Next Article in Journal
Extracellular l-arginine Enhances Relaxations Induced by Opening of Calcium-Activated SKCa Channels in Porcine Retinal Arteriole
Next Article in Special Issue
Insights on the Proteases Involved in Barley and Wheat Grain Germination
Previous Article in Journal
Alpha-Synuclein RNA Expression is Increased in Major Depression
Previous Article in Special Issue
Instability of Alien Chromosome Introgressions in Wheat Associated with Improper Positioning in the Nucleus
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Brief Report

New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds

1
Provincial Key Laboratory of Plant Breeding and Genetics, Sichuan Agricultural University, Wenjiang, Chengdu 611130, Sichuan, China
2
College of Agronomy, Sichuan Agricultural University, Wenjiang, Chengdu 611130, Sichuan, China
3
Center for Informational Biology, University of Electronic Science and Technology of China, Chengdu 610054, Sichuan, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Int. J. Mol. Sci. 2019, 20(8), 2031; https://doi.org/10.3390/ijms20082031
Submission received: 4 April 2019 / Revised: 20 April 2019 / Accepted: 22 April 2019 / Published: 25 April 2019
(This article belongs to the Special Issue Molecular Advances in Wheat and Barley)

Abstract

Thinopyrum has been widely used to improve wheat (Triticum aestivum L.) cultivars. Non-denaturing fluorescence in situ hybridization (ND-FISH) technology using oligonucleotides (oligo) as probes provides a convenient and efficient way to identify alien chromosomes in wheat backgrounds. However, suitable ND-FISH-positive oligo probes for distinguishing Thinopyrum chromosomes from wheat are lacking. Two oligo probes, Oligo-B11 and Oligo-pThp3.93, were designed according to the published Thinopyrum ponticum (Th. ponticum)-specific repetitive sequences. Both Oligo-B11 and Oligo-pThp3.93 can be used for ND-FISH analysis and can replace conventional GISH and FISH to discriminate some chromosomes of Th. elongatum, Th. intermedium, and Th. ponticum in wheat backgrounds. The two oligo probes provide a convenient way for the utilization of Thinopyrum germplasms in future wheat breeding programs.

Graphical Abstract

1. Introduction

Thinopyrum intermedium (Th. intermedium), Thinopyrum ponticum (Th. ponticum) and Thinopyrum elongatum (Th. elongatum) are important reservoirs of elite genes for wheat (Triticum aestivum L.) breeding programs. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) technologies can be used to differentiate and localize Th. intermedium, Th. ponticum and Th. elongatum chromosomes in wheat backgrounds [1,2,3,4,5,6,7,8]. However, GISH and FISH are time-consuming because of the preparation and labeling of probe sequences, and denaturing of the probes and chromosomes [9,10]. Oligonucleotide (oligo) probes combined with non-denaturing fluorescence in situ hybridization (ND-FISH) can be used to discriminate alien chromosomes in wheat backgrounds conveniently [10,11]. Suitable ND-FISH-positive oligo probes for distinguishing Thinopyrum chromosomes from wheat are lacking. In this study, Thinopyrum chromosome-specific oligo probes were developed.

2. Results

2.1. Production of Thinopyrum Chromosome-Specific Oligo Probes

Th. ponticum species-specific repetitive sequences B11 [3] and pThp3.93 [6] were aligned using the DNAMAN (Ver. 4.0, Lynnon Corp., Quebec, QC, Canada). The sequence of pThp3.93 has a 59.78% similarity with the 1138–1622 bp segment of the reverse_complement B11 sequence. The 1304–1348 bp segment of the reverse_complement B11 sequence and the 158–216 bp segment of the pThp3.93 sequence were used as oligo probes, and were named as Oligo-B11 and Oligo-pThp3.93, respectively. The two oligo probes are listed in Table 1.

