Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity
Abstract
1. Introduction
2. Results
2.1. Impact of Microgravity on the Regulation of Genes Whose Products Act Extracellularly
2.2. Influence of Microgravity on Genes of Membrane Proteins and Their Accumulation
3. Discussion
3.1. Impact of Microgravity on the Cytoskeleton
3.2. Real Microgravity Changes the Extracellular Matrix
3.3. Alteration of Focal Adhesion Proteins
3.4. Impact of altered gravity on cytokines
4. Materials and Methods
4.1. Cell Cultures
4.2. TEXUS Sounding Rocket Mission
4.3. Random Positioning Machine
4.4. F-actin Staining
4.5. Confocal Laser Scanning Microscopy (CLSM)
4.6. Immunofluorescence of Fibronectin, Vinculin and ICAM-1
4.7. Western Blot Analysis
4.8. Postflight qPCR Analysis
4.9. In-silico Analyses
4.10. Microarray Analysis
4.11. Statistics
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
| µg | Microgravity | |
| 2D | two-dimensional | |
| 3D | three-dimensional | |
| AD | adherently growing | |
| ADS | Airbus Defence and Space | |
| CDH1 | Cadherin-1/E-cadherin | |
| CFL1 | Cofilin | |
| COL1A1/COL4A5 | Collagen 1A1/Collagen 4A5 | |
| CXCL8 | Interleukin 8 | |
| ECM | Extracellular Matrix | |
| ERM | Ezrin-Radixin-Moesin | |
| FN1 | Fibronectin 1 | |
| ICAM1 | Intercellular adhesion molecule 1 | |
| IL6 | Interleukin 6 | |
| IMS | Immunofluorescence staining | |
| ITGB1 | Integrin beta-1 | |
| LOX | Protein-lysine 6-oxidase | |
| MCS | Multicellular spheroids | |
| MMPs | Matrix metalloproteinases | |
| PTK2/FAK1 | Focal adhesion kinase 1 | |
| qPCR | Quantitative PCR | |
| r- | real- | |
| RAI | Radioiodine therapy | |
| RPM | Random Positioning Machine | |
| s- | simulated- | |
| SPP1 | Secreted Phosphoprotein 1 / Osteopontin | |
| TC | Thyroid cancer | |
| TGFB1 | Transforming growth factor beta-1 | |
| TIMP1 | Metallopeptidase (proteinase) inhibitor 1 | |
| TX | TEXUS | |
| VCAM1 | Vascular cell adhesion protein 1 | |
| ADM | Adrenomedullin | |
| GJB2 | Gap junction beta-2 protein | |
| PFKFB4 | 6-phosphofructo-2-kinase/fructose-2,6-biphospatase 4 | |
| KISS1R | KiSS-1 receptor | |
| NDRG1 | Protein NDRG1 | |
| IGFBP3 | Insulin-like growth factor-binding protein 3 | |
References
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: Globocan estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Ancker, O.V.; Wehland, M.; Bauer, J.; Infanger, M.; Grimm, D. The adverse effect of hypertension in the treatment of thyroid cancer with multi-kinase inhibitors. Int. J. Mol. Sci. 2017, 18, 625. [Google Scholar] [CrossRef] [PubMed]
- Omur, O.; Baran, Y. An update on molecular biology of thyroid cancers. Crit. Rev. Oncol. Hematol. 2014, 90, 233–252. [Google Scholar] [CrossRef] [PubMed]
- Laursen, R.; Wehland, M.; Kopp, S.; Pietsch, J.; Infanger, M.; Grosse, J.; Grimm, D. Effects and role of multikinase inhibitors in thyroid cancer. Curr. Pharm. Des. 2016, 22, 5915–5926. [Google Scholar] [CrossRef] [PubMed]
- Grimm, D.; Egli, M.; Kruger, M.; Riwaldt, S.; Corydon, T.J.; Kopp, S.; Wehland, M.; Wise, P.; Infanger, M.; Mann, V.; et al. Tissue engineering under microgravity conditions-use of stem cells and specialized cells. Stem Cells Dev. 2018, 27, 787–804. [Google Scholar] [CrossRef] [PubMed]
