Liver Sinusoidal Endothelial Cells Promote the Expansion of Human Cord Blood Hematopoietic Stem and Progenitor Cells
Abstract
:1. Introduction
2. Results
2.1. Establishment and Identification of hFLSEC-E4orf1 Feeders
2.2. Coculture of hFLSECs-E4orf1 Enhanced the Ex Vivo Expansion of HSPCs While Retaining HSC Pool Size
2.3. Coculture with hFLSECs-E4orf1 Heightened the Multilineage Differentiation Potential of HSPCs In Vitro and the Amplified Cells Engrafted in NSG Mice
2.4. hFLSECs-E4orf1 Express Growth Factors and Signaling Molecules that Support HSC Expansion
3. Discussion
4. Materials and Methods
4.1. Cell Isolation and Culture
4.2. Retrovirus Transduction
4.3. qRT-PCR Analysis
4.4. Immunofluorescent Staining
4.5. Flow Cytometry
4.6. Tube Formation Assay
4.7. Ex Vivo Expansion
4.8. In Vivo Transplantation
4.9. Giemsa Staining
4.10. Cell Cycle Analysis
4.11. Hematopoietic CFU Assays
4.12. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Stanevsky, A.; Goldstein, G.; Nagler, A. Umbilical cord blood transplantation: Pros, cons and beyond. Blood Rev. 2009, 23, 199–204. [Google Scholar] [CrossRef] [PubMed]
- Zon, L.I. Intrinsic and extrinsic control of haematopoietic stem-cell self-renewal. Nature 2008, 453, 306–313. [Google Scholar] [CrossRef] [PubMed]
- Kaur, S.; Raggatt, L.J.; Millard, S.M.; Wu, A.C.; Batoon, L.; Jacobsen, R.N.; Winkler, I.G.; MacDonald, K.P.; Perkins, A.C.; Hume, D.A.; et al. Self-repopulating recipient bone marrow resident macrophages promote long-term hematopoietic stem cell engraftment. Blood 2018, 132, 735–749. [Google Scholar] [CrossRef] [PubMed]
- Qu, Q.; Liu, L.; Chen, G.; Xu, Y.; Wu, X.; Wu, D. Endothelial progenitor cells promote efficient ex vivo expansion of cord blood-derived hematopoietic stem/progenitor cells. Cytotherapy 2016, 18, 452–464. [Google Scholar] [CrossRef]
- Raynaud, C.M.; Butler, J.M.; Halabi, N.M.; Ahmad, F.S.; Ahmed, B.; Rafii, S.; Rafii, A. Endothelial cells provide a niche for placental hematopoietic stem/progenitor cell expansion through broad transcriptomic modification. Stem Cell Res. 2013, 11, 1074–1090. [Google Scholar] [CrossRef] [Green Version]
- Boitano, A.E.; Wang, J.; Romeo, R.; Bouchez, L.C.; Parker, A.E.; Sutton, S.E.; Walker, J.R.; Flaveny, C.A.; Perdew, G.H.; Denison, M.S.; et al. Aryl hydrocarbon receptor antagonists promote the expansion of human hematopoietic stem cells. Science 2010, 329, 1345–1348. [Google Scholar] [CrossRef] [PubMed]
- Fares, I.; Chagraoui, J.; Gareau, Y.; Gingras, S.; Ruel, R.; Mayotte, N.; Csaszar, E.; Knapp, D.J.; Miller, P.; Ngom, M.; et al. Pyrimidoindole derivatives are agonists of human hematopoietic stem cell self-renewal. Science 2014, 345, 1509–1512. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ke, Z.; Wei-Wei, Z.; Xiao-Ming, D.; Rong-Hua, Y.; Rui, G.; Xiu, L.; Jin-Fang, L.; Yi-Qun, Z.; Miao, Y.; Hui, C.; et al. EDAG promotes the expansion and survival of human CD34+ cells. PLoS ONE 2018, 13, e0190794. [Google Scholar]
