Characterization of Glyceollins as Novel Aryl Hydrocarbon Receptor Ligands and Their Role in Cell Migration
Abstract
:1. Introduction
2. Results
2.1. Docking at the Ligand-Binding Site and Experimental Interactions of AhR with Glyceollins
2.2. AhR Activation by Glyceollins in Breast Cancer Cells
2.3. Genome-Wide Analysis of the Glyceollin Effects
2.4. Glyceollin Effects on AhR Target Gene Expression
2.5. Glyceollin Effect on Cell Migration
3. Discussion
4. Materials and Methods
4.1. Computer Simulation of AhR Ligand Interactions (Docking)
4.2. Cell Cultures and Reagents
4.3. Immunofluorescence
4.4. Luciferase Assay
4.5. Protein Extraction and Western Blotting
4.6. Chromatin Immunoprecipitation (ChIP) Assays
4.7. RNA Extraction and Real-Time PCR
4.8. Cell Migration Assays
4.9. Statistical Analyses
4.10. Transcriptome Analysis
4.11. Statistical Filtration and Clustering
4.12. Functional Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
AhR | Aryl hydrocarbon receptor |
GI | Glyceollin I |
GII | Glyceollin II |
TCDD | 2,3,7,8-tetrachlorodibenzo-p-dioxin |
BC | Breast cancer |
ER | Estrogen receptor |
XRE | Xenobiotic response element |
EMT | Epithelial-mesenchymal transition |
PAS | Per-Arnt-Sim |
LBD | Ligand binding domain |
HIF-2α | hypoxia-inducible factor 2alpha |
References
- Ferlay, J.; Soerjomataram, I.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA. Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [Green Version]
- Haney, M.J.; Zhao, Y.; Jin, Y.S.; Li, S.M.; Bago, J.R.; Klyachko, N.L.; Kabanov, A.V.; Batrakova, E.V. Macrophage-Derived Extracellular Vesicles as Drug Delivery Systems for Triple Negative Breast Cancer (TNBC) Therapy. J. Neuroimmune Pharmacol. 2019. [Google Scholar] [CrossRef]
- Nishijima, T.F.; Deal, A.M.; Williams, G.R.; Sanoff, H.K.; Nyrop, K.A.; Muss, H.B. Chemotherapy Toxicity Risk Score for Treatment Decisions in Older Adults with Advanced Solid Tumors. Oncologist 2018, 23, 573–579. [Google Scholar] [CrossRef] [Green Version]
- Park, I.S.; Kim, H.J.; Jeong, Y.-S.; Kim, W.-K.; Kim, J.-S. Differential abilities of Korean soybean varieties to biosynthesize glyceollins by biotic and abiotic elicitors. Food Sci. Biotechnol. 2017, 26, 255–261. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.R.; Kim, J.Y.; Chun, J.; Park, S.; Kim, H.J.; Kim, J.-S.; Jeong, J.-I.; Kim, J.H. Induction of glyceollins by fungal infection in varieties of Korean soybean. J. Microbiol. Biotechnol. 2010, 20, 1226–1229. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, H.J.; Lim, J.-S.; Kim, W.-K.; Kim, J.-S. Soyabean glyceollins: Biological effects and relevance to human health. Proc. Nutr. Soc. 2012, 71, 166–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pham, T.H.; Lecomte, S.; Efstathiou, T.; Ferriere, F.; Pakdel, F. An Update on the Effects of Glyceollins on Human Health: Possible Anticancer Effects and Underlying Mechanisms. Nutrients 2019, 11, 79. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bamji, S.F.; Corbitt, C. Glyceollins: Soybean phytoalexins that exhibit a wide range of health-promoting effects. J. Funct. Foods 2017, 34, 98–105. [Google Scholar] [CrossRef]
- Lecomte, S.; Chalmel, F.; Ferriere, F.; Percevault, F.; Plu, N.; Saligaut, C.; Surel, C.; Lelong, M.; Efstathiou, T.; Pakdel, F. Glyceollins trigger anti-proliferative effects through estradiol-dependent and independent pathways in breast cancer cells. Cell Commun. Signal. CCS 2017, 15, 26. [Google Scholar] [CrossRef] [Green Version]