- Grimm, D.; Wehland, M.; Pietsch, J.; Aleshcheva, G.; Wise, P.; van Loon, J.; Ulbrich, C.; Magnusson, N.E.; Infanger, M.; Bauer, J. Growing tissues in real and simulated microgravity: New methods for tissue engineering. Tissue Eng. Part B Rev. 2014, 20, 555–566. [Google Scholar] [CrossRef] [PubMed]
- Strauch, S.M.; Grimm, D.; Corydon, T.J.; Krüger, M.; Bauer, J.; Lebert, M.; Wise, P.; Infanger, M.; Richter, P. Current knowledge about the impact of microgravity on the proteome. Expert Rev. Proteom. 2018, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Kopp, S.; Warnke, E.; Wehland, M.; Aleshcheva, G.; Magnusson, N.E.; Hemmersbach, R.; Corydon, T.J.; Bauer, J.; Infanger, M.; Grimm, D. Mechanisms of three-dimensional growth of thyroid cells during long-term simulated microgravity. Sci. Rep. 2015, 5, 16691. [Google Scholar] [CrossRef] [PubMed]
- Warnke, E.; Pietsch, J.; Kopp, S.; Bauer, J.; Sahana, J.; Wehland, M.; Krüger, M.; Hemmersbach, R.; Infanger, M.; Lützenberg, R.; et al. Cytokine release and focal adhesion proteins in normal thyroid cells cultured on the random positioning machine. Cell. Physiol. Biochem. 2017, 43, 257–270. [Google Scholar] [CrossRef] [PubMed]
- Warnke, E.; Pietsch, J.; Wehland, M.; Bauer, J.; Infanger, M.; Görög, M.; Hemmersbach, R.; Braun, M.; Ma, X.; Sahana, J.; et al. Spheroid formation of human thyroid cancer cells under simulated microgravity: A possible role of CTGF and CAV1. Cell Commun. Signal. 2014, 12, 32. [Google Scholar] [CrossRef]
- Ma, X.; Pietsch, J.; Wehland, M.; Schulz, H.; Saar, K.; Hübner, N.; Bauer, J.; Braun, M.; Schwarzwälder, A.; Segerer, J.; et al. Differential gene expression profile and altered cytokine secretion of thyroid cancer cells in space. FASEB J. 2014, 28, 813–835. [Google Scholar] [CrossRef] [PubMed]
- Corydon, T.J.; Kopp, S.; Wehland, M.; Braun, M.; Schütte, A.; Mayer, T.; Hulsing, T.; Oltmann, H.; Schmitz, B.; Hemmersbach, R.; et al. Alterations of the cytoskeleton in human cells in space proved by life-cell imaging. Sci. Rep. 2016, 6, 20043. [Google Scholar] [CrossRef] [PubMed]
- Ingber, D. How cells (might) sense microgravity. FASEB J. 1999, 13, S3–S15. [Google Scholar] [CrossRef] [PubMed]
- Ingber, D.E.; Wang, N.; Stamenovic, D. Tensegrity, cellular biophysics, and the mechanics of living systems. Rep. Prog. Phys. 2014, 77, 046603. [Google Scholar] [CrossRef] [PubMed]
- Schoenwaelder, S.M.; Burridge, K. Bidirectional signaling between the cytoskeleton and integrins. Curr. Opin. Cell Biol. 1999, 11, 274–286. [Google Scholar] [CrossRef]
- Yamada, K.M.; Geiger, B. Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol. 1997, 9, 76–85. [Google Scholar] [CrossRef]
- Calderwood, D.A.; Shattil, S.J.; Ginsberg, M.H. Integrins and actin filaments: Reciprocal regulation of cell adhesion and signaling. J. Biol. Chem. 2000, 275, 22607–22610. [Google Scholar] [CrossRef] [PubMed]
- McClatchey, A.I. Erm proteins at a glance. J. Cell Sci. 2014, 127, 3199–3204. [Google Scholar] [CrossRef] [PubMed]
- Schwartz, M.A. Integrins and extracellular matrix in mechanotransduction. Cold Spring Harb. Perspect. Biol. 2010, 2, a005066. [Google Scholar] [CrossRef]