2.2. ND-FISH Analysis Using Oligo-B11 and Oligo-pThp3.93

The Oligo-B11, Oligo-pThp3.93, Oligo-pSc119.2-1, and Oligo-pTa535-1 probes combined with the ND-FISH assay could distinguish Thinopyrum chromosomes from wheat in Xiaoyan 68, 8802, Xaioyan 7430, and Zhong 3. Both Oligo-B11 and Oligo-pThp3.93 probes produced dispersed signal patterns on 12 and 14 chromosomes in Xiaoyan 68 and 8802, respectively (Figure 1 and Figure 2). A pair of wheat-Th. ponticum translocation chromosomes TTh-4DS·4DL in Xiaoyan 68 could also be detected by Oligo-B11, Oligo-pThp3.93, Oligo-pSc119.2-1, and Oligo-pTa535-1 (Figure 1).
The Oligo-B11 and Oligo-pThp3.93 probes also produced whole-chromosome signal patterns on 12 and 14 chromosomes in Xiaoyan 7430 and Zhong 3, respectively (Figure 3 and Figure 4). Therefore, both of the ND-FISH-positive Oligo-B11 and Oligo-pThp3.93 probes produced whole-chromosome signal patterns on 12, 14, 12, and 14 chromosomes in Xiaoyan 68, 8802, Xaioyan 7430, and Zhong 3, respectively. Additionally, no obvious signals of Oligo-B11 and Oligo-pThp3.93 were observed on wheat chromosomes in the materials used in this study (Figure 1, Figure 2, Figure 3 and Figure 4).

3. Discussion

3.1. Using Oligo Probes and ND-FISH Assay to Identify Alien Chromosomes

Since Cuadrado et al. used the ND-FISH assay to detect plant telomeres [12], this technology has been widely used to analyze chromosomes of Triticeae species because of its convenience and high efficiency [4,10,11,13,14,15,16,17,18,19,20,21,22,23,24,25,26]. Using oligo probes combined with the ND-FISH assay, rye (S. cereale) and Dasypyrum villosum chromosomes can be effectively and accurately distinguished from common wheat chromosomes [4,10,11]. In addition, two ND-FISH-positive oligo probes, Oligo-B and Oligo-D, can replace multicolor GISH to identify wheat A-, B-, and D-genome chromosomes [23]. During the ND-FISH procedure, oligo probes can be commercially synthesized and the denaturing of probes and chromosomes is not necessary [4,10,11,23]. Therefore, compared with GISH and FISH, ND-FISH analysis with suitable oligo probes can efficiently distinguish the chromosomes between two distant genera and within the same genus of the Triticeae tribe.

3.2. ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes

For a successful ND-FISH assay, finding suitable oligo probes is the key initial step. However, the necessary ND-FISH-positive oligo probes for distinguishing Thinopyrum chromosomes in wheat backgrounds are still lacking. Some disease-resistance and stress-resistance genes from Thinopyrum have been introduced into wheat backgrounds [1,2,3,4,5,6,7,8,18,27]. Now, conventional GISH and FISH are the main methods to distinguish and localize Thinopyrum chromosomal segments in wheat backgrounds [1,2,3,4,5,6,7,8,18,27]. In this study, two suitable ND-FISH-positive oligo probes, Oligo-B11 and Oligo-pThp3.93, were designed based on Th. ponticum species-specific repetitive sequences [3,6]. Both of these oligo probes produced whole-chromosome signal patterns on 12, 14, 12, and 14 chromosomes in Xiaoyan 68, 8802, Xaioyan 7430m and Zhong 3, respectively (Figure 1, Figure 2, Figure 3 and Figure 4). The numbers of the Thinopyrum chromosomes identified by Oligo-B11 and Oligo-pThp3.93 in each of these materials were consistent with those previously reported [1,6,28,29].
In addition, the Oligo-B11, Oligo-pThp3.93, and Oligo-pTa535-1 probes could also identify the TTh-4DS·4DL translocation chromosomes in Xiaoyan 68 (Figure 1). In the materials used in this study, the Thinopyrum chromosomes came from Th. ponticum, Th. elongatum, and Th. intermedium [1,6,28,29]. Therefore, Oligo-B11 and Oligo-pThp3.93 combined with the ND-FISH assay can replace conventional GISH and FISH to conveniently discriminate the Th. elongatum, Th. intermedium, and Th. ponticum chromosomes in Xiaoyan 68, 8802, Xaioyan 7430, and Zhong 3 from wheat chromosomes.

4. Materials and Methods

4.1. Plant Materials

Wheat-Th. ponticum partial amphiploids Xiaoyan 68 and Xaioyan 7430, hexaploid Trititrigia 8802, and wheat-Th. intermedium partial amphiploid Zhong 3 were kindly provided by Professor Fangpu Han, Institute of Genetics and Developmental Biology, Chinese Academy of Science, Beijing, China. The 8802 contains chromosomes of Th. elongatum [28].