- Burow, M.E.; Boue, S.M.; Collins-Burow, B.M.; Melnik, L.I.; Duong, B.N.; Carter-Wientjes, C.H.; Li, S.; Wiese, T.E.; Cleveland, T.E.; McLachlan, J.A. Phytochemical glyceollins, isolated from soy, mediate antihormonal effects through estrogen receptor alpha and beta. J. Clin. Endocrinol. Metab. 2001, 86, 1750–1758. [Google Scholar] [PubMed] [Green Version]
- Zimmermann, M.C.; Tilghman, S.L.; Boué, S.M.; Salvo, V.A.; Elliott, S.; Williams, K.Y.; Skripnikova, E.V.; Ashe, H.; Payton-Stewart, F.; Vanhoy-Rhodes, L.; et al. Glyceollin I, a novel antiestrogenic phytoalexin isolated from activated soy. J. Pharmacol. Exp. Ther. 2010, 332, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Salvo, V.A.; Boué, S.M.; Fonseca, J.P.; Elliott, S.; Corbitt, C.; Collins-Burow, B.M.; Curiel, T.J.; Srivastav, S.K.; Shih, B.Y.; Carter-Wientjes, C.; et al. Antiestrogenic glyceollins suppress human breast and ovarian carcinoma tumorigenesis. Clin. Cancer Res. Off. J. Am. Assoc. Cancer Res. 2006, 12, 7159–7164. [Google Scholar] [CrossRef] [Green Version]
- Wood, C.E.; Clarkson, T.B.; Appt, S.E.; Franke, A.A.; Boue, S.M.; Burow, M.E.; McCoy, T.; Cline, J.M. Effects of soybean glyceollins and estradiol in postmenopausal female monkeys. Nutr. Cancer 2006, 56, 74–81. [Google Scholar] [CrossRef] [PubMed]
- Bratton, M.R.; Martin, E.C.; Elliott, S.; Rhodes, L.V.; Collins-Burow, B.M.; McLachlan, J.A.; Wiese, T.E.; Boue, S.M.; Burow, M.E. Glyceollin, a novel regulator of mTOR/p70S6 in estrogen receptor positive breast cancer. J. Steroid Biochem. Mol. Biol. 2015, 150, 17–23. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rhodes, L.V.; Tilghman, S.L.; Boue, S.M.; Wang, S.; Khalili, H.; Muir, S.E.; Bratton, M.R.; Zhang, Q.; Wang, G.; Burow, M.E.; et al. Glyceollins as novel targeted therapeutic for the treatment of triple-negative breast cancer. Oncol. Lett. 2012, 3, 163–171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.H.; Lee, J.; Jung, M.H.; Lee, Y.M. Glyceollins, a novel class of soy phytoalexins, inhibit angiogenesis by blocking the VEGF and bFGF signaling pathways. Mol. Nutr. Food Res. 2013, 57, 225–234. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.-H.; Jee, J.-G.; Bae, J.-S.; Liu, K.-H.; Lee, Y.M. A group of novel HIF-1α inhibitors, glyceollins, blocks HIF-1α synthesis and decreases its stability via inhibition of the PI3K/AKT/mTOR pathway and Hsp90 binding. J. Cell Physiol. 2015, 230, 853–862. [Google Scholar] [CrossRef]
- Abel, J.; Haarmann-Stemmann, T. An introduction to the molecular basics of aryl hydrocarbon receptor biology. Biol. Chem. 2010, 391, 1235–1248. [Google Scholar] [CrossRef]
- Poland, A.; Glover, E.; Kende, A.S. Stereospecific, high affinity binding of 2,3,7,8-tetrachlorodibenzo-p-dioxin by hepatic cytosol. Evidence that the binding species is receptor for induction of aryl hydrocarbon hydroxylase. J. Biol. Chem. 1976, 251, 4936–4946. [Google Scholar]
- Kolluri, S.K.; Jin, U.-H.; Safe, S. Role of the aryl hydrocarbon receptor in carcinogenesis and potential as an anti-cancer drug target. Arch. Toxicol. 2017, 91, 2497–2513. [Google Scholar] [CrossRef]
- Safe, S.; Cheng, Y.; Jin, U.-H. The Aryl Hydrocarbon Receptor (AhR) as a Drug Target for Cancer Chemotherapy. Curr. Opin. Toxicol. 2017, 2, 24–29. [Google Scholar] [CrossRef] [PubMed]
- Murray, I.A.; Patterson, A.D.; Perdew, G.H. Aryl hydrocarbon receptor ligands in cancer: Friend and foe. Nat. Rev. Cancer 2014, 14, 801–814. [Google Scholar] [CrossRef] [PubMed]
- Tissue Expression of AHR—Summary—The Human Protein Atlas. Available online: https://www.proteinatlas.org/ENSG00000106546-AHR/tissue (accessed on 18 November 2019).