- Kopp, S.; Krüger, M.; Feldmann, S.; Oltmann, H.; Schütte, A.; Schmitz, B.; Bauer, J.; Schulz, H.; Saar, K.; Huebner, N.; et al. Thyroid cancer cells in space during the texus-53 sounding rocket mission—The thyroid project. Sci. Rep. 2018, 8, 10355. [Google Scholar] [CrossRef]
- Bauer, J.; Grimm, D.; Gombocz, E. Semantic analysis of thyroid cancer cell proteins obtained from rare research opportunities. J. Biomed. Inform. 2017, 76, 138–153. [Google Scholar] [CrossRef] [PubMed]
- Bauer, J.; Wehland, M.; Infanger, M.; Grimm, D.; Gombocz, E. Semantic analysis of posttranslational modification of proteins accumulated in thyroid cancer cells exposed to simulated microgravity. Int. J. Mol. Sci. 2018, 19, 2257. [Google Scholar] [CrossRef] [PubMed]
- Grosse, J.; Wehland, M.; Pietsch, J.; Schulz, H.; Saar, K.; Hubner, N.; Eilles, C.; Bauer, J.; Abou-El-Ardat, K.; Baatout, S.; et al. Gravity-sensitive signaling drives 3-dimensional formation of multicellular thyroid cancer spheroids. FASEB J. 2012, 26, 5124–5140. [Google Scholar] [CrossRef] [PubMed]
- Svejgaard, B.; Wehland, M.; Ma, X.; Kopp, S.; Sahana, J.; Warnke, E.; Aleshcheva, G.; Hemmersbach, R.; Hauslage, J.; Grosse, J.; et al. Common effects on cancer cells exerted by a random positioning machine and a 2d clinostat. PLoS ONE 2015, 10, e0135157. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.; Wehland, M.; Schulz, H.; Saar, K.; Hübner, N.; Infanger, M.; Bauer, J.; Grimm, D. Genomic approach to identify factors that drive the formation of three-dimensional structures by ea.Hy926 endothelial cells. PLoS ONE 2013, 8, e64402. [Google Scholar] [CrossRef]
- Ma, X.; Wehland, M.; Aleshcheva, G.; Hauslage, J.; Wasser, K.; Hemmersbach, R.; Infanger, M.; Bauer, J.; Grimm, D. Interleukin-6 expression under gravitational stress due to vibration and hypergravity in follicular thyroid cancer cells. PLoS ONE 2013, 8, e68140. [Google Scholar] [CrossRef]
- Ulbrich, C.; Pietsch, J.; Grosse, J.; Wehland, M.; Schulz, H.; Saar, K.; Hubner, N.; Hauslage, J.; Hemmersbach, R.; Braun, M.; et al. Differential gene regulation under altered gravity conditions in follicular thyroid cancer cells: Relationship between the extracellular matrix and the cytoskeleton. Cell. Physiol. Biochem. 2011, 28, 185–198. [Google Scholar] [CrossRef]
- Riwaldt, S.; Bauer, J.; Wehland, M.; Slumstrup, L.; Kopp, S.; Warnke, E.; Dittrich, A.; Magnusson, N.E.; Pietsch, J.; Corydon, T.J.; et al. Pathways regulating spheroid formation of human follicular thyroid cancer cells under simulated microgravity conditions: A genetic approach. Int. J. Mol. Sci. 2016, 17, 528. [Google Scholar] [CrossRef]
- Warnke, E.; Kopp, S.; Wehland, M.; Hemmersbach, R.; Bauer, J.; Pietsch, J.; Infanger, M.; Grimm, D. Thyroid cells exposed to simulated microgravity conditions—Comparison of the fast rotating clinostat and the random positioning machine. Microgravity Sci. Technol. 2016, 28, 247–260. [Google Scholar] [CrossRef]
- Buravkova, L.B.; Romanov, Y.A. The role of cytoskeleton in cell changes under condition of simulated microgravity. Acta Astronaut. 2001, 48, 647–650. [Google Scholar] [CrossRef]