4.2. Cytological Analysis

Root-tip metaphase chromosomes were prepared following the methods described by Han et al. [30]. Oligo-pSc119.2-1 and Oligo-pTa535-1 were also used in this study [31]. Oligo-B11, Oligo-pThp3.93, Oligo-pSc119.2-1, and Oligo-pTa535-1 probes were synthesized by Tsingke Biological Technology Co. Ltd. (Beijing, China). Both the Oligo-B11 and Oligo-pThp3.93 probes were 5′-end-labelled with 6-carboxyfluorescein (6-FAM), the Oligo-pTa535-1 probe was 5′-end-labeled with 6-carboxytetramethylrhodamine (TAMRA), and the Oligo-pSc119.2-1 probe was 5′-end-labeled with Cyanine Dye 5 (Cy5). The synthesized oligo probes were diluted by 1 × TE solution (pH 7.0). For Oligo-pSc119.2-1 and Oligo-pTa535-1, probe dilution and the probe amounts per slide were carried out according to the methods described by Tang et al. [31]. For Oligo-B11 and Oligo-pThp3.93, 100 μL 1 × TE was used to dissolve each 1OD probe. Then, the original solution was diluted five times and were used as the working solutions. Two × SSC and 1 × TE buffers (pH 7.0) were mixed as a 1:1 (volume) ratio. The target probes were added into the 2 × SSC + 1 × TE buffer and uniformly mixed. For each slide, 10 μL of probe mixture was used. When the probe mixture was dropped onto the cell spreads, the room temperature around the slide were kept at above 28 °C, then the slides were covered with glass coverslips and immediately put in a moist box that was incubated at 42 °C in advance, and then stored in the moist box at 42 °C for 1–2 h. After incubation, the slides were washed for 15–20 s in 2 × SSC at 42 °C. When the slide washing was completed, the slides were dried with a rubber suction bulb, and the slides were mounted with Vectashield mounting medium (Vector Laboratories, Burlingame, CA, USA) with DAPI (4′,6-diamidino-2-phenylindole). An epifluorescence microscope (BX51, Olympus Corporation, Tokyo, Japan) equipped with a cooled charge-coupled device camera operated with HCIMAGE Live software (Hamamatsu Corporation, Sewickley, PA, USA) was used to take images.

5. Conclusions

In conclusion, the Oligo-B11 and Oligo-pThp3.93 probes combined with the ND-FISH assay can replace GISH and FISH to conveniently discriminate the Th. elongatum, Th. Intermedium, and Th. ponticum chromosomes in Xiaoyan 68, 8802, Xaioyan 7430, and Zhong 3 from wheat chromosomes. Therefore, the two oligo probes provide a convenient way for the utilization of Thinopyrum germplasms in Xiaoyan 68, 8802, Xaioyan 7430, and Zhong 3 in future wheat breeding programs.

Author Contributions

S.F. and Z.T. designed the study and the oligo probes, analyzed the data, and wrote the manuscript. W.X., S.T., and J.L. performed the experiments. Z.Y. analyzed the data.

Acknowledgments

This project was supported by the National Key Research and Development Program of China (No. 2016YFD0102001) and the “13th Five-Year” Crops, Livestock and Poultry Breeding Program of Sichuan Province (No. 2016NY0030).

Conflicts of Interest

These authors have no conflicts of interest. The funding sponsors had no role in the experiment design, material creation, data analysis, manuscript writing and the decision to publish the results.