- Peled, T.; Shoham, H.; Aschengrau, D.; Yackoubov, D.; Frei, G.; Rosenheimer, N.; Lerrer, B.; Cohen, H.Y.; Nagler, A.; Fibach, E.; et al. Nicotinamide, a SIRT1 inhibitor, inhibits differentiation and facilitates expansion of hematopoietic progenitor cells with enhanced bone marrow homing and engraftment. Exp. Hematol. 2012, 40, 342–355. [Google Scholar] [CrossRef]
- Delaney, C.; Heimfeld, S.; Brashem-Stein, C.; Voorhies, H.; Manger, R.L.; Bernstein, I.D. Notch-mediated expansion of human cord blood progenitor cells capable of rapid myeloid reconstitution. Nat. Med. 2010, 16, 232–236. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Antonchuk, J.; Sauvageau, G.; Humphries, R.K. HOXB4-Induced expansion of adult hematopoi- etic stem cell ex vivo. Cell 2002, 109, 39–45. [Google Scholar] [CrossRef]
- Perry, J.M.; He, X.C.; Sugimura, R.; Grindley, J.C.; Haug, J.S.; Ding, S.; Li, L. Cooperation between both Wnt/b-catenin and PTEN/PI3K/Akt signaling promotes primitive hematopoietic stem cell self-renewal and expansion. Genes Dev. 2011, 25, 1928–1942. [Google Scholar] [CrossRef]
- Chagraoui, J.; Lepage-Noll, A.; Anjo, A.; Uzan, G.; Charbord, P. Fetal liver stroma consists of cells in epithelial-to-mesenchymal transition. Blood 2003, 101, 2973–2982. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ema, H.; Nakauchi, H. Expansion of hematopoietic stem cells in the developing liver of a mouse embryo. Blood 2000, 95, 2284–2288. [Google Scholar] [PubMed]
- Méndez-Ferrer, S.; Michurina, T.V.; Ferraro, F.; Mazloom, A.R.; Macarthur, B.D.; Lira, S.A.; Scadden, D.T.; Ma’ayan, A.; Enikolopov, G.N.; Frenette, P.S. Mesenchymal and haematopoietic stem cells form a unique bone marrow niche. Nature 2010, 466, 829–834. [Google Scholar] [CrossRef] [Green Version]
- Greenbaum, A.; Hsu, Y.M.; Day, R.B.; Schuettpelz, L.G.; Christopher, M.J.; Borgerding, J.N.; Nagasawa, T.; Link, D.C. CXCL12 in early mesenchymal progenitors is required for haematopoietic stem-cell maintenance. Nature 2013, 495, 227–230. [Google Scholar] [CrossRef] [PubMed]
- Ding, L.; Saunders, T.L.; Enikolopov, G.; Morrison, S.J. Endothelial and perivascular cells maintain haematopoietic stem cells. Nature 2012, 481, 457–462. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kunisaki, Y.; Bruns, I.; Scheiermann, C.; Ahmed, J.; Pinho, S.; Zhang, D.; Mizoguchi, T.; Wei, Q.; Lucas, D.; Ito, K.; et al. Arteriolar niches maintain haematopoietic stem cell quiescence. Nature 2013, 502, 637–643. [Google Scholar] [CrossRef] [Green Version]
- Zhao, M.; Perry, J.M.; Marshall, H.; Venkatraman, A.; Qian, P.; He, X.C.; Ahamed, J.; Li, L. Megakaryocytes maintain homeostatic quiescence and promote post-injury regeneration of hematopoietic stem cells. Nat. Med. 2014, 20, 1321–1326. [Google Scholar] [CrossRef]
- Sugimura, R. Bioengineering hematopoietic stem cell niche toward regenerative medicine. Adv. Drug Deliv. Rev. 2016, 99, 212–220. [Google Scholar] [CrossRef]
- Christensen, J.L.; Wright, D.E.; Wagers, A.J.; Weissman, I.L. Circulation and chemotaxis of fetal hematopoietic stem cells. PLoS Biol. 2004, 2, E75. [Google Scholar] [CrossRef]