- Crawford-Young, S.J. Effects of microgravity on cell cytoskeleton and embryogenesis. Int. J. Dev. Biol. 2006, 50, 183–191. [Google Scholar] [CrossRef] [PubMed]
- Hughes-Fulford, M. Function of the cytoskeleton in gravisensing during spaceflight. Adv. Space Res. 2003, 32, 1585–1593. [Google Scholar] [CrossRef]
- Vorselen, D.; Roos, W.H.; MacKintosh, F.C.; Wuite, G.J.; van Loon, J.J. The role of the cytoskeleton in sensing changes in gravity by nonspecialized cells. FASEB J. 2014, 28, 536–547. [Google Scholar] [CrossRef] [PubMed]
- Huber, F.; Schnauss, J.; Ronicke, S.; Rauch, P.; Muller, K.; Futterer, C.; Kas, J. Emergent complexity of the cytoskeleton: From single filaments to tissue. Adv. Phys. 2013, 62, 1–112. [Google Scholar] [CrossRef] [PubMed]
- Tsukita, S.; Yonemura, S.; Tsukita, S. Erm proteins: Head-to-tail regulation of actin-plasma membrane interaction. Trends Biochem. Sci. 1997, 22, 53–58. [Google Scholar] [CrossRef]
- Neisch, A.L.; Fehon, R.G. Ezrin, radixin and moesin: Key regulators of membrane-cortex interactions and signaling. Curr. Opin. Cell Biol. 2011, 23, 377–382. [Google Scholar] [CrossRef]
- Pearson, M.A.; Reczek, D.; Bretscher, A.; Karplus, P.A. Structure of the erm protein moesin reveals the ferm domain fold masked by an extended actin binding tail domain. Cell 2000, 101, 259–270. [Google Scholar] [CrossRef]
- Barros, F.B.A.; Assao, A.; Garcia, N.G.; Nonogaki, S.; Carvalho, A.L.; Soares, F.A.; Kowalski, L.P.; Oliveira, D.T. Moesin expression by tumor cells is an unfavorable prognostic biomarker for oral cancer. BMC Cancer 2018, 18, 53. [Google Scholar] [CrossRef]
- Bartova, M.; Hlavaty, J.; Tan, Y.; Singer, C.; Pohlodek, K.; Luha, J.; Walter, I. Expression of ezrin and moesin in primary breast carcinoma and matched lymph node metastases. Clin. Exp. Metastasis 2017, 34, 333–344. [Google Scholar] [CrossRef]
- Pietsch, J.; Sickmann, A.; Weber, G.; Bauer, J.; Egli, M.; Wildgruber, R.; Infanger, M.; Grimm, D. A proteomic approach to analysing spheroid formation of two human thyroid cell lines cultured on a random positioning machine. Proteomics 2011, 11, 2095–2104. [Google Scholar] [CrossRef]
- Grimm, D.; Bauer, J.; Kossmehl, P.; Shakibaei, M.; Schöberger, J.; Pickenhahn, H.; Schulze-Tanzil, G.; Vetter, R.; Eilles, C.; Paul, M.; et al. Simulated microgravity alters differentiation and increases apoptosis in human follicular thyroid carcinoma cells. FASEB J. 2002, 16, 604–606. [Google Scholar] [CrossRef] [PubMed]
- Levene, C.I.; Carrington, M.J. The inhibition of protein-lysine 6-oxidase by various lathyrogens. Evidence for two different mechanisms. Biochem. J. 1985, 232, 293–296. [Google Scholar] [CrossRef] [PubMed]
- Bauer, J.; Wehland, M.; Pietsch, J.; Sickmann, A.; Weber, G.; Grimm, D. Annotated gene and proteome data support recognition of interconnections between the results of different experiments in space research. Microgravity Sci. Technol. 2016, 28, 357–365. [Google Scholar] [CrossRef]
- Arpino, V.; Brock, M.; Gill, S.E. The role of timps in regulation of extracellular matrix proteolysis. Matrix Biol. 2015, 44–46, 247–254. [Google Scholar] [CrossRef]