- Narasimhan, S.; Stanford Zulick, E.; Novikov, O.; Parks, A.; Schlezinger, J.; Wang, Z.; Laroche, F.; Feng, H.; Mulas, F.; Monti, S.; et al. Towards Resolving the Pro- and Anti-Tumor Effects of the Aryl Hydrocarbon Receptor. Int. J. Mol. Sci. 2018, 19, 1388. [Google Scholar] [CrossRef] [Green Version]
- Tsai, C.-H.; Li, C.-H.; Cheng, Y.-W.; Lee, C.-C.; Liao, P.-L.; Lin, C.-H.; Huang, S.-H.; Kang, J.-J. The inhibition of lung cancer cell migration by AhR-regulated autophagy. Sci. Rep. 2017, 7, 41927. [Google Scholar] [CrossRef] [PubMed]
- Tsai, C.-H.; Li, C.-H.; Liao, P.-L.; Chang, Y.-W.; Cheng, Y.-W.; Kang, J.-J. Aza-PBHA, a potent histone deacetylase inhibitor, inhibits human gastric-cancer cell migration via PKCα-mediated AHR-HDAC interactions. Biochim. Biophys. Acta Mol. Cell Res. 2019, 1867, 118564. [Google Scholar] [CrossRef] [PubMed]
- Pandini, A.; Denison, M.S.; Song, Y.; Soshilov, A.A.; Bonati, L. Structural and Functional Characterization of the Aryl Hydrocarbon Receptor Ligand Binding Domain by Homology Modeling and Mutational Analysis. Biochemistry 2007, 46, 696–708. [Google Scholar] [CrossRef] [Green Version]
- Xing, Y.; Nukaya, M.; Satyshur, K.A.; Jiang, L.; Stanevich, V.; Korkmaz, E.N.; Burdette, L.; Kennedy, G.D.; Cui, Q.; Bradfield, C.A. Identification of the Ah-Receptor Structural Determinants for Ligand Preferences. Toxicol. Sci. 2012, 129, 86–97. [Google Scholar] [CrossRef] [Green Version]
- Salzano, M.; Marabotti, A.; Milanesi, L.; Facchiano, A. Human aryl-hydrocarbon receptor and its interaction with dioxin and physiological ligands investigated by molecular modelling and docking simulations. Biochem. Biophys. Res. Commun. 2011, 413, 176–181. [Google Scholar] [CrossRef]
- Rasmussen, M.K.; Balaguer, P.; Ekstrand, B.; Daujat-Chavanieu, M.; Gerbal-Chaloin, S. Skatole (3-Methylindole) Is a Partial Aryl Hydrocarbon Receptor Agonist and Induces CYP1A1/2 and CYP1B1 Expression in Primary Human Hepatocytes. PLoS ONE 2016, 11, e0154629. [Google Scholar] [CrossRef]
- Gong, P.; Madak-Erdogan, Z.; Flaws, J.A.; Shapiro, D.J.; Katzenellenbogen, J.A.; Katzenellenbogen, B.S. Estrogen receptor-α and aryl hydrocarbon receptor involvement in the actions of botanical estrogens in target cells. Mol. Cell. Endocrinol. 2016, 437, 190–200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kress, S.; Greenlee, W.F. Cell-specific regulation of human CYP1A1 and CYP1B1 genes. Cancer Res. 1997, 57, 1264–1269. [Google Scholar] [PubMed]
