CrossRef] [Scilit]
- Emmert-Buck, M.R.; Roth, M.J.; Zhuang, Z.; Campo, E.; Rozhin, J.; Sloane, B.F.; Liotta, L.A.; Stetler-Stevenson, W.G. Increased gelatinase A (MMP-2) and cathepsin B activity in invasive tumor regions of human colon cancer samples. Am. J. Pathol. 1994, 145, 1285–1290. [Google Scholar]
- Mook, O.R.; Frederiks, W.M.; Van Noorden, C.J. The role of gelatinases in colorectal cancer progression and metastasis. Biochim. Biophys. Acta 2004, 1705, 69–89. [Google Scholar] [CrossRef] [Scilit]
- Nabeshima, K.; Iwasaki, H.; Koga, K.; Hojo, H.; Suzumiya, J.; Kikuchi, M. Emmprin (basigin/CD147): Matrix metalloproteinase modulator and multifunctional cell recognition molecule that plays a critical role in cancer progression. Pathol. Int. 2006, 56, 359–367. [Google Scholar] [CrossRef] [Scilit]
- Xu, X.Y.; Lin, N.; Li, Y.M.; Zhi, C.; Shen, H. Expression of HAb18G/CD147 and its localization correlate with the progression and poor prognosis of non-small cell lung cancer. Pathol. Res. Pract. 2013, 209, 345–352. [Google Scholar] [CrossRef] [Scilit]
- Clark, J.C.; Thomas, D.M.; Choong, P.F.; Dass, C.R. RECK--a newly discovered inhibitor of metastasis with prognostic significance in multiple forms of cancer. Cancer Metastasis Rev. 2007, 26, 675–683. [Google Scholar] [CrossRef] [Scilit]
- Takenaka, K.; Ishikawa, S.; Kawano, Y.; Yanagihara, K.; Miyahara, R.; Otake, Y.; Morioka, Y.; Takahashi, C.; Noda, M.; Wada, H.; et al. Expression of a novel matrix metalloproteinase regulator, RECK, and its clinical significance in resected non-small cell lung cancer. Eur. J. Cancer 2004, 40, 1617–1623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sun, J. Matrix Metalloproteinases and Tissue Inhibitor of Metalloproteinases Are Essential for the Inflammatory Response in Cancer Cells. J. Signal. Transuct. 2010, 2010, 985132–985139. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsai, J.H.; Yang, J. Epithelial-mesenchymal plasticity in carcinoma metastasis. Genes. Dev. 2013, 27, 2192–2206. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wells, A.; Chao, Y.L.; Grahovac, J.; Wu, Q.; Lauffenburger, D.A. Epithelial and mesenchymal phenotypic switchings modulate cell motility in metastasis. Front. Biosci. 2011, 16, 815–837. [Google Scholar] [CrossRef] [Scilit]
- Zeisberg, M.; Neilson, E.G. Biomarkers for epithelial-mesenchymal transitions. J. Clin. Invest. 2009, 119, 1429–1437. [Google Scholar] [CrossRef] [Scilit]
- Zhao, Y.; Srivastava, D. A developmental view of microRNA function. Trends Biochem. Sci. 2007, 32, 189–197. [Google Scholar] [CrossRef] [Scilit]
- Kumar, M.S.; Lu, J.; Mercer, K.L.; Golub, T.R.; Jacks, T. Impaired microRNA processing enhances cellular transformation and tumorigenesis. Nat. Genet. 2007, 39, 673–677. [Google Scholar] [CrossRef] [Scilit]
- Esquela-Kerscher, A.; Slack, F.J. Oncomirs—MicroRNAs with a role in cancer. Nat. Rev. 2006, 6, 259–269. [Google Scholar] [CrossRef] [Scilit]
- Manikandan, J.; Aarthi, J.J.; Kumar, S.D.; Pushparaj, P.N. Oncomirs: The potential role of non-coding microRNAs in understanding cancer. Bioinformation 2008, 2, 330–334. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Markou, A.; Tsaroucha, E.G.; Kaklamanis, L.; Fotinou, M.; Georgoulias, V.; Lianidou, E.S. Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT-PCR. Clin. Chem. 2008, 54, 1696–1704. [Google Scholar] [CrossRef] [Scilit]