- Hawthorn, L.; Stein, L.; Varma, R.; Wiseman, S.; Loree, T.; Tan, D. TIMP1 and SERPIN-A overexpression and TFF3 and CRABP1 underexpression as biomarkers for papillary thyroid carcinoma. Head Neck 2004, 26, 1069–1083. [Google Scholar] [CrossRef]
- Riwaldt, S.; Bauer, J.; Pietsch, J.; Braun, M.; Segerer, J.; Schwarzwälder, A.; Corydon, T.J.; Infanger, M.; Grimm, D. The importance of caveolin-1 as key-regulator of three-dimensional growth in thyroid cancer cells cultured under real and simulated microgravity conditions. Int. J. Mol. Sci. 2015, 16, 28296–28310. [Google Scholar] [CrossRef]
- Marastoni, S.; Ligresti, G.; Lorenzon, E.; Colombatti, A.; Mongiat, M. Extracellular matrix: A matter of life and death. Connect. Tissue Res. 2008, 49, 203–206. [Google Scholar] [CrossRef]
- Chaudhary, A.K.; Pandya, S.; Ghosh, K.; Nadkarni, A. Matrix metalloproteinase and its drug targets therapy in solid and hematological malignancies: An overview. Mutat. Res. 2013, 753, 7–23. [Google Scholar] [CrossRef]
- Kraiem, Z.; Korem, S. Matrix metalloproteinases and the thyroid. Thyroid 2000, 10, 1061–1069. [Google Scholar] [CrossRef]
- Kingsley, D.M. The TGF-β superfamily: New members, new receptors, and new genetic tests of function in different organisms. Genes Dev. 1994, 8, 133–146. [Google Scholar] [CrossRef]
- Geiger, B.; Spatz, J.P.; Bershadsky, A.D. Environmental sensing through focal adhesions. Nat. Rev. Mol. Cell Biol. 2009, 10, 21–33. [Google Scholar] [CrossRef] [PubMed]
- Zhao, T.; Li, R.; Tan, X.; Zhang, J.; Fan, C.; Zhao, Q.; Deng, Y.; Xu, A.; Lukong, K.E.; Genth, H.; et al. Simulated microgravity reduces focal adhesions and alters cytoskeleton and nuclear positioning leading to enhanced apoptosis via suppressing FAK/RhoA-mediated mTORC1/NF-κB and ERK1/2 pathways. Int. J. Mol. Sci. 2018, 19, 1994. [Google Scholar] [CrossRef] [PubMed]
- Spanjaard, E.; de Rooij, J. Mechanotransduction: Vinculin provides stability when tension rises. Curr. Biol. 2013, 23, R159–R161. [Google Scholar] [CrossRef] [PubMed]
- Humphries, J.D.; Wang, P.; Streuli, C.; Geiger, B.; Humphries, M.J.; Ballestrem, C. Vinculin controls focal adhesion formation by direct interactions with talin and actin. J. Cell Biol. 2007, 179, 1043–1057. [Google Scholar] [CrossRef] [PubMed]
- Tadokoro, S.; Shattil, S.J.; Eto, K.; Tai, V.; Liddington, R.C.; de Pereda, J.M.; Ginsberg, M.H.; Calderwood, D.A. Talin binding to integrin β tails: A final common step in integrin activation. Science 2003, 302, 103–106. [Google Scholar] [CrossRef] [PubMed]
- Critchley, D.R. Biochemical and structural properties of the integrin-associated cytoskeletal protein talin. Annu. Rev. Biophys. 2009, 38, 235–254. [Google Scholar] [CrossRef] [PubMed]
- Aleshcheva, G.; Bauer, J.; Hemmersbach, R.; Slumstrup, L.; Wehland, M.; Infanger, M.; Grimm, D. Scaffold-free tissue formation under real and simulated microgravity conditions. Basic Clin. Pharmacol. Toxicol. 2016, 119 (Suppl. 3), 26–33. [Google Scholar] [CrossRef]
- Goodfellow, P.J.; Nevanlinna, H.A.; Gorman, P.; Sheer, D.; Lam, G.; Goodfellow, P.N. Assignment of the gene encoding the β-subunit of the human fibronectin receptor (β-FNR) to chromosome 10p11.2. Ann. Hum. Genet. 1989, 53, 15–22. [Google Scholar] [CrossRef]