- Hanieh, H.; Mohafez, O.; Hairul-Islam, V.I.; Alzahrani, A.; Bani Ismail, M.; Thirugnanasambantham, K. Novel Aryl Hydrocarbon Receptor Agonist Suppresses Migration and Invasion of Breast Cancer Cells. PLoS ONE 2016, 11, e0167650. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, U.-H.; Lee, S.-O.; Pfent, C.; Safe, S. The aryl hydrocarbon receptor ligand omeprazole inhibits breast cancer cell invasion and metastasis. BMC Cancer 2014, 14, 498. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mrozik, K.M.; Blaschuk, O.W.; Cheong, C.M.; Zannettino, A.C.W.; Vandyke, K. N-cadherin in cancer metastasis, its emerging role in haematological malignancies and potential as a therapeutic target in cancer. BMC Cancer 2018, 18, 939. [Google Scholar] [CrossRef]
- Nam, J.-S.; Kang, M.-J.; Suchar, A.M.; Shimamura, T.; Kohn, E.A.; Michalowska, A.M.; Jordan, V.C.; Hirohashi, S.; Wakefield, L.M. Chemokine (C-C Motif) Ligand 2 Mediates the Prometastatic Effect of Dysadherin in Human Breast Cancer Cells. Cancer Res. 2006, 66, 7176–7184. [Google Scholar] [CrossRef] [Green Version]
- Jia, Y.; Shi, H.; Cao, Y.; Feng, W.; Li, M.; Li, X. PDZ and LIM domain protein 4 suppresses the growth and invasion of ovarian cancer cells via inactivation of STAT3 signaling. Life Sci. 2019, 233, 116715. [Google Scholar] [CrossRef]
- Donovan, M.G.; Selmin, O.I.; Doetschman, T.C.; Romagnolo, D.F. Epigenetic Activation of BRCA1 by Genistein In Vivo and Triple Negative Breast Cancer Cells Linked to Antagonism toward Aryl Hydrocarbon Receptor. Nutrients 2019, 11, 2559. [Google Scholar] [CrossRef] [Green Version]
- Campbell, P.S.; Mavingire, N.; Khan, S.; Rowland, L.K.; Wooten, J.V.; Opoku-Agyeman, A.; Guevara, A.; Soto, U.; Cavalli, F.; Perez, A.L.; et al. AhR ligand Aminoflavone suppresses α6-integrin-Src-Akt signaling to attenuate tamoxifen resistance in breast cancer cells. J. Cell. Physiol. 2018, 234, 108–121. [Google Scholar] [CrossRef] [Green Version]
- O’Donnell, E.F.; Koch, D.C.; Bisson, W.H.; Jang, H.S.; Kolluri, S.K. The aryl hydrocarbon receptor mediates raloxifene-induced apoptosis in estrogen receptor-negative hepatoma and breast cancer cells. Cell Death Dis. 2014, 5, e1038. [Google Scholar] [CrossRef]
- Pillon, A.; Boussioux, A.-M.; Escande, A.; Aït-Aïssa, S.; Gomez, E.; Fenet, H.; Ruff, M.; Moras, D.; Vignon, F.; Duchesne, M.-J.; et al. Binding of Estrogenic Compounds to Recombinant Estrogen Receptor-α: Application to Environmental Analysis. Environ. Health Perspect. 2005, 113, 278–284. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Satsu, H.; Yoshida, K.; Mikubo, A.; Ogiwara, H.; Inakuma, T.; Shimizu, M. Establishment of a stable aryl hydrocarbon receptor-responsive HepG2 cell line. Cytotechnology 2015, 67, 621–632. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Powell, J.B.; Goode, G.D.; Eltom, S.E. The Aryl Hydrocarbon Receptor: A Target for Breast Cancer Therapy. J. Cancer Ther. 2013, 4, 1177–1186. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jitariu, A.-A.; Cîmpean, A.M.; Ribatti, D.; Raica, M. Triple negative breast cancer: The kiss of death. Oncotarget 2017, 8, 46652–46662. [Google Scholar] [CrossRef] [Green Version]