- Fukushima, N.; Ohkawa, H. Hematopoietic stem cells and microenvironment: The proliferation and differentiation of stromal cells. Crit. Rev. Oncol. Hematol. 1995, 20, 255–270. [Google Scholar] [CrossRef]
- Lux, C.T.; Yoshimoto, M.; McGrath, K.; Conway, S.J.; Palis, J.; Yoder, M.C. All primitive and definitive hematopoietic progenitor cells emerging before E10 in the mouse embryo are products of the yolk sac. Blood 2008, 111, 3435–3438. [Google Scholar] [CrossRef] [Green Version]
- Zovein, A.C.; Hofmann, J.J.; Lynch, M.; French, W.J.; Turlo, K.A.; Yang, Y.; Becker, M.S.; Zanetta, L.; Dejana, E.; Gasson, J.C.; et al. Fate tracing reveals the endothelial origin of hematopoietic stem cells. Cell Stem Cell 2008, 3, 625–636. [Google Scholar] [CrossRef] [Green Version]
- Bale, S.S.; Golberg, I.; Jindal, R.; McCarty, W.J.; Luitje, M.; Hegde, M.; Bhushan, A.; Usta, O.B.; Yarmush, M.L. Long-Term Coculture Strategies for Primary Hepatocytes and Liver Sinusoidal Endothelial Cells. Tissue Eng. Part C Methods 2015, 21, 413–422. [Google Scholar] [CrossRef]
- Cardier, J.E.; Barberá-Guillem, E. Extramedullary hematopoiesis in the adult mouse liver is associated with specific hepatic sinusoidal endothelial cells. Hepatology 1997, 26, 165–175. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fomin, M.E.; Beyer, A.I.; Muench, M.O. Human fetal liver cultures support multiple cell lineages that can engraft immunodeficient mice. Open Biol. 2017, 7, 170108. [Google Scholar] [CrossRef] [Green Version]
- Ding, B.S.; Nolan, D.J.; Butler, J.M.; James, D.; Babazadeh, A.O.; Rosenwaks, Z.; Mittal, V.; Kobayashi, H.; Shido, K.; Lyden, D.; et al. Inductive angiocrine signals from sinusoidal endothelium are required for liver regeneration. Nature 2010, 468, 310–315. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seandel, M.; Butler, J.M.; Kobayashi, H.; Hooper, A.T.; White, I.A.; Zhang, F.; Vertes, E.L.; Kobayashi, M.; Zhang, Y.; Shmelkov, S.V.; et al. Generation of a functional and durable vascular niche by the adenoviral E4ORF1 gene. Proc. Natl. Acad. Sci. USA 2008, 105, 19288–19293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Onoe, T.; Ohdan, H.; Tokita, D.; Shishida, M.; Tanaka, Y.; Hara, H.; Zhou, W.; Ishiyama, K.; Mitsuta, H.; Ide, K.; et al. Liver sinusoidal endothelial cells tolerize T cells across MHC barriers in mice. J. Immunol. 2005, 175, 139–146. [Google Scholar] [CrossRef]
- Zhang, C.C.; Kaba, M.; Ge, G.; Xie, K.; Tong, W.; Hug, C.; Lodish, H.F. Angiopoietin-like proteins stimulate ex vivo expansion of hematopoietic stem cells. Nat. Med. 2006, 12, 240–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hayashi, N.; Takahashi, K.; Abe, Y.; Kashiwakura, I. Placental/ umbilical cord blood-derived mesenchymal stem cell-like stromal cells support hematopoietic recovery of X-irradiated human CD34 + cells. Life Sci. 2009, 84, 598–605. [Google Scholar] [CrossRef] [PubMed]