- Bouaouina, M.; Lad, Y.; Calderwood, D.A. The N-terminal domains of talin cooperate with the phosphotyrosine binding-like domain to activate β1 and β3 integrins. J. Biol. Chem. 2008, 283, 6118–6125. [Google Scholar] [CrossRef]
- Van Roy, F.; Berx, G. The cell–cell adhesion molecule E-cadherin. Cell. Mol. Life Sci. 2008, 65, 3756–3788. [Google Scholar] [CrossRef]
- Reynolds, A.B. P120-catenin: Past and present. Biochim. Biophys. Acta 2007, 1773, 2–7. [Google Scholar] [CrossRef] [PubMed]
- Ishiyama, N.; Ikura, M. The three-dimensional structure of the cadherin-catenin complex. In Adherens Junctions: From Molecular Mechanisms to Tissue Development and Disease; Subcellular Biochemistry; Springer: Dordrecht, The Netherlands, 2012; Volume 60, pp. 39–62. [Google Scholar]
- Sahana, J.; Nassef, M.Z.; Wehland, M.; Kopp, S.; Krüger, M.; Corydon, T.J.; Infanger, M.; Bauer, J.; Grimm, D. Decreased E-cadherin in MCF7 human breast cancer cells forming multicellular spheroids exposed to simulated microgravity. Proteomics 2018, 18, e1800015. [Google Scholar] [CrossRef] [PubMed]
- Petrova, Y.I.; Schecterson, L.; Gumbiner, B.M. Roles for E-cadherin cell surface regulation in cancer. Mol. Biol. Cell 2016, 27, 3233–3244. [Google Scholar] [CrossRef] [PubMed]
- Martinez-Aguilar, J.; Clifton-Bligh, R.; Molloy, M.P. Proteomics of thyroid tumours provides new insights into their molecular composition and changes associated with malignancy. Sci. Rep. 2016, 6, 23660. [Google Scholar] [CrossRef] [PubMed]
- McGough, A.; Pope, B.; Chiu, W.; Weeds, A. Cofilin changes the twist of F-actin: Implications for actin filament dynamics and cellular function. J. Cell Biol. 1997, 138, 771–781. [Google Scholar] [CrossRef]
- Giusti, L.; Iacconi, P.; Ciregia, F.; Giannaccini, G.; Donatini, G.L.; Basolo, F.; Miccoli, P.; Pinchera, A.; Lucacchini, A. Fine-needle aspiration of thyroid nodules: Proteomic analysis to identify cancer biomarkers. J. Proteome Res. 2008, 7, 4079–4088. [Google Scholar] [CrossRef]
- Maimaiti, Y.; Jie, T.; Jing, Z.; Changwen, W.; Pan, Y.; Chen, C.; Tao, H. Aurora kinase a induces papillary thyroid cancer lymph node metastasis by promoting cofilin-1 activity. Biochem. Biophys. Res. Commun. 2016, 473, 212–218. [Google Scholar] [CrossRef]
- Bauer, J.; Kopp, S.; Schlagberger, E.M.; Grosse, J.; Sahana, J.; Riwaldt, S.; Wehland, M.; Luetzenberg, R.; Infanger, M.; Grimm, D. Proteome analysis of human follicular thyroid cancer cells exposed to the random positioning machine. Int. J. Mol. Sci. 2017, 18, 546. [Google Scholar] [CrossRef]
- Kopp, S.; Sahana, J.; Islam, T.; Petersen, A.G.; Bauer, J.; Corydon, T.J.; Schulz, H.; Saar, K.; Huebner, N.; Slumstrup, L.; et al. The role of NFκB in spheroid formation of human breast cancer cells cultured on the Random Positioning Machine. Sci. Rep. 2018, 8, 921. [Google Scholar] [CrossRef]
- Wuest, S.L.; Richard, S.; Kopp, S.; Grimm, D.; Egli, M. Simulated microgravity: Critical review on the use of random positioning machines for mammalian cell culture. BioMed Res. Int. 2015, 2015, 971474. [Google Scholar] [CrossRef]