- Krichevsky, A.M.; Gabriely, G. miR-21: A small multi-faceted RNA. J. Cell. Mol. Med. 2009, 13, 39–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Asangani, I.A.; Rasheed, S.A.; Nikolova, D.A.; Leupold, J.H.; Colburn, N.H.; Post, S.; Allgayer, H. MicroRNA-21 (miR-21) post-transcriptionally downregulates tumor suppressor Pdcd4 and stimulates invasion, intravasation and metastasis in colorectal cancer. Oncogene 2008, 27, 2128–2136. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meng, F.; Henson, R.; Wehbe-Janek, H.; Ghoshal, K.; Jacob, S.T.; Patel, T. MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology 2007, 133, 647–658. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.F.; Wu, Z.P.; Chen, Y.; Zhu, Q.S.; Hamidi, S.; Navab, R. MicroRNA-21 (miR-21) regulates cellular proliferation, invasion, migration, and apoptosis by targeting PTEN, RECK and Bcl-2 in lung squamous carcinoma, Gejiu City, China. PLoS ONE 2014, 9, e103698. [Google Scholar] [CrossRef] [Scilit]
- Zhao, X.X.; Peng, C.; Zhang, H.; Qin, L.P. Sinomenium acutum: A review of chemistry, pharmacology, pharmacokinetics, and clinical use. Pharm. Biol. 2012, 50, 1053–1061. [Google Scholar] [CrossRef] [Scilit]
- Teng, P.; Liu, H.L.; Zhang, L.; Feng, L.L.; Huai, Y.; Deng, Z.S.; Sun, Y.; Xu, Q.; Li, J.X. Synthesis and biological evaluation of novel sinomenine derivatives as anti-inflammatory agents. Eur. J. Med. Chem. 2012, 50, 63–74. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Fang, Y.; Huang, W.; Zhou, X.; Wang, M.; Zhong, B.; Peng, D. Effect of sinomenine on cytokine expression of macrophages and synoviocytes in adjuvant arthritis rats. J. Ethnopharmacol. 2005, 98, 37–43. [Google Scholar] [CrossRef] [Scilit]
- Jiang, Y.; Jiao, Y.; Wang, Z.; Li, T.; Liu, Y.; Li, Y.; Zhao, X.; Wang, D. Sinomenine Hydrochloride Inhibits Human Glioblastoma Cell Growth through Reactive Oxygen Species Generation and Autophagy-Lysosome Pathway Activation: An In Vitro and In Vivo Study. Int. J. Mol. Sci. 2017, 18, 1945. [Google Scholar] [CrossRef] [Scilit]
- Jiang, T.; Zhou, L.; Zhang, W.; Qu, D.; Xu, X.; Yang, Y.; Li, S. Effects of sinomenine on proliferation and apoptosis in human lung cancer cell line NCI-H460 in vitro. Mol. Med. Rep. 2010, 3, 51–56. [Google Scholar]
- Lv, Y.; Li, C.; Li, S.; Hao, Z. Sinomenine inhibits proliferation of SGC-7901 gastric adenocarcinoma cells via suppression of cyclooxygenase-2 expression. Oncol. Lett. 2011, 2, 741–745. [Google Scholar] [CrossRef] [Scilit]