- Vacher, S.; Castagnet, P.; Chemlali, W.; Lallemand, F.; Meseure, D.; Pocard, M.; Bieche, I.; Perrot-Applanat, M. High AHR expression in breast tumors correlates with expression of genes from several signaling pathways namely inflammation and endogenous tryptophan metabolism. PLoS ONE 2018, 13, e0190619. [Google Scholar] [CrossRef] [Green Version]
- Mescher, M.; Haarmann-Stemmann, T. Modulation of CYP1A1 metabolism: From adverse health effects to chemoprevention and therapeutic options. Pharmacol. Ther. 2018, 187, 71–87. [Google Scholar] [CrossRef]
- Kasai, A.; Hiramatsu, N.; Hayakawa, K.; Yao, J.; Kitamura, M. Blockade of the Dioxin Pathway by Herbal Medicine Formula Bupleuri Minor: Identification of Active Entities for Suppression of AhR Activation. Biol. Pharm. Bull. 2008, 31, 838–846. [Google Scholar] [CrossRef] [Green Version]
- Casper, R.F.; Quesne, M.; Rogers, I.M.; Shirota, T.; Jolivet, A.; Milgrom, E.; Savouret, J.-F. Resveratrol Has Antagonist Activity on the Aryl Hydrocarbon Receptor: Implications for Prevention of Dioxin Toxicity. Mol. Pharmacol. 1999, 56, 784–790. [Google Scholar]
- Guan, X. Cancer metastases: Challenges and opportunities. Acta Pharm. Sin. B 2015, 5, 402–418. [Google Scholar] [CrossRef] [Green Version]
- Carriere, P.P.; Llopis, S.D.; Naiki, A.C.; Nguyen, G.; Phan, T.; Nguyen, M.M.; Preyan, L.C.; Yearby, L.; Pratt, J.; Burks, H.; et al. Glyceollin I Reverses Epithelial to Mesenchymal Transition in Letrozole Resistant Breast Cancer through ZEB1. Int. J. Environ. Res. Public Health 2016, 13, 10. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.J.; Cha, B.-Y.; Choi, B.; Lim, J.S.; Woo, J.-T.; Kim, J.-S. Glyceollins inhibit platelet-derived growth factor-mediated human arterial smooth muscle cell proliferation and migration. Br. J. Nutr. 2012, 107, 24–35. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Källberg, M.; Wang, H.; Wang, S.; Peng, J.; Wang, Z.; Lu, H.; Xu, J. Template-based protein structure modeling using the RaptorX web server. Nat. Protoc. 2012, 7, 1511–1522. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chovancova, E.; Pavelka, A.; Benes, P.; Strnad, O.; Brezovsky, J.; Kozlikova, B.; Gora, A.; Sustr, V.; Klvana, M.; Medek, P.; et al. CAVER 3.0: A Tool for the Analysis of Transport Pathways in Dynamic Protein Structures. PLoS Comput. Biol. 2012, 8, e1002708. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Connolly, M.L. Analytical molecular surface calculation. J. Appl. Crystallogr. 1983, 16, 548–558. [Google Scholar] [CrossRef]
- Korb, O.; Stützle, T.; Exner, T.E. Empirical scoring functions for advanced protein-ligand docking with PLANTS. J. Chem. Inf. Model. 2009, 49, 84–96. [Google Scholar] [CrossRef]
- Soumillon, M.; Cacchiarelli, D.; Semrau, S.; van Oudenaarden, A.; Mikkelsen, T.S. Characterization of directed differentiation by high-throughput single-cell RNA-Seq. bioRXiv 2014. [Google Scholar] [CrossRef] [Green Version]