- Aleshcheva, G.; Sahana, J.; Ma, X.; Hauslage, J.; Hemmersbach, R.; Egli, M.; Infanger, M.; Bauer, J.; Grimm, D. Changes in morphology, gene expression and protein content in chondrocytes cultured on a random positioning machine. PLoS ONE 2013, 8, e79057. [Google Scholar] [CrossRef] [PubMed]
- Aleshcheva, G.; Wehland, M.; Sahana, J.; Bauer, J.; Corydon, T.J.; Hemmersbach, R.; Frett, T.; Egli, M.; Infanger, M.; Grosse, J.; et al. Moderate alterations of the cytoskeleton in human chondrocytes after short-term microgravity produced by parabolic flight maneuvers could be prevented by up-regulation of BMP-2 and SOX-9. FASEB J. 2015, 29, 2303–2314. [Google Scholar] [CrossRef] [PubMed]
- Nyegaard, M.; Rendtorff, N.D.; Nielsen, M.S.; Corydon, T.J.; Demontis, D.; Starnawska, A.; Hedemand, A.; Buniello, A.; Niola, F.; Overgaard, M.T.; et al. A novel locus harbouring a functional CD164 nonsense mutation identified in a large danish family with nonsyndromic hearing impairment. PLoS Genet. 2015, 11, e1005386. [Google Scholar] [CrossRef] [PubMed]
- Zhang, K.; Liu, J.; Li, C.; Peng, X.; Li, H.; Li, Z. Identification and validation of potential target genes in papillary thyroid cancer. Eur. J. Pharmacol. 2018, 843, 217–225. [Google Scholar] [CrossRef] [PubMed]







| Cell Line | g-Condition | FN1 | COL1A1 | COL4A5 | SPP1 | Reference | |
| FTC-133 | Space | 10 days | ↓ | [11] | |||
| RPM | 1 day | AD↑↑ MCS↑ | [23] | ||||
| 7 days | ↓ | ↑↑ | [8] | ||||
| 14 days | ↓ | ↑↑ | [8] | ||||
| PFC | 31P | WT↑↑ | [11] | ||||
| hyper-g | 2 h | [11] | |||||
| Nthy-ori 3-1 | RPM | 4 h | AD↑ | [9] | |||
| 1 day | AD↑ MCS↓ | [9] | |||||
| 3 days | AD→ MCS→ | [9] | |||||
| 7 days | ↑↑ | [8] | |||||
| 14 days | ↑↑ | ↑↑ | [8] | ||||
| Cell line | g-Condition | ICAM1 | VCAM1 | IL6 | CXCL8 | Reference | |
| FTC-133 | Space | 10 days | ↓ | ↓ | [11] | ||
| RPM | 1 day | AD↑↑ MCS↓↓ | AD↑↑ MCS↑ | [23] | |||
| 7 days | ↑↑ | AD↑↑ MCS↓↓ | [8] | ||||
| 14 days | ↑↑ | AD↑↑ MCS→ | [8] | ||||
| PFC | 31 P | WT↑↑ | WT↑↑ | [11] | |||
| hyper-g | 2 h | [11] | |||||
| Nthy-ori 3-1 | RPM | 4 h | [9] | ||||
| 1 day | [9] | ||||||
| 3 days | [9] | ||||||
| 7 days | ↑↑ | AD↑↑ MCS↓↓ | [8] | ||||
| 14 days | ↑↑ | AD↑↑ MCS↑↑ | [8] | ||||
| Antibodies | Company/No | Species | MW (kDa) | Dilution |
|---|---|---|---|---|
| Collagen type I | Sigma/C2456 | Ms | ~130 | 1:500 |
| B-actin | Sigma/A5316 | Ms | 42 | 1:2000 |
| Fibronectin | Invitrogen/MA1198 | Ms | 250 | 1:1000 |
| Osteopontin | Sigma/07264 | Rb | 50 | 1:1000 |
| Cofilin | #ab 42824 | Rb | 20 | 1:2000 |
| IL-8 | Abcam/ab7747 | Rb | 11 | 1:500 |
| Collagen type IV | Abcam/ab52235 | Rb | 160 | 1:1000 |
| Ezrin | Cell Signaling #3145 | Rb | 81 | 1:500 |
| Moesin | Cell Signaling #3150 | Rb | 78 | 1:500 |
| Vinculin | Abcam/ab18058 | Ms | 124 | 1:1000 |
| ICAM 1 | Cell Signaling #4915S | Rb | 89–92 | 1:500 |
| GAPDH | Abcam/ab9384 | Rb | 37 | 1: 1000 |
| Gene | Primer Name | Sequence |
|---|---|---|
| 18S-rRNA | 18S-F | GGAGCCTGCGGCTTAATTT |
| 18S-R | CAACTAAGAACGGCCATGCA | |
| ACTB | ACTB-F | TGCCGACAGGATGCAGAAG |
| ACTB-R | GCCGATCCACACGGAGTACT | |
| CDH1 | CDH1-F | GCTGGACCGAGAGAGTTTCC |
| CDH1-R | CAGCTGTTGCTGTTGTGCTT | |