References

  1. Han, F.; Liu, B.; Fedak, G.; Liu, Z. Genomic constitution and variation in five partial amphiploids of wheat–Thinopyrum intermedium as revealed by GISH, multicolor GISH and seed storage protein analysis. Theor. Appl. Genet. 2004, 109, 1070–1076. [Google Scholar] [CrossRef] [Scilit]
  2. Fu, S.; Lv, Z.; Qi, B.; Guo, X.; Li, J.; Liu, B.; Han, F. Molecular cytogenetic characterization of wheat-Thinopyrum elongatum addition, substitution and translocation lines with a novel source of resistance to wheat Fusarium Head Blight. J. Genet. Genomics 2012, 39, 103–110. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Yao, H.; Tang, C.G.; Zhao, J.; Zheng, Q.; Li, B.; Hao, C.Y.; Li, Z.S.; Zhang, X.Y. Isolation of Thinopyrum ponticum genome specific repetitive sequences and their application for effective detection of alien segments in wheat. Sci. Agric. Sin. 2016, 49, 3683–3693. [Google Scholar]
  4. Li, J.; Lang, T.; Li, B.; Yu, Z.; Wang, H.; Li, G.; Yang, E.; Yang, Z. Introduction of Thinopyrum intermedium ssp. trichophorum chromosomes to wheat by trigeneric hybridization involving Triticum, Secale and Thinopyrum genera. Planta 2017, 245, 1121–1135. [Google Scholar] [CrossRef] [Scilit]
  5. Lang, T.; La, S.; Li, B.; Yu, Z.; Chen, Q.; Li, J.; Yang, E.; Li, G.; Yang, Z. Precise identification of wheat-Thinopyrum intermedium translocation chromosomes carrying resistance to wheat stripe rust in line Z4 and its derived progenies. Genome 2018, 61, 177–185. [Google Scholar] [CrossRef] [Scilit]
  6. Liu, L.; Luo, Q.; Teng, W.; Li, B.; Li, H.; Li, Y.; Li, Z.; Zheng, Q. Development of Thinopyrum ponticum-specific molecular markers and FISH probes based on SLAF-seq technology. Planta 2018, 247, 1099–1108. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  7. Li, D.; Li, T.; Wu, Y.; Zhang, X.; Zhu, W.; Wang, Y.; Zeng, J.; Xu, L.; Fan, X.; Sha, L.; et al. FISH-based markers enable identification of chromosomes derived from tetraploid Thinopyrum elongatum in hybrid lines. Front. Plant Sci. 2018, 9, 526. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Mago, R.; Zhang, P.; Xia, X.; Zhang, J.; Hoxha, S.; Lagudah, E.; Graner, A.; Dundas, I. Transfer of stem rust resistance gene SrB from Thinopyrum ponticum into wheat and development of a closely linked PCR-based marker. Theor. Appl. Genet. 2019, 132, 371–382. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  9. Du, W.; Wang, J.; Lu, M.; Sun, S.; Chen, X.; Zhao, J.; Yang, Q.; Wu, J. Characterization of a wheat-Psathyrostachys huashanica Keng 4Ns disomic addition line for enhanced tiller numbers and stripe rust resistance. Planta 2014, 239, 97–105. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Fu, S.; Chen, L.; Wang, Y.; Li, M.; Yang, Z.; Qiu, L.; Yan, B.; Ren, Z.; Tang, Z. Oligonucleotide probes for ND-FISH analysis to identify rye and wheat chromosomes. Sci. Rep. 2015, 5, 10552. [Google Scholar] [CrossRef] [Scilit]
  11. Xiao, Z.; Tang, S.; Qiu, L.; Tang, Z.; Fu, S. Oligonucleotides and ND-FISH displaying different arrangements of tandem repeats and identification of Dasypyrum villosum chromosomes in wheat backgrounds. Molecules 2017, 22, 973. [Google Scholar] [CrossRef] [Scilit]
  12. Cuadrado, Á.; Golczyk, H.; Jouve, N. A novel, simple and rapid nondenaturing FISH (ND-FISH) technique for the detection of plant telomeres. Potential used and possible target structures detected. Chromosome Res. 2009, 1, 755–762. [Google Scholar] [CrossRef] [Scilit]
  13. Cuadrado, Á.; Jouve, N. Chromosomal detection of simple sequence repeats (SSRs) using nondenaturing FISH (ND-FISH). Chromosoma 2010, 119, 495–503. [Google Scholar] [CrossRef] [Scilit]
  14. Cuadrado, Á.; Carmona, A.; Jouve, N. Chromosomal characterization of the three subgenomes in the polyploids of Hordeum murinum L.: New insight into the evolution of this complex. PLoS ONE 2013, 8, e81385. [Google Scholar] [CrossRef] [Scilit]