- Lu, X.L.; Zeng, J.; Chen, Y.L.; He, P.M.; Wen, M.X.; Ren, M.D.; Hu, Y.N.; Lu, G.F.; He, S. Sinomenine hydrochloride inhibits human hepatocellular carcinoma cell growth in vitro and in vivo: Involvement of cell cycle arrest and apoptosis induction. Int. J. Oncol. 2013, 42, 229–238. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, X.; Wang, K.; Ren, Y.; Zhang, L.; Tang, X.J.; Zhang, H.M.; Zhao, C.Q.; Liu, P.J.; Zhang, J.M.; He, J.J. MAPK signaling mediates sinomenine hydrochloride-induced human breast cancer cell death via both reactive oxygen species-dependent and -independent pathways: An in vitro and in vivo study. Cell Death Dis. 2014, 5, e1356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Song, L.; Liu, D.; Zhao, Y.; He, J.; Kang, H.; Dai, Z.; Wang, X.; Zhang, S.; Zan, Y. Sinomenine inhibits breast cancer cell invasion and migration by suppressing NF-κB activation mediated by IL-4/miR-324-5p/CUEDC2 axis. Biochem. Biophys. Res. Commun. 2015, 464, 705–710. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, S.; Gao, Y.; Hou, W.; Liu, R.; Qi, X.; Xu, X.; Li, J.; Bao, Y.; Zheng, H.; Hua, B. Sinomenine inhibits A549 human lung cancer cell invasion by mediating the STAT3 signaling pathway. Oncol. Lett. 2016, 12, 1380–1386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, G.; Liang, X.; Ma, W. Sinomenine restrains breast cancer cells proliferation, migration and invasion via modulation of miR-29/PDCD-4 axis. Artif. Cells Nanomed. Biotechnol. 2019, 47, 3839–3846. [Google Scholar] [CrossRef] [Scilit]
- Xu, F.; Li, Q.; Wang, Z.; Cao, X. Sinomenine inhibits proliferation, migration, invasion and promotes apoptosis of prostate cancer cells by regulation of miR-23a. Biomed. Pharmacother. Biomed. Pharmacother. 2019, 112, 108592. [Google Scholar] [CrossRef] [Scilit]
- Yuan, H.; Zhang, J.; Li, F.; Li, W.; Wang, H. Sinomenine exerts antitumour effect in gastric cancer cells via enhancement of miR-204 expression. Basic Clin. Pharmacol. Toxicol. 2019, 125, 450–459. [Google Scholar] [CrossRef] [Scilit]
- Zhao, B.; Liu, L.; Mao, J.; Liu, K.; Fan, W.; Liu, J.; Zhang, Z.; Li, Q. Sinomenine hydrochloride attenuates the proliferation, migration, invasiveness, angiogenesis and epithelial-mesenchymal transition of clear-cell renal cell carcinoma cells via targeting Smad in vitro. Biomed. Pharmacother. 2017, 96, 1036–1044. [Google Scholar] [CrossRef] [Scilit]
- He, X.; Maimaiti, M.; Jiao, Y.; Meng, X.; Li, H. Sinomenine Induces G1-Phase Cell Cycle Arrest and Apoptosis in Malignant Glioma Cells Via Downregulation of Sirtuin 1 and Induction of p53 Acetylation. Technol. Cancer Res. Treat. 2018, 17, 1533034618770305. [Google Scholar] [CrossRef] [Scilit]
- Friedl, P.; Wolf, K. Tumour-cell invasion and migration: Diversity and escape mechanisms. Nat. Rev. 2003, 3, 362–374. [Google Scholar] [CrossRef] [Scilit]
- Bodey, B.; Bodey, B., Jr.; Groger, A.M.; Siegel, S.E.; Kaiser, H.E. Invasion and metastasis: The expression and significance of matrix metalloproteinases in carcinomas of the lung. In Vivo 2001, 15, 175–180. [Google Scholar]
- Hrabec, E.; Strek, M.; Nowak, D.; Greger, J.; Suwalski, M.; Hrabec, Z. Activity of type IV collagenases (MMP-2 and MMP-9) in primary pulmonary carcinomas: A quantitative analysis. J. Cancer Res. Clin. Oncol. 2002, 128, 197–204. [Google Scholar] [CrossRef] [Scilit]