| CFL | CFL-F | GAAGGAGGATCTGGTGTTTATCTTCT |
| CFL-R | CCTTGGAGCTGGCATAAATCAT | |
| COL1A1 | COL1A1-F | ACGAAGACATCCCACCAATCAC |
| COL1A1-R | CGTTGTCGCAGACGCAGAT | |
| COL4A5 | COL4A5-F | GGTACCTGTAACTACTATGCCAACTCCTA |
| COL4A5-R | CGGCTAATTCGTGTCCTCAAG | |
| EZR | EZR-F | GCAATCCAGCCAAATACAACTG |
| EZR-R | CCACATAGTGGAGGCCAAAGTAC | |
| FAK1/PTK2 | FAK1-F | TGTGGGTAAACCAGATCCTGC |
| FAK1-R | CTGAAGCTTGACACCCTCGT | |
| FN1 | FN1-F | AGATCTACCTGTACACCTTGAATGACA |
| FN1-R | CATGATACCAGCAAGGAATTGG | |
| ICAM-1 | ICAM1-F | CGGCTGACGTGTGCAGTAAT |
| ICAM1-R | CTTCTGAGACCTCTGGCTTCGT | |
| IL6 | IL6-F | CGGGAACGAAAGAGAAGCTCTA |
| IL6-R | GAGCAGCCCCAGGGAGAA | |
| IL8/CXCL8 | IL8-F | TGGCAGCCTTCCTGATTTCT |
| IL8-R | GGGTGGAAAGGTTTGGAGTATG | |
| ITGB1 | ITGB1-F | GAAAACAGCGCATATCTGGAAATT |
| ITGB1-R | CAGCCAATCAGTGATCCACAA | |
| LOX | LOX-F | TGGGAATGGCACAGTTGTCA |
| LOX-R | AGCCACTCTCCTCTGGGTGTT | |
| MMP1 | MMP1-F | GTCAGGGGAGATCATCGGG |
| MMP1-R | GAGCATCCCCTCCAATACCTG | |
| MMP3 | MMP3-F | ACAAAGGATACAACAGGGACCAA |
| MMP3-R | TAGAGTGGGTACATCAAAGCTTCAGT | |
| MMP14 | MMP14-F | ACTTTATGGGGGTGAGTCAGG |
| MMP14-R | GATGTTGGGCCCATAGGTGG | |
| MSN | MSN-F | GAAATTTGTCATCAAGCCCATTG |
| MSN-R | CCATGCACAAGGCCAAGAT | |
| PFN1 | PFN-F | GGGAATTTAGCATGGATCTTCGT |
| PFN-R | ACCGTGGACACCTTCTTTGC | |
| SSP1 | SSP1-F | CGAGGTGATAGTGTGGTTTATGGA |
| SSP1-R | CGTCTGTAGCATCAGGGTACTG | |
| TGFB1 | TGFB1-F | CACCCGCGTGCTAATGGT |
| TGFB1-R | AGAGCAACACGGGTTCAGGTA | |
| TIMP1 | TIMP1-F | GCCATCGCCGCAGATC |
| TIMP1-R | GCTATCAGCCACAGCAACAACA | |
| TLN1 | TLN1-F | GATGGCTATTACTCAGTACAGACAACTGA |
| TLN1-R | CATAGTAGACTCCTCATCTCCTTCCA | |
| VCAM-1 | VCAM1--F | CATGGAATTCGAACCCAAACA |
| VCAM1-R | GGCTGACCAAGACGGTTGTATC | |
| VCL | VCL-F | GTCTCGGCTGCTCGTATCTT |
| VCL-R | GTCCACCAGCCCTGTCATTT |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kopp, S.; Krüger, M.; Bauer, J.; Wehland, M.; Corydon, T.J.; Sahana, J.; Nassef, M.Z.; Melnik, D.; Bauer, T.J.; Schulz, H.; et al. Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity. Int. J. Mol. Sci. 2018, 19, 4001. https://doi.org/10.3390/ijms19124001
Kopp S, Krüger M, Bauer J, Wehland M, Corydon TJ, Sahana J, Nassef MZ, Melnik D, Bauer TJ, Schulz H, et al. Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity. International Journal of Molecular Sciences. 2018; 19(12):4001. https://doi.org/10.3390/ijms19124001
Chicago/Turabian StyleKopp, Sascha, Marcus Krüger, Johann Bauer, Markus Wehland, Thomas J. Corydon, Jayashree Sahana, Mohamed Zakaria Nassef, Daniela Melnik, Thomas J. Bauer, Herbert Schulz, and et al. 2018. "Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity" International Journal of Molecular Sciences 19, no. 12: 4001. https://doi.org/10.3390/ijms19124001
APA StyleKopp, S., Krüger, M., Bauer, J., Wehland, M., Corydon, T. J., Sahana, J., Nassef, M. Z., Melnik, D., Bauer, T. J., Schulz, H., Schütte, A., Schmitz, B., Oltmann, H., Feldmann, S., Infanger, M., & Grimm, D. (2018). Microgravity Affects Thyroid Cancer Cells during the TEXUS-53 Mission Stronger than Hypergravity. International Journal of Molecular Sciences, 19(12), 4001. https://doi.org/10.3390/ijms19124001

