The Peroxisome Proliferator-Activated Receptor α (PPARα) Agonist Pemafibrate Protects against Diet-Induced Obesity in Mice
Abstract
1. Introduction
2. Results
2.1. Pemafibrate Suppresses High-Fat Diet (HFD)-Induced Obesity in Mice
2.2. Pemafibrate and Fenofibrate Normalize HFD-Induced Glucose Intolerance and Insulin Resistance
2.3. Pemafibrate and Fenofibrate Activate PPARα-Mediated Gene Expression in the Liver and iWAT but Not eWAT or BAT of DIO Mice
2.4. Pemafibrate Ameliorates Obesity-Induced Abnormalities in Obese Mice
2.5. Pemafibrate Treatment Alters the Expression of Genes Related to Thermogenesis in iWAT and BAT of Mice Fed with Modest Fat (MF) Diet
2.6. Pemafibrate-Induced Gene Expression Partially Depends on FGF21
3. Discussion
4. Materials and Methods
4.1. Reagent
4.2. Animals
4.3. Metabolic Measurements
4.4. Histological Analysis
4.5. Analysis of Gene Expression
4.6. Statistical Analyses
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| Acox1 | acyl-CoA oxidase 1 |
| Adrb3 | adrenergic receptor, beta 3 |
| ALT | alanine aminotransferase |
| AST | aspartate aminotransferase |
| Atgl | adipose triglyceride lipase |
| BAT | brown adipose tissue |
| Cidea | cell death-inducing DFFA-like effector a |
| Cpt1a | carnitine palmitoyl transferase 1a |
| Cpt1b | carnitine palmitoyl transferase 1b |
| CREBH | cAMP-responsive element-binding protein H |
| DIO | diet-induced obesity |
| Elovl3 | ELOVL fatty acid elongase 3 |
| eWAT | epididymal white adipose tissue |
| FFA | Free fatty acid |
| FGF21 | fibroblast growth factor 21 |
| FGFR1 | FGF receptor 1 |
| OGTT | oral glucose tolerance test |
| HDL | high-density lipoprotein |
| HE | hematoxylin and eosin |
| HFD | high-fat diet |
| Hsl | hormone sensitive lipase |
| ITT | insulin tolerance test |
| iWAT | inguinal adipose tissue |
| KO | knockout |
| MF | modest fat |
| Ppargc1a | peroxisome proliferative-activated receptor, gamma, coactivator 1 alpha |
| PPARα | peroxisome proliferator-activated receptor α |
| PPRE | PPAR response element |
| Prdm16 | PR domain containing 16 |
| TC | total cholesterol |
| TG | triglyceride |
| UCP1 | uncoupling protein 1 |
| WT | wild type |
References
- Roberto, C.A.; Swinburn, B.; Hawkes, C.; Huang, T.T.; Costa, S.A.; Ashe, M.; Zwicker, L.; Cawley, J.H.; Brownell, K.D. Patchy progress on obesity prevention: Emerging examples, entrenched barriers and new thinking. Lancet 2015, 385, 2400–2409. [Google Scholar] [CrossRef] [Scilit]
- Goto, T.; Hirata, M.; Aoki, Y.; Iwase, M.; Takahashi, H.; Kim, M.; Li, Y.; Jheng, H.F.; Nomura, W.; Takahashi, N.; et al. The hepatokine FGF21 is crucial for peroxisome proliferator-activated receptor-α agonist-induced amelioration of metabolic disorders in obese mice. J. Biol. Chem. 2017, 292, 9175–9190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Diabetes Atherosclerosis Intervention Study Investigators. Effect of fenofibrate on progression of coronary-artery disease in type 2 diabetes: The Diabetes Atherosclerosis Intervention Study, a randomised study. Lancet 2001, 357, 905–910. [Google Scholar]