- Chalmel, F.; Primig, M. The Annotation, Mapping, Expression and Network (AMEN) suite of tools for molecular systems biology. BMC Bioinform. 2008, 9, 86. [Google Scholar] [CrossRef] [PubMed]
- Smyth, G.K. Linear models and empirical bayes methods for assessing differential expression in microarray experiments. Stat. Appl. Genet. Mol. Biol. 2004, 3, 3. [Google Scholar] [CrossRef]
Experiments | Gene Name and Symbol | Forward Primer | Reverse Primer |
---|---|---|---|
Real-time PCR | Cytochrome P450 family 1 subfamily A member 1 (CYP1A1) | GCTGACTTCATCCCTATTCTTCG | TTTTGTAGTGCTCCTTGACCATCT |
Cytochrome P450 family 1 subfamily B member 1 (CYP1B1) | GCAACTTCAGCAACTTCATC | ATAAAGGCGTCCATCATGTC | |
N-Cadherin (CDH2) | GACAATGCCCCTCAAGTGTT | CCATTAAGCCGAGTGATGGT | |
Chemokine (C-C motif) ligand 2 (CCL2) | AAGATCTCAGTGCAGAGGCTCG | TTGCTTGTCCAGGTGGTCCAT | |
PDZ- LIM domain protein 4 (PDLIM4) | CAAGGCACGGGACAAGCTCTAC | AGCAGGGACCTTAAGAAGCAG | |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | TGCACCACCAACTGCTTAGC | GGCATGGACTGTGGTCATGAG | |
TATA box-binding protein (TBP) | TGCACAGGAGCCAAGAGTGAA | CACATCACAGCTCCCCACCA | |
ChIP-PCR | Cytochrome P450 family 1 subfamily A member 1 (CYP1A1) | GCGCGAACCTCAGCTAGT | TTCCCGGGGTTACTGAGTC |
Cytochrome P450 family 1 subfamily B member 1 (CYP1B1) | ATATGACTGGAGCCGACTTTTCC | GGCGAACTTTATCGGGTTGA |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pham, T.H.; Lecomte, S.; Le Guevel, R.; Lardenois, A.; Evrard, B.; Chalmel, F.; Ferriere, F.; Balaguer, P.; Efstathiou, T.; Pakdel, F. Characterization of Glyceollins as Novel Aryl Hydrocarbon Receptor Ligands and Their Role in Cell Migration. Int. J. Mol. Sci. 2020, 21, 1368. https://doi.org/10.3390/ijms21041368
Pham TH, Lecomte S, Le Guevel R, Lardenois A, Evrard B, Chalmel F, Ferriere F, Balaguer P, Efstathiou T, Pakdel F. Characterization of Glyceollins as Novel Aryl Hydrocarbon Receptor Ligands and Their Role in Cell Migration. International Journal of Molecular Sciences. 2020; 21(4):1368. https://doi.org/10.3390/ijms21041368
Chicago/Turabian StylePham, Thu Ha, Sylvain Lecomte, Remy Le Guevel, Aurélie Lardenois, Bertrand Evrard, Frédéric Chalmel, François Ferriere, Patrick Balaguer, Theo Efstathiou, and Farzad Pakdel. 2020. "Characterization of Glyceollins as Novel Aryl Hydrocarbon Receptor Ligands and Their Role in Cell Migration" International Journal of Molecular Sciences 21, no. 4: 1368. https://doi.org/10.3390/ijms21041368
APA StylePham, T. H., Lecomte, S., Le Guevel, R., Lardenois, A., Evrard, B., Chalmel, F., Ferriere, F., Balaguer, P., Efstathiou, T., & Pakdel, F. (2020). Characterization of Glyceollins as Novel Aryl Hydrocarbon Receptor Ligands and Their Role in Cell Migration. International Journal of Molecular Sciences, 21(4), 1368. https://doi.org/10.3390/ijms21041368