- Xie, T.; Ren, H.Y.; Lin, H.Q.; Mao, J.P.; Zhu, T.; Wang, S.D.; Ye, Z.M. Sinomenine prevents metastasis of human osteosarcoma cells via S phase arrest and suppression of tumor-related neovascularization and osteolysis through the CXCR4-STAT3 pathway. Int. J. Oncol. 2016, 48, 2098–2112. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jiang, Y.; Jiao, Y.; Liu, Y.; Zhang, M.; Wang, Z.; Li, Y.; Li, T.; Zhao, X.; Wang, D. Sinomenine Hydrochloride Inhibits the Metastasis of Human Glioblastoma Cells by Suppressing the Expression of Matrix Metalloproteinase-2/-9 and Reversing the Endogenous and Exogenous Epithelial-Mesenchymal Transition. Int. J. Mol. Sci. 2018, 19, 844. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takemoto, N.; Tada, M.; Hida, Y.; Asano, T.; Cheng, S.; Kuramae, T.; Hamada, J.; Miyamoto, M.; Kondo, S.; Moriuchi, T. Low expression of reversion-inducing cysteine-rich protein with Kazal motifs (RECK) indicates a shorter survival after resection in patients with adenocarcinoma of the lung. Lung Cancer 2007, 58, 376–383. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kato, K.; Long, N.K.; Makita, H.; Toida, M.; Yamashita, T.; Hatakeyama, D.; Hara, A.; Mori, H.; Shibata, T. Effects of green tea polyphenol on methylation status of RECK gene and cancer cell invasion in oral squamous cell carcinoma cells. Br. J. Cancer 2008, 99, 647–654. [Google Scholar] [CrossRef] [Scilit]
- Rabien, A.; Ergun, B.; Erbersdobler, A.; Jung, K.; Stephan, C. RECK overexpression decreases invasive potential in prostate cancer cells. Prostate 2012, 72, 948–954. [Google Scholar] [CrossRef] [Scilit]
- Gomez, D.E.; Alonso, D.F.; Yoshiji, H.; Thorgeirsson, U.P. Tissue inhibitors of metalloproteinases: Structure, regulation and biological functions. Eur. J. Cell Biol. 1997, 74, 111–122. [Google Scholar]
- Pulukuri, S.M.; Patibandla, S.; Patel, J.; Estes, N.; Rao, J.S. Epigenetic inactivation of the tissue inhibitor of metalloproteinase-2 (TIMP-2) gene in human prostate tumors. Oncogene 2007, 26, 5229–5237. [Google Scholar] [CrossRef] [Scilit]
- Ramer, R.; Hinz, B. Inhibition of cancer cell invasion by cannabinoids via increased expression of tissue inhibitor of matrix metalloproteinases-1. J. Natl. Cancer Inst. 2008, 100, 59–69. [Google Scholar] [CrossRef] [Scilit]
- Ramer, R.; Merkord, J.; Rohde, H.; Hinz, B. Cannabidiol inhibits cancer cell invasion via upregulation of tissue inhibitor of matrix metalloproteinases-1. Biochem. Pharmacol. 2010, 79, 955–966. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.R.; Qi, H.J.; Deng, D.F.; Luo, Y.Y.; Yang, S.L. MicroRNA-21 promotes cell proliferation, migration, and resistance to apoptosis through PTEN/PI3K/AKT signaling pathway in esophageal cancer. Tumour Biol. 2016, 37, 12061–12070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.L.; Wang, H.; Liu, J.; Wang, Z.X. MicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN. Mol. Cell. Biochem. 2013, 372, 35–45. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, D.; Kim, S.; Koh, H.; Yoon, S.O.; Chung, A.S.; Cho, K.S.; Chung, J. Akt/PKB promotes cancer cell invasion via increased motility and metalloproteinase production. FASEB J. 2001, 15, 1953–1962. [Google Scholar]
- Chakraborti, S.; Mandal, M.; Das, S.; Mandal, A.; Chakraborti, T. Regulation of matrix metalloproteinases: An overview. Mol. Cell. Biochem. 2003, 253, 269–285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dai, L.; Chen, F.; Zheng, Y.; Zhang, D.; Qian, B.; Ji, H.; Long, F.; Cretoiu, D. miR-21 regulates growth and EMT in lung cancer cells via PTEN/Akt/GSK3beta signaling. Front. Biosci. 2019, 24, 1426–1439. [Google Scholar]