- Bloomfield Rubins, H.; Davenport, J.; Babikian, V.; Brass, L.M.; Collins, D.; Wexler, L.; Wagner, S.; Papademetriou, V.; Rutan, G.; Robins, S.J.; et al. Reduction in stroke with gemfibrozil in men with coronary heart disease and low HDL cholesterol: The Veterans Affairs HDL Intervention Trial (VA-HIT). Circulation 2001, 103, 2828–2833. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rubins, H.B.; Robins, S.J.; Collins, D.; Fye, C.L.; Anderson, J.W.; Elam, M.B.; Faas, F.H.; Linares, E.; Schaefer, E.J.; Schectman, G.; et al. Gemfibrozil for the secondary prevention of coronary heart disease in men with low levels of high-density lipoprotein cholesterol. Veterans Affairs High-Density Lipoprotein Cholesterol Intervention Trial Study Group. N. Engl. J. Med. 1999, 341, 410–418. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanne, D.; Koren-Morag, N.; Graff, E.; Goldbourt, U. Blood lipids and first-ever ischemic stroke/transient ischemic attack in the Bezafibrate Infarction Prevention (BIP) Registry: High triglycerides constitute an independent risk factor. Circulation 2001, 104, 2892–2897. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- BIP Study Group. Secondary prevention by raising HDL cholesterol and reducing triglycerides in patients with coronary artery disease. Circulation 2000, 102, 21–27. [Google Scholar]
- Rachid, T.L.; Penna-de-Carvalho, A.; Bringhenti, I.; Aguila, M.B.; Mandarim-de-Lacerda, C.A.; Souza-Mello, V. Fenofibrate (PPARα agonist) induces beige cell formation in subcutaneous white adipose tissue from diet-induced male obese mice. Mol. Cell. Endocrinol. 2015, 402, 86–94. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guerre-Millo, M.; Gervois, P.; Raspe, E.; Madsen, L.; Poulain, P.; Derudas, B.; Herbert, J.M.; Winegar, D.A.; Willson, T.M.; Fruchart, J.C.; et al. Peroxisome proliferator-activated receptor α activators improve insulin sensitivity and reduce adiposity. J. Biol. Chem. 2000, 275, 16638–16642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamamoto, Y.; Takei, K.; Arulmozhiraja, S.; Sladek, V.; Matsuo, N.; Han, S.I.; Matsuzaka, T.; Sekiya, M.; Tokiwa, T.; Shoji, M.; et al. Molecular association model of PPARα and its new specific and efficient ligand, pemafibrate: Structural basis for SPPARMα. Biochem. Biophys. Res. Commun. 2018, 499, 239–245. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raza-Iqbal, S.; Tanaka, T.; Anai, M.; Inagaki, T.; Matsumura, Y.; Ikeda, K.; Taguchi, A.; Gonzalez, F.J.; Sakai, J.; Kodama, T. Transcriptome Analysis of K-877 (a novel selective PPARα modulator (SPPARMα))-regulated genes in primary human hepatocytes and the mouse liver. J. Atheroscler. Thromb. 2015, 22, 754–772. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fruchart, J.C. Selective peroxisome proliferator-activated receptor α modulators (SPPARMalpha): The next generation of peroxisome proliferator-activated receptor alpha-agonists. Cardiovasc. Diabetol. 2013, 12, 82. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamazaki, Y.; Abe, K.; Toma, T.; Nishikawa, M.; Ozawa, H.; Okuda, A.; Araki, T.; Oda, S.; Inoue, K.; Shibuya, K.; et al. Design and synthesis of highly potent and selective human peroxisome proliferator-activated receptor alpha agonists. Bioorg. Med. Chem. Lett. 2007, 17, 4689–4693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Inagaki, T.; Dutchak, P.; Zhao, G.; Ding, X.; Gautron, L.; Parameswara, V.; Li, Y.; Goetz, R.; Mohammadi, M.; Esser, V.; et al. Endocrine regulation of the fasting response by PPARalpha-mediated induction of fibroblast growth factor 21. Cell Metab. 2007, 5, 415–425. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Badman, M.K.; Pissios, P.; Kennedy, A.R.; Koukos, G.; Flier, J.S.; Maratos-Flier, E. Hepatic fibroblast growth factor 21 is regulated by PPARα and is a key mediator of hepatic lipid metabolism in ketotic states. Cell Metab. 2007, 5, 426–437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakagawa, Y.; Satoh, A.; Yabe, S.; Furusawa, M.; Tokushige, N.; Tezuka, H.; Mikami, M.; Iwata, W.; Shingyouchi, A.; Matsuzaka, T.; et al. Hepatic CREB3L3 Controls Whole-Body Energy Homeostasis and Improves Obesity and Diabetes. Endocrinology 2014, 155, 4706–4719. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakagawa, Y.; Satoh, A.; Tezuka, H.; Han, S.I.; Takei, K.; Iwasaki, H.; Yatoh, S.; Yahagi, N.; Suzuki, H.; Iwasaki, Y.; et al. CREB3L3 controls fatty acid oxidation and ketogenesis in synergy with PPARα. Sci. Rep. 2016, 6, 39182. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Potthoff, M.J.; Inagaki, T.; Satapati, S.; Ding, X.; He, T.; Goetz, R.; Mohammadi, M.; Finck, B.N.; Mangelsdorf, D.J.; Kliewer, S.A.; et al. FGF21 induces PGC-1α and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response. Proc. Natl. Acad. Sci. USA 2009, 106, 10853–10858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogawa, Y.; Kurosu, H.; Yamamoto, M.; Nandi, A.; Rosenblatt, K.P.; Goetz, R.; Eliseenkova, A.V.; Mohammadi, M.; Kuro-o, M. BetaKlotho is required for metabolic activity of fibroblast growth factor 21. Proc. Natl. Acad. Sci. USA 2007, 104, 7432–7437. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Suzuki, M.; Uehara, Y.; Motomura-Matsuzaka, K.; Oki, J.; Koyama, Y.; Kimura, M.; Asada, M.; Komi-Kuramochi, A.; Oka, S.; Imamura, T. betaKlotho is required for fibroblast growth factor (FGF) 21 signaling through FGF receptor (FGFR) 1c and FGFR3c. Mol. Endocrinol. 2008, 22, 1006–1014. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kurosu, H.; Choi, M.; Ogawa, Y.; Dickson, A.S.; Goetz, R.; Eliseenkova, A.V.; Mohammadi, M.; Rosenblatt, K.P.; Kliewer, S.A.; Kuro-o, M. Tissue-specific expression of betaKlotho and fibroblast growth factor (FGF) receptor isoforms determines metabolic activity of FGF19 and FGF21. J. Biol. Chem. 2007, 282, 26687–26695. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Coskun, T.; Bina, H.A.; Schneider, M.A.; Dunbar, J.D.; Hu, C.C.; Chen, Y.; Moller, D.E.; Kharitonenkov, A. Fibroblast growth factor 21 corrects obesity in mice. Endocrinology 2008, 149, 6018–6027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Lloyd, D.J.; Hale, C.; Stanislaus, S.; Chen, M.; Sivits, G.; Vonderfecht, S.; Hecht, R.; Li, Y.S.; Lindberg, R.A.; et al. Fibroblast growth factor 21 reverses hepatic steatosis, increases energy expenditure and improves insulin sensitivity in diet-induced obese mice. Diabetes 2009, 58, 250–259. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fisher, F.M.; Kleiner, S.; Douris, N.; Fox, E.C.; Mepani, R.J.; Verdeguer, F.; Wu, J.; Kharitonenkov, A.; Flier, J.S.; Maratos-Flier, E.; et al. FGF21 regulates PGC-1α and browning of white adipose tissues in adaptive thermogenesis. Genes Dev. 2012, 26, 271–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaich, G.; Chien, J.Y.; Fu, H.; Glass, L.C.; Deeg, M.A.; Holland, W.L.; Kharitonenkov, A.; Bumol, T.; Schilske, H.K.; Moller, D.E. The effects of LY2405319, an FGF21 analog, in obese human subjects with type 2 diabetes. Cell Metab. 