- Moore, K.A.; Pytowski, B.; Witte, L.; Hicklin, D.; Lemischka, I.R. Hematopoietic activity of a stromal cell transmembrane protein containing epidermal growth factor-like repeat motifs. Proc. Natl. Acad. Sci. USA 1997, 94, 4011–4016. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chou, S.; Lodish, H.F. Fetal liver hepatic progenitors are supportive stromal cells for hematopoietic stem cells. Proc. Natl. Acad. Sci. USA 2010, 107, 7799–7804. [Google Scholar] [CrossRef] [Green Version]
- Khan, J.A.; Mendelson, A.; Kunisaki, Y.; Birbrair, A.; Kou, Y.; Arnal-Estapé, A.; Pinho, S.; Ciero, P.; Nakahara, F.; Ma’ayan, A.; et al. Fetal liver hematopoietic stem cell niches associate with portal vessels. Science 2016, 351, 176–180. [Google Scholar] [CrossRef] [PubMed]
- Kadereit, S.; Deeds, L.S.; Haynesworth, S.E.; Koc, O.N.; Kozik, M.M.; Szekely, E.; Daum-Woods, K.; Goetchius, G.W.; Fu, P.; Welniak, L.A.; et al. Expansion of LTC-ICs and maintenance of p21 and BCL-2 expression in cord bloodCD34(+)/CD38(-) early progenitors cultured over human MSCs as a feeder layer. Stem Cells 2002, 20, 573–582. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.F.; Wang, L.J.; Wu, Y.F.; Xiang, Y.; Xie, C.G.; Jia, B.B.; Harrington, J.; McNiece, I.K. Mesenchymal stem/progenitor cells in human umbilical cord blood as support for ex vivo expansion of CD34(+) hematopoietic stem cells and for chondrogenic differentiation. Haematologica 2004, 89, 837–844. [Google Scholar] [PubMed]
- De Lima, M.; McNiece, I.; Robinson, S.N.; Munsell, M.; Eapen, M.; Horowitz, M.; Alousi, A.; Saliba, R.; McMannis, J.D.; Kaur, I.; et al. Cord-blood engraftment with ex vivo mesenchymal-cell coculture. New Eng. J. Med. 2012, 367, 2305–2315. [Google Scholar] [CrossRef] [PubMed]
- Nishioka, K.; Fujimori, Y.; Hashimoto-Tamaoki, T.; Kai, S.; Qiu, H.; Kobayashi, N.; Tanaka, N.; Westerman, K.A.; Leboulch, P.; Hara, H. Immortalization of bone marrow-derived human mesenchymal stem cells by removable simian virus 40T antigen gene: Analysis of the ability to support expansion of cord blood hematopoietic progenitor cells. Int. J. Oncol. 2003, 23, 925–932. [Google Scholar] [CrossRef] [PubMed]
- Walenda, T.; Bork, S.; Horn, P.; Wein, F.; Saffrich, R.; Diehlmann, A.; Eckstein, V.; Ho, A.D.; Wagner, W. Co-culture with mesenchymal stromal cells increases proliferation and maintenance of haematopoietic progenitor cells. J. Cell. Mol 2010, 14, 337–350. [Google Scholar] [CrossRef] [PubMed]
- Doulatov, S.; Notta, F.; Laurenti, E.; Dick, J.E. Hematopoiesis: A Human Perspective. Cell Stem Cell 2012, 10, 120–136. [Google Scholar] [CrossRef] [Green Version]
- Norkin, M.; Lazarus, H.M.; Wingard, J.R. Umbilical cord blood graft enhancement strategies: Has the time come to move these into the clinic? Bone Marrow Transpl. 2013, 48, 884–889. [Google Scholar] [CrossRef] [PubMed]
- Cao, N.; Liao, T.; Liu, J.; Fan, Z.; Zeng, Q.; Zhou, J.; Pei, H.; Xi, J.; He, L.; Chen, L.; et al. Clinical-Grade Human Umbilical Cord-Derived Mesenchymal Stem Cells Reverse Cognitive Aging via Improving Synaptic Plasticity and Endogenous Neurogenesis. Cell Death Dis. 2017, 8, e2996. [Google Scholar] [CrossRef] [PubMed]