- Sethi, G.; Ahn, K.S.; Sung, B.; Aggarwal, B.B. Pinitol targets nuclear factor-kappaB activation pathway leading to inhibition of gene products associated with proliferation, apoptosis, invasion, and angiogenesis. Mol. Cancer Ther. 2008, 7, 1604–1614. [Google Scholar] [CrossRef] [Scilit]
- Shin, E.M.; Hay, H.S.; Lee, M.H.; Goh, J.N.; Tan, T.Z.; Sen, Y.P.; Lim, S.W.; Yousef, E.M.; Ong, H.T.; Thike, A.A.; et al. DEAD-box helicase DP103 defines metastatic potential of human breast cancers. J. Clin. Investig. 2014, 124, 3807–3824. [Google Scholar] [CrossRef] [Scilit]
- Safe, S.; Kasiappan, R. Natural Products as Mechanism-based Anticancer Agents: Sp Transcription Factors as Targets. Phytother. Res. 2016, 30, 1723–1732. [Google Scholar] [CrossRef] [Scilit]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef] [Scilit]
- Lu, M.K.; Shih, Y.W.; Chang Chien, T.T.; Fang, L.H.; Huang, H.C.; Chen, P.S. alpha-Solanine inhibits human melanoma cell migration and invasion by reducing matrix metalloproteinase-2/9 activities. Biol. Pharm. Bull. 2010, 33, 1685–1691. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Sequence (5′-3′) |
|---|---|
| MMP-2-F | CTTCCAAGTCTGGAGCGATGT |
| MMP-2-R | TACCGTCAAAGGGGTATCCAT |
| MMP-9-F | GGGACGCAGACATCGTCATC |
| MMP-9-R | TCGTCATCGTCGAAATGGGC |
| EMMPRIN-F | CTACACATTGAGAACCTGAACAT |
| EMMPRIN-R | TTCTCGTAGATGAAGATGATGGT |
| RECK-F | CCTGCATTGCTCGCTGTGTG |
| RECK-R | CCTGTGGTTTGGGTATGCACCTT |
| TIMP-1-F | CTTCTGCAATTCCGACCTCGT |
| TIMP-1-R | CCCTAAGGCTTGGAACCCTTT |
| TIMP-2-F | AAGCGGTCAGTGAGAAGGAAG |
| TIMP-2-R | CACACACTACCGAGGAGGG |
| β-actin-F | CATGTACGTTGCTATCCAGGC |
| β-actin-R | CTCCTTAATGTCACGCACGAT |
| E-cadherin-F | ACCAGAATAAAGACCAAGTGACCA |
| E-cadherin-R | AGCAAGAGCAGCAGAATCAGAAT |
| vimentin-F | AATGGCTCGTCACCTTCGTGAAT |
| vimentin-R | CAGATTATG TTCCCTCAGGTTCAG |
| miR-21 | CGGCGGTAGCTTATCAGACTGA |
| RNU6B | TTCCTCCGCAAGGATGACACGC |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shen, K.-H.; Hung, J.-H.; Liao, Y.-C.; Tsai, S.-T.; Wu, M.-J.; Chen, P.-S. Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs. Int. J. Mol. Sci. 2020, 21, 3080. https://doi.org/10.3390/ijms21093080
Shen K-H, Hung J-H, Liao Y-C, Tsai S-T, Wu M-J, Chen P-S. Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs. International Journal of Molecular Sciences. 2020; 21(9):3080. https://doi.org/10.3390/ijms21093080
Chicago/Turabian StyleShen, Kun-Hung, Jui-Hsiang Hung, Yi-Ching Liao, Shu-Ting Tsai, Ming-Jiuan Wu, and Pin-Shern Chen. 2020. "Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs" International Journal of Molecular Sciences 21, no. 9: 3080. https://doi.org/10.3390/ijms21093080
APA StyleShen, K.-H., Hung, J.-H., Liao, Y.-C., Tsai, S.-T., Wu, M.-J., & Chen, P.-S. (2020). Sinomenine Inhibits Migration and Invasion of Human Lung Cancer Cell through Downregulating Expression of miR-21 and MMPs. International Journal of Molecular Sciences, 21(9), 3080. https://doi.org/10.3390/ijms21093080