2013, 18, 333–340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miura, Y.; Hosono, M.; Oyamada, C.; Odai, H.; Oikawa, S.; Kondo, K. Dietary isohumulones, the bitter components of beer, raise plasma HDL-cholesterol levels and reduce liver cholesterol and triacylglycerol contents similar to PPARα activations in C57BL/6 mice. Br. J. Nutr. 2005, 93, 559–567. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chan, S.M.; Zeng, X.Y.; Sun, R.Q.; Jo, E.; Zhou, X.; Wang, H.; Li, S.; Xu, A.; Watt, M.J.; Ye, J.M. Fenofibrate insulates diacylglycerol in lipid droplet/ER and preserves insulin signaling transduction in the liver of high fat fed mice. Biochim. Biophys. Acta 2015, 1852, 1511–1519. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takei, K.; Han, S.I.; Murayama, Y.; Satoh, A.; Oikawa, F.; Ohno, H.; Osaki, Y.; Matsuzaka, T.; Sekiya, M.; Iwasaki, H.; et al. The selective PPARα modulator K-877 efficiently activates the PPARα pathway and improves lipid metabolism in mice. J. Diabetes Investig. 2017, 8, 446–452. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ediger, B.N.; Lim, H.W.; Juliana, C.; Groff, D.N.; Williams, L.T.; Dominguez, G.; Liu, J.H.; Taylor, B.L.; Walp, E.R.; Kameswaran, V.; et al. LIM domain-binding 1 maintains the terminally differentiated state of pancreatic beta cells. J. Clin. Investig. 2017, 127, 215–229. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takahashi, H.; Goto, T.; Yamazaki, Y.; Kamakari, K.; Hirata, M.; Suzuki, H.; Shibata, D.; Nakata, R.; Inoue, H.; Takahashi, N.; et al. Metabolomics reveal 1-palmitoyl lysophosphatidylcholine production by peroxisome proliferator-activated receptor α. J. Lipid Res. 2015, 56, 254–265. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Goto, T.; Lee, J.Y.; Teraminami, A.; Kim, Y.I.; Hirai, S.; Uemura, T.; Inoue, H.; Takahashi, N.; Kawada, T. Activation of peroxisome proliferator-activated receptor-α stimulates both differentiation and fatty acid oxidation in adipocytes. J. Lipid Res. 2011, 52, 873–884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tsuchida, A.; Yamauchi, T.; Takekawa, S.; Hada, Y.; Ito, Y.; Maki, T.; Kadowaki, T. Peroxisome proliferator-activated receptor (PPAR) α activation increases adiponectin receptors and reduces obesity-related inflammation in adipose tissue: Comparison of activation of PPARα, PPARγ and their combination. Diabetes 2005, 54, 3358–3370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galman, C.; Lundasen, T.; Kharitonenkov, A.; Bina, H.A.; Eriksson, M.; Hafstrom, I.; Dahlin, M.; Amark, P.; Angelin, B.; Rudling, M. The circulating metabolic regulator FGF21 is induced by prolonged fasting and PPARα activation in man. Cell Metab. 2008, 8, 169–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kharitonenkov, A.; Shiyanova, T.L.; Koester, A.; Ford, A.M.; Micanovic, R.; Galbreath, E.J.; Sandusky, G.E.; Hammond, L.J.; Moyers, J.S.; Owens, R.A.; et al. FGF-21 as a novel metabolic regulator. J. Clin. Investig. 2005, 115, 1627–1635. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, J.; Stanislaus, S.; Chinookoswong, N.; Lau, Y.Y.; Hager, T.; Patel, J.; Ge, H.; Weiszmann, J.; Lu, S.C.; Graham, M.; et al. Acute glucose-lowering and insulin-sensitizing action of FGF21 in insulin-resistant mouse models—Association with liver and adipose tissue effects. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E1105–E1114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sairyo, M.; Kobayashi, T.; Masuda, D.; Kanno, K.; Zhu, Y.; Okada, T.; Koseki, M.; Ohama, T.; Nishida, M.; Sakata, Y.; et al. A Novel Selective PPARα Modulator (SPPARMα), K-877 (Pemafibrate), Attenuates Postprandial Hypertriglyceridemia in Mice. J. Atheroscler. Thromb. 2018, 25, 142–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hiuge, A.; Tenenbaum, A.; Maeda, N.; Benderly, M.; Kumada, M.; Fisman, E.Z.; Tanne, D.; Matas, Z.; Hibuse, T.; Fujita, K.; et al. Effects of peroxisome proliferator-activated receptor ligands, bezafibrate and fenofibrate, on adiponectin level. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 635–641. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mazzucotelli, A.; Viguerie, N.; Tiraby, C.; Annicotte, J.S.; Mairal, A.; Klimcakova, E.; Lepin, E.; Delmar, P.; Dejean, S.; Tavernier, G.; et al. The transcriptional coactivator peroxisome proliferator activated receptor (PPAR)γ coactivator-1 α and the nuclear receptor PPAR α control the expression of glycerol kinase and metabolism genes independently of PPAR γ activation in human white adipocytes. Diabetes 2007, 56, 2467–2475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ribet, C.; Montastier, E.; Valle, C.; Bezaire, V.; Mazzucotelli, A.; Mairal, A.; Viguerie, N.; Langin, D. Peroxisome proliferator-activated receptor-α control of lipid and glucose metabolism in human white adipocytes. Endocrinology 2010, 151, 123–133. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolsoni-Lopes, A.; Festuccia, W.T.; Farias, T.S.; Chimin, P.; Torres-Leal, F.L.; Derogis, P.B.; de Andrade, P.B.; Miyamoto, S.; Lima, F.B.; Curi, R.; et al. Palmitoleic acid (n-7) increases white adipocyte lipolysis and lipase content in a PPARα-dependent manner. Am. J. Physiol. Endocrinol. Metab. 2013, 305, E1093–E1102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hsuchou, H.; Pan, W.; Kastin, A.J. The fasting polypeptide FGF21 can enter brain from blood. Peptides 2007, 28, 2382–2386. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fon Tacer, K.; Bookout, A.L.; Ding, X.; Kurosu, H.; John, G.B.; Wang, L.; Goetz, R.; Mohammadi, M.; Kuro-o, M.; Mangelsdorf, D.J.; et al. Research resource: Comprehensive expression atlas of the fibroblast growth factor system in adult mouse. Mol. Endocrinol. 2010, 24, 2050–2064. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Douris, N.; Stevanovic, D.M.; Fisher, F.M.; Cisu, T.I.; Chee, M.J.; Nguyen, N.L.; Zarebidaki, E.; Adams, A.C.; Kharitonenkov, A.; Flier, J.S.; et al. Central Fibroblast Growth Factor 21 Browns White Fat via Sympathetic Action in Male Mice. Endocrinology 2015, 156, 2470–2481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rousset, S.; Alves-Guerra, M.C.; Mozo, J.; Miroux, B.; Cassard-Doulcier, A.M.; Bouillaud, F.; Ricquier, D. The biology of mitochondrial uncoupling proteins. Diabetes 2004, 53, S130–S135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Marken Lichtenbelt, W.D.; Vanhommerig, J.W.; Smulders, N.M.; Drossaerts, J.M.; Kemerink, G.J.; Bouvy, N.D.; Schrauwen, P.; Teule, G.J. Cold-activated brown adipose tissue in healthy men. N. Engl. J. Med. 2009, 360, 1500–1508. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cypess, A.M.; Lehman, S.; Williams, G.; Tal, I.; Rodman, D.; Goldfine, A.B.; Kuo, F.C.; Palmer, E.L.; Tseng, Y.H.; Doria, A.; et al. Identification and importance of brown adipose tissue in adult humans. N. Engl. J. Med. 2009, 360, 1509–1517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saito, M.; Okamatsu-Ogura, Y.; Matsushita, M.; Watanabe, K.; Yoneshiro, T.; Nio-Kobayashi, J.; Iwanaga, T.; Miyagawa, M.; Kameya, T.; Nakada, K.; et al. High incidence of metabolically active brown adipose tissue in healthy adult humans: Effects of cold exposure and adiposity. Diabetes 2009, 58, 1526–1531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nagase, I.; Yoshida, T.; Kumamoto, K.; Umekawa, T.; Sakane, N.; Nikami, H.; Kawada, T.; Saito, M. Expression of uncoupling protein in skeletal muscle and white fat of obese mice treated with thermogenic beta 3-adrenergic agonist. J. Clin. Investig. 1996, 97, 2898–2904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbatelli, G.; Murano, I.; Madsen, L.; Hao, Q.; Jimenez, M.; Kristiansen, K.; Giacobino, J.P.; de Matteis, R.; Cinti, S. The emergence of cold-induced brown adipocytes in mouse white fat depots is determined predominantly by white to brown adipocyte transdifferentiation. Am. J. Physiol. Endocrinol. Metab. 2010, 298, E1244–E1253. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xue, B.; Rim, J.S.; Hogan, J.C.; Coulter, A.A.; Koza, R.A.; Kozak, L.P. Genetic variability affects the development of brown adipocytes in white fat but not in interscapular brown fat. J. Lipid Res. 2007, 48, 41–51. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cohen, P.; Levy, J.D.; Zhang, Y.; Frontini, A.; Kolodin, D.P.; Svensson, K.J.; Lo, J.C.; Zeng, X.; Ye, L.; Khandekar, M.J.; et al. Ablation of PRDM16 and beige adipose causes metabolic dysfunction and a subcutaneous to visceral fat switch. Cell 2014, 156, 304–316. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barbera, M.J.; Schluter, A.; Pedraza, N.; Iglesias, R.; Villarroya, F.; Giralt, M. Peroxisome proliferator-activated receptor α activates transcription of the brown fat uncoupling protein-1 gene. A link between regulation of the thermogenic and lipid oxidation pathways in the brown fat cell. J. Biol. Chem. 2001, 276, 1486–1493. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Defour, M.; Dijk, W.; Ruppert, P.; Nascimento, E.B.M.; Schrauwen, P.; Kersten, S. The Peroxisome Proliferator-Activated Receptor α is dispensable for cold-induced adipose tissue browning in mice. Mol. Metab. 2018, 10, 39. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Owen, B.M.; Ding, X.; Morgan, D.A.; Coate, K.C.; Bookout, A.L.; Rahmouni, K.; Kliewer, S.A.; Mangelsdorf, D.J. FGF21 acts centrally to induce sympathetic nerve activity, energy expenditure and weight loss. Cell Metab. 2014, 20, 670–677. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tvrdik, P.; Asadi, A.; Kozak, L.P.; Nedergaard, J.; Cannon, B.; Jacobsson, A. Cig30, a mouse member of a novel membrane protein gene family, is involved in the recruitment of brown adipose tissue. J. Biol. Chem. 1997, 272, 31738–31746. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Westerberg, R.; Tvrdik, P.; Unden, A.B.; Mansson, J.E.; Norlen, L.; Jakobsson, A.; Holleran, W.H.; Elias, P.M.; Asadi, A.; Flodby, P.; et al. Role for ELOVL3 and fatty acid chain length in development of hair and skin function. J. Biol. Chem. 2004, 279, 5621–5629. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Westerberg, R.; Mansson, J.E.; Golozoubova, V.; Shabalina, I.G.; Backlund, E.C.; Tvrdik, P.; Retterstol, K.; Capecchi, M.R.; Jacobsson, A. ELOVL3 is an important component for early onset of lipid recruitment in brown adipose tissue. J. Biol. Chem. 2006, 281, 4958–4968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jorgensen, J.A.; Zadravec, D.; Jacobsson, A. Norepinephrine and rosiglitazone synergistically induce Elovl3 expression in brown adipocytes. Am. J. Physiol. Endocrinol. Metab. 2007, 293, E1159–E1168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nakagawa, Y.; Shimano, H.; Yoshikawa, T.; Ide, T.; Tamura, M.; Furusawa, M.; Yamamoto, T.; Inoue, N.; Matsuzaka, T.; Takahashi, A.; et al. TFE3 transcriptionally activates hepatic IRS-2, participates in insulin signaling and ameliorates diabetes. Nat. Med. 2006, 12, 107–113. [Google Scholar] [CrossRef] [Scilit] [PubMed]









| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| Acox1 | CGATCCAGACTTCCAACATGAG | CCATGGTGGCACTCTTCTTAACA |
| Adrb3 | ACAGGAATGCCACTCCAATC | TTAGCCACAACGAACACTCG |
| Atgl | GGATGGCGGCATTTCA | CAAAGGGTTGGGTTGG |
| Cebpa | GCGCAAGAGCCGAGATAAAG | CGGTCATTGTCACTGGTCAACT |
| Cidea | CATCCCCCAAGCCTAG | CTCTGTAGCTGTGCCC |
| Cpt1a | CCTGGGCATGATTGCAAAG | GGACGCCACTCACGATGTT |
| Cpt1b | GGCTGCCGTGGGACATT | TGCCTTGGCTACTTGGTACGA |
| CrebH | CCTGTTTGATCGGCAGGAC | CGGGGGACGATAATGGAGA |
| Cyclophilin | TGGCTCACAGTTCTTCATAACCA | ATGACATCCTTCAGTGGCTTGTC |
| Elovl3 | CGTAGTCAGATTCTGG | CCAGAAGAAGTGTTCC |
| Fgf21 | AGATCAGGGAGGATGGAACA | TCAAAGTGAGGCGATCCATA |
| Hsl | GAGCGCTGGAGGAGTGTTTT | TGATGCAGAGATTCCCACCTG |
| Ppara | ACGCGAGTTCCTTAAGAACCTG | GTGTCATCTGGATGGTTGCTCT |
| Ppard | TTCCACTATGGAGTTCATGCTTG | TCCGGCAGTTAAGATCACACCT |
| Pparg | TCAACATGGAATGTCGGGTG | ATACTCGAGCTTCATGCGGATT |
| Ppargc1a | TTCAAGATCCTGTTACTACT | ACCTTGAACGTGATCTCACA |
| Prdm16 | GGCGAGGAAGCTAGCC | GGTCTCCTCCTCGGCA |
| Ucp1 | AGGATGGTGAACCCGACAAC | TTGGATCTGAAGGCGGACTT |
| Ucp2 | GACCTCATCAAAGATACTCTCCTGAA | ATCTCGTCTTGACCACATCAACAG |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Araki, M.; Nakagawa, Y.; Oishi, A.; Han, S.-i.; Wang, Y.; Kumagai, K.; Ohno, H.; Mizunoe, Y.; Iwasaki, H.; Sekiya, M.; et al. The Peroxisome Proliferator-Activated Receptor α (PPARα) Agonist Pemafibrate Protects against Diet-Induced Obesity in Mice. Int. J. Mol. Sci. 2018, 19, 2148. https://doi.org/10.3390/ijms19072148
Araki M, Nakagawa Y, Oishi A, Han S-i, Wang Y, Kumagai K, Ohno H, Mizunoe Y, Iwasaki H, Sekiya M, et al. The Peroxisome Proliferator-Activated Receptor α (PPARα) Agonist Pemafibrate Protects against Diet-Induced Obesity in Mice. International Journal of Molecular Sciences. 2018; 19(7):2148. https://doi.org/10.3390/ijms19072148
Chicago/Turabian StyleAraki, Masaya, Yoshimi Nakagawa, Asayo Oishi, Song-iee Han, Yunong Wang, Kae Kumagai, Hiroshi Ohno, Yuhei Mizunoe, Hitoshi Iwasaki, Motohiro Sekiya, and et al. 2018. "The Peroxisome Proliferator-Activated Receptor α (PPARα) Agonist Pemafibrate Protects against Diet-Induced Obesity in Mice" International Journal of Molecular Sciences 19, no. 7: 2148. https://doi.org/10.3390/ijms19072148
APA StyleAraki, M., Nakagawa, Y., Oishi, A., Han, S.-i., Wang, Y., Kumagai, K., Ohno, H., Mizunoe, Y., Iwasaki, H., Sekiya, M., Matsuzaka, T., & Shimano, H. (2018). The Peroxisome Proliferator-Activated Receptor α (PPARα) Agonist Pemafibrate Protects against Diet-Induced Obesity in Mice. International Journal of Molecular Sciences, 19(7), 2148. https://doi.org/10.3390/ijms19072148