  15. Carmona, A.; Friero, E.; Bustos, A.D.; Jouve, N.; Cuadrado, A. Cytogenetic diversity of SSR motifs within and between Hordeum species carrying the H genome: H. vulgare L. and H. bulbosum L. Theor. Appl. Genet. 2013, 126, 949–961. [Google Scholar] [CrossRef] [Scilit]
  16. Cabo, S.; Carvalho, A.; Martin, A.; Lima-Brito, J. Structural rearrangements detected in newly-formed hexaploid tritordeum after three sequential FISH experiments with repetitive DNA sequences. J. Genet. 2014, 93, 183–188. [Google Scholar] [CrossRef] [Scilit]
  17. Delgado, A.; Carvalh, A.; Martín, A.C.; Martín, A.; Lima-Brito, J. Use of the synthetic Oligo-pTa535 and Oligo-pAs1 probes for identification of Hordeum chilense-origin chromosomes in hexaploid tritordeum. Genet. Resour. Crop Evol. 2016, 63, 945–951. [Google Scholar] [CrossRef] [Scilit]
  18. Li, G.; Wang, H.; Lang, T.; Li, J.; La, S.; Yang, E.; Yang, Z. New molecular markers and cytogenetic probes enable chromosome identification of wheat-Thinopyrum intermedium introgression lines for improving protein and gluten contents. Planta 2016, 244, 865–876. [Google Scholar] [CrossRef] [Scilit]
  19. Delgado, A.; Carvalho, A.; Martín, A.C.; Martín, A.; Lima-Brito, J. Genomic reshuffling in advanced lines of hexaploid tritordeum. Gene. Resour. Crop Evol. 2017, 64, 1331–1353. [Google Scholar] [CrossRef] [Scilit]
  20. Jiang, M.; Xiao, Z.Q.; Fu, S.L.; Tang, Z.X. FISH karyotype of 85 common wheat cultivars/lines displayed by ND-FISH using oligonucleotide probes. Cereal Res. Commun. 2017, 45, 549–563. [Google Scholar] [CrossRef] [Scilit]
  21. Duan, Q.; Wang, Y.Y.; Qiu, L.; Ren, T.H.; Li, Z.; Fu, S.L.; Tang, Z. Physical location of new PCR-based markers and powdery mildew resistance gene(s) on rye (Secale cereale L.) chromosome 4 using 4R dissection lines. Front. Plant Sci. 2017, 8, 1716. [Google Scholar] [CrossRef] [Scilit]
  22. Du, P.; Zhuang, L.; Wang, Y.; Yuan, L.; Wang, Q.; Wan, D.; Dawadondup; Tan, L.; Shen, J.; Xu, H.; Zhao, H.; et al. Development of oligonucleotides and multiplex probes for quick and accurate identitication of wheat and Thinopyrum bessarabicum chromosomes. Genome 2017, 60, 93–103. [Google Scholar] [CrossRef] [Scilit]
  23. Tang, S.; Tang, Z.; Qiu, L.; Yang, Z.; Li, G.; Lang, T.; Zhu, W.; Zhang, J.; Fu, S. Developing new oligo probes to distinguish specific chromosomal segments and the A, B, D genomes of wheat (Triticum aestivum L.) using ND-FISH. Front. Plant Sci. 2018, 9, 1104. [Google Scholar] [CrossRef] [Scilit]
  24. Ren, T.; He, M.; Sun, Z.; Tan, F.; Luo, P.; Tang, Z.; Fu, S.; Yan, B.; Ren, Z.; Li, Z. The polymorphisms of oligonucleotide probes in wheat cultivars determined by ND-FISH. Molecules 2019, 24, 1126. [Google Scholar] [CrossRef] [Scilit]
  25. Lang, T.; Li, G.; Wang, H.; Yu, Z.; Chen, Q.; Yang, E.; Fu, S.; Tang, Z.; Yang, Z. Physical location of tandem repeats in the wheat genome and application for chromosome identification. Planta 2019, 249, 663–675. [Google Scholar] [CrossRef] [Scilit]
  26. Du, H.; Tang, Z.; Duan, Q.; Tang, S.; Fu, S. Using the 6RLKu minichromosome of rye (Secale cereale L.) to create wheat-rye 6D/6RLKu small segment translocation lines with powdery mildew resistance. Int. J. Mol. Sci. 2018, 19, E3933. [Google Scholar] [CrossRef] [Scilit]
  27. Nie, L.; Yang, Y.; Zhang, J.; Fu, T. Disomic chromosome addition from Thinopyrum intermedium to bread wheat appears to confer stripe rust resistance. Euphytica 2019, 215, 56. [Google Scholar] [CrossRef] [Scilit]
  28. Guo, X.; Shi, Q.; Wang, J.; Hou, Y.; Wang, Y.; Han, F. Characterization and genome changes of new amphiploids from wheat wide hybridization. J. Genet. Genomics 2015, 42, 459–461. [Google Scholar] [CrossRef] [Scilit]
  29. He, F.; Wang, Y.; Bao, Y.; Ma, Y.; Wang, X.; Li, X.; Wang, H. Chromosomal constitutions of five wheat–Elytrigia elongata partial amphiploids as revealed by GISH, multicolor GISH and FISH. Comp. Cytogenet. 2017, 11, 525–540. [Google Scholar] [CrossRef] [Scilit]
  30. Han, F.; Lamb, J.C.; Birchler, A. High frequency of centromere inactivation resulting in stable dicentric chromosomes of maize. Proc. Natl. Acad. Sci. USA 2006, 103, 3238–3243. [Google Scholar] [CrossRef] [Scilit]