- Raynaud, C.M.; Maleki, M.; Lis, R.; Ahmed, B.; Al-Azwani, I.; Malek, J.; Rafii, A. Comprehensive characterization of mesenchymal stem cells from human placenta and fetal membrane and their response to osteoactivin stimulation. Stem Cells Int. 2012, 2012, 658356. [Google Scholar] [CrossRef] [PubMed]
- Liu, X.; Qi, J.; Xu, X.; Zeisberg, M.; Guan, K.; Zeisberg, E.M. Differentiation of functional endothelial cells from human induced pluripotent stem cells: A novel, highly efficient and cost effective method. Differentiation 2016, 92, 225–236. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′-3′) |
---|---|
E4orf1-S | CGCCGGAATTAGATCTGCCA |
E4orf1-AS | CTCGAGCAGCGTAATCTGGA |
Angptl1-S | AGAAAGGAAAGCCGTAACATGAA |
Angptl1-AS | TCCCTGTATCTTGTTGCCATCT |
Angptl2-S | GAACCGAGTGCATAAGCAGGA |
Angptl2-AS | GTGACCCGCGAGTTCATGTT |
Angptl3-S | CATCTAGTTGCGATTACTGGCA |
Angptl3-AS | CCTCCTGAATAACCCTCTGGA |
Angptl4-S | GGCTCAGTGGACTTCAACCG |
Angptl4-AS | CCGTGATGCTATGCACCTTCT |
Angptl5-S | AAAATGCAATGCCTTTTAGCACA |
Angptl5-AS | GGTCTTGTTATGGAGGTGACTG |
Angptl6-S | CCGTCACGTAGTGTCAGTATGG |
Angptl6-AS | GCTGCCAGGTAGTGAAGAAGTT |
Igf2-S | GTGGCATCGTTGAGGAGTG |
Igf2-AS | CACGTCCCTCTCGGACTTG |
Dll1-S | GACGAACACTACTACGGAGAGG |
Dll1-AS | AGCCAGGGTTGCACACTTT |
Dll4-S | TGGGTCAGAACTGGTTATTGGA |
Dll4-AS | GTCATTGCGCTTCTTGCACAG |
Notch1-S | GAGGCGTGGCAGACTATGC |
Notch1-AS | CTTGTACTCCGTCAGCGTGA |
Notch2-S | CAACCGCAATGGAGGCTATG |
Notch2-AS | GCGAAGGCACAATCATCAATGTT |
Notch3-S | CGTGGCTACACTGGACCTC |
Notch3-AS | AGATACAGGTGAACTGGCCTAT |
Jag1-S | GTCCATGCAGAACGTGAACG |
Jag1-AS | GCGGGACTGATACTCCTTGA |
Hes1-S | TCAACACGACACCGGATAAAC |
Hes1-AS | GCCGCGAGCTATCTTTCTTCA |
Runx1-S | ATGTGGTCCTATTTAAGCCAGCCC |
Runx1-AS | TCATCTGGCTGAAGACACCAGCTT |
GAPDH-S | GAGTCAACGGATTTGGTCGT |
GAPDH-AS | TTGATTTTGGAGGGATCTCG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, H.; Pei, H.; Xie, X.; Wang, S.; Jia, Y.; Zhang, B.; Fan, Z.; Liu, Y.; Bai, Y.; Han, Y.; et al. Liver Sinusoidal Endothelial Cells Promote the Expansion of Human Cord Blood Hematopoietic Stem and Progenitor Cells. Int. J. Mol. Sci. 2019, 20, 1985. https://doi.org/10.3390/ijms20081985
Li H, Pei H, Xie X, Wang S, Jia Y, Zhang B, Fan Z, Liu Y, Bai Y, Han Y, et al. Liver Sinusoidal Endothelial Cells Promote the Expansion of Human Cord Blood Hematopoietic Stem and Progenitor Cells. International Journal of Molecular Sciences. 2019; 20(8):1985. https://doi.org/10.3390/ijms20081985
Chicago/Turabian StyleLi, Huilin, Haiyun Pei, Xiaoyan Xie, Sihan Wang, Yali Jia, Bowen Zhang, Zeng Fan, Yiming Liu, Yun Bai, Yi Han, and et al. 2019. "Liver Sinusoidal Endothelial Cells Promote the Expansion of Human Cord Blood Hematopoietic Stem and Progenitor Cells" International Journal of Molecular Sciences 20, no. 8: 1985. https://doi.org/10.3390/ijms20081985
APA StyleLi, H., Pei, H., Xie, X., Wang, S., Jia, Y., Zhang, B., Fan, Z., Liu, Y., Bai, Y., Han, Y., He, L., Nan, X., Yue, W., & Pei, X. (2019). Liver Sinusoidal Endothelial Cells Promote the Expansion of Human Cord Blood Hematopoietic Stem and Progenitor Cells. International Journal of Molecular Sciences, 20(8), 1985. https://doi.org/10.3390/ijms20081985