  31. Tang, Z.; Yang, Z.; Fu, S. Oligonucleotides replacing the roles of repetitive sequences pAs1, pSc119.2, pTa-535, pTa71, CCS1, and pAWRC.1 for FISH analysis. J. Appl. Genet. 2014, 55, 313–318. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. ND-FISH analysis of root tip metaphase chromosomes of Xiaoyan 68 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red), and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. ponticum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Triangles indicate the wheat-Th. ponticum translocation chromosomes TTh-4DS·4DL. Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Figure 1. ND-FISH analysis of root tip metaphase chromosomes of Xiaoyan 68 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red), and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. ponticum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Triangles indicate the wheat-Th. ponticum translocation chromosomes TTh-4DS·4DL. Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Ijms 20 02031 g001
Figure 2. ND-FISH analysis of the root tip metaphase chromosomes of 8802 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. elongatum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Figure 2. ND-FISH analysis of the root tip metaphase chromosomes of 8802 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. elongatum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Ijms 20 02031 g002
Figure 3. ND-FISH analysis of the root tip metaphase chromosomes of Xiaoyan 7430 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. ponticum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Figure 3. ND-FISH analysis of the root tip metaphase chromosomes of Xiaoyan 7430 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. ponticum chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Ijms 20 02031 g003
Figure 4. ND-FISH analysis of the root tip metaphase chromosomes of Zhong 3 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. intermedium chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Figure 4. ND-FISH analysis of the root tip metaphase chromosomes of Zhong 3 using the Oligo-B11 (green), Oligo-pThp3.93 (green), Oligo-pTa535-1 (red) and Oligo-pSc119.2-1 (green) as probes. (A) and (B) are the same cell, and (C) and (D) are the same cell. Arrows indicate the Th. intermedium chromosomes that carry signals of Oligo-B11 (A) and Oligo-pThp3.93 (C). Chromosomes were counterstained with DAPI (blue). Scale bar: 10 μm.
Ijms 20 02031 g004
Table 1. Oligonucleotide sequences of new oligo probes developed in this study.
Table 1. Oligonucleotide sequences of new oligo probes developed in this study.
ProbeAmount for Each Slide (ng/slide)Oligonucleotide Sequence (5′-3′)
Oligo-B1172.5–96.6TCCGCTCACCTTGATGACAACATCAGGTGGAATTCCGTTCGAGGG
Oligo-pThp3.9369.5–92.6GGACTCCCACTAGATGTATCCGTCAAGGTGAATCCAGAGGAATCACCCTCGATGGCATT

Share and Cite

MDPI and ACS Style

Xi, W.; Tang, Z.; Tang, S.; Yang, Z.; Luo, J.; Fu, S. New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds. Int. J. Mol. Sci. 2019, 20, 2031. https://doi.org/10.3390/ijms20082031

AMA Style

Xi W, Tang Z, Tang S, Yang Z, Luo J, Fu S. New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds. International Journal of Molecular Sciences. 2019; 20(8):2031. https://doi.org/10.3390/ijms20082031

Chicago/Turabian Style

Xi, Wei, Zongxiang Tang, Shuyao Tang, Zujun Yang, Jie Luo, and Shulan Fu. 2019. "New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds" International Journal of Molecular Sciences 20, no. 8: 2031. https://doi.org/10.3390/ijms20082031

APA Style

Xi, W., Tang, Z., Tang, S., Yang, Z., Luo, J., & Fu, S. (2019). New ND-FISH-Positive Oligo Probes for Identifying Thinopyrum Chromosomes in Wheat Backgrounds. International Journal of Molecular Sciences, 20(8), 2031. https://doi.org/10.3390/ijms20082031

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop