PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway
Abstract
:1. Introduction
2. Results
2.1. Porcine Tissue Expression Profile of PDGFRα
2.2. Identification of PDGFRα-Positive Cells in Porcine LD
2.3. Comparison on the Levels of PDGFRα in Different Ages and Types of Pigs
2.4. Time Course Expression of PDGFRα during Porcine IMF Preadipocyte Differentiation
2.5. Knockdown of Modulated-FoxO1 PDGFRα Inhibits Adipogenesis through Erk Signaling Pathway
2.6. miR-34a Represses Lipogenesis through Targeting PDGFRα
3. Discussion
4. Materials and Methods
4.1. Animal and Sample Collection
4.2. Cell Isolation and Culture
4.3. Real-Time Quantitative PCR
4.4. Western Blots
4.5. Frozen Section and HE Staining
4.6. Immunohistochemistry
4.7. Oil Red O and BODITY Staining
4.8. Vector Construction Interference
4.9. Lentivirus Package and Infection
4.10. Transfection of miRNA Mimics
4.11. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Fernandez, X.; Monin, G.; Talmant, A.; Mourot, J.; Lebret, B. Influence of intramuscular fat content on the quality of pig meat—1. Composition of the lipid fraction and sensory characteristics of M. longissimus lumborum. Meat Sci. 1999, 53, 59–65. [Google Scholar] [CrossRef]
- Hocquette, J.F.; Gondret, F.; Baeza, E.; Medale, F.; Jurie, C.; Pethick, D.W. Intramuscular fat content in meat-producing animals: Development, genetic and nutritional control, and identification of putative markers. Animal 2010, 4, 303–319. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.Y.; Liu, Y.Q.; Lai, X.S.; Kuang, S.H. Intramuscular adipose is derived from a non-Pax3 lineage and required for efficient regeneration of skeletal muscles. Dev. Biol. 2012, 361, 27–38. [Google Scholar] [CrossRef] [PubMed]
- Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef] [PubMed]
- Tang, W.; Zeve, D.; Suh, J.M.; Bosnakovski, D.; Kyba, M.; Hammer, R.E.; Tallquist, M.D.; Graff, J.M. White fat progenitor cells reside in the adipose vasculature. Science 2008, 322, 583–586. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.A.; Tao, C.; Gupta, R.K.; Scherer, P.E. Tracking adipogenesis during white adipose tissue development, expansion and regeneration. Nat. Med. 2013, 19, 1338–1344. [Google Scholar] [CrossRef] [PubMed]
- Rodeheffer, M.S.; Birsoy, K.; Friedman, J.M. Identification of white adipocyte progenitor cells in vivo. Cell 2008, 135, 240–249. [Google Scholar] [CrossRef] [PubMed]
- Berry, R.; Rodeheffer, M.S. Characterization of the adipocyte cellular lineage in vivo. Nat. Cell Biol. 2013, 15, 302–308. [Google Scholar] [CrossRef] [PubMed]
- Hoch, R.V.; Soriano, P. Roles of PDGF in animal development. Development 2003, 130, 4769–4784. [Google Scholar] [CrossRef] [PubMed]
- Chong, J.J.H.; Reinecke, H.; Iwata, M.; Torok-Storb, B.; Stempien-Otero, A.; Murry, C.E. Progenitor Cells Identified by PDGFR-Alpha Expression in the Developing and Diseased Human Heart. Stem Cells Dev. 2013, 22, 1932–1943. [Google Scholar] [CrossRef] [PubMed]
- Lemos, D.R.; Paylor, B.; Chang, C.; Sampaio, A.; Underhill, T.M.; Rossi, F.M.V. Functionally Convergent White Adipogenic Progenitors of Different Lineages Participate in a Diffused System Supporting Tissue Regeneration. Stem Cells 2012, 30, 1152–1162. [Google Scholar] [CrossRef] [PubMed]
- Shefer, G.; Wleklinski-Lee, M.; Yablonka-Reuveni, Z. Skeletal muscle satellite cells can spontaneously enter, an alternative mesenchymal pathway. J. Cell Sci. 2004, 117, 5393–5404. [Google Scholar] [CrossRef] [PubMed]
- Caplan, A.I. All MSCs are pericytes? Cell Stem Cell 2008, 3, 229–230. [Google Scholar] [CrossRef] [PubMed]
- Corselli, M.; Chen, C.W.; Crisan, M.; Lazzari, L.; Peault, B. Perivascular Ancestors of Adult Multipotent Stem Cells. Arterioscler. Thromb. Vasc. Biol. 2010, 30, 1104–1109. [Google Scholar] [CrossRef] [PubMed]
- Birbrair, A.; Zhang, T.; Wang, Z.M.; Messi, M.L.; Enikolopov, G.N.; Mintz, A.; Delbono, O. Role of Pericytes in Skeletal Muscle Regeneration and Fat Accumulation. Stem Cells Dev. 2013, 22, 2298–2314. [Google Scholar] [CrossRef] [PubMed]
- Starkey, J.D.; Yamamoto, M.; Yamamoto, S.; Goldhamer, D.J. Skeletal muscle satellite cells are committed to myogenesis and do not spontaneously adopt nonmyogenic fates. J. Histochem. Cytochem. 2011, 59, 33–46. [Google Scholar] [CrossRef] [PubMed]
- Uezumi, A.; Fukada, S.; Yamamoto, N.; Takeda, S.; Tsuchida, K. Mesenchymal progenitors distinct from satellite cells contribute to ectopic fat cell formation in skeletal muscle. Nat. Cell Biol. 2010, 12, 143–152. [Google Scholar] [CrossRef] [PubMed]
- Rana, T.M. Illuminating the silence understanding the structure and function of small RNAs. Nat. Rev. Mol. Cell Biol. 2007, 8, 23–36. [Google Scholar] [CrossRef] [PubMed]
- Garofalo, M.; Jeon, Y.J.; Nuovo, G.J.; Middleton, J.; Secchiero, P.; Joshi, P.; Alder, H.; Nazaryan, N.; Di Leva, G.; Romano, G.; et al. MiR-34a/c-Dependent PDGFR-alpha/beta Downregulation Inhibits Tumorigenesis and Enhances TRAIL-Induced Apoptosis in Lung Cancer. PLoS ONE 2013, 8, e67581. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Xu, J.; Hou, Z.L.; Wang, F.F.; Song, Y.L.; Wang, J.; Zhu, H.; Jin, H.B. miRNA-34a promotes proliferation of human pulmonary artery smooth muscle cells by targeting PDGFRA. Cell Prolif. 2016, 49, 484–493. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Guo, J.J.; Liu, Y.M.; Wu, X.L. MicroRNA-34A inhibits the growth, invasion and metastasis of gastric cancer by targeting PDGFR and MET expression. Biosci. Rep. 2014, 34, e00112. [Google Scholar] [CrossRef] [PubMed]
- Martins, R.; Lithgow, G.J.; Link, W. Long live FOXO: Unraveling the role of FOXO proteins in aging and longevity. Aging Cell 2016, 15, 196–207. [Google Scholar] [CrossRef] [PubMed]
- Van Der Heide, L.P.; Hoekman, M.F.; Smidt, M.P. The ins and outs of FoxO shuttling: Mechanisms of FoxO translocation and transcriptional regulation. Biochem. J. 2004, 380 Pt 2, 297–309. [Google Scholar] [CrossRef] [PubMed]
- Mei, Y.; Wang, Z.X.; Zhang, L.; Zhang, Y.R.; Li, X.Y.; Liu, H.H.; Ye, J.; You, H. Regulation of neuroblastoma differentiation by forkhead transcription factors FOXO1/3/4 through the receptor tyrosine kinase PDGFRA. Proc. Natl. Acad. Sci. USA 2012, 109, 4898–4903. [Google Scholar] [CrossRef] [PubMed]
- Benezech, C.; Mader, E.; Desanti, G.; Khan, M.; Nakamura, K.; White, A.; Ware, C.F.; Anderson, G.; Caamano, J.H. Lymphotoxin-beta receptor signaling through NF-kappaB2-RelB pathway reprograms adipocyte precursors as lymph node stromal cells. Immunity 2012, 37, 721–734. [Google Scholar] [CrossRef] [PubMed]
- Sejersen, H.; Sorensen, M.T.; Larsen, T.; Bendixen, E.; Ingvartsen, K.L. Liver protein expression in young pigs in response to a high-fat diet and diet restriction. J. Anim. Sci. 2013, 91, 147–158. [Google Scholar] [CrossRef] [PubMed]
- Farahani, R.M.; Xaymardan, M. Platelet-Derived Growth Factor Receptor Alpha as a Marker of Mesenchymal Stem Cells in Development and Stem Cell Biology. Stem Cells Int. 2015, 2015, 362753. [Google Scholar] [CrossRef] [PubMed]
- Ball, S.G.; Shuttleworth, C.A.; Kielty, C.M. Platelet-derived growth factor receptor-alpha is a key determinant of smooth muscle alpha-actin filaments in bone marrow-derived mesenchymal stem cells. Int. J. Biochem. Cell B 2007, 39, 379–391. [Google Scholar] [CrossRef] [PubMed]
- Schwab, C.R.; Baas, T.J.; Stalder, K.J.; Mabry, J.W. Deposition rates and accretion patterns of intramuscular fat, loin muscle area, and backfat of Duroc pigs sired by boars from two time periods. J. Anim. Sci. 2007, 85, 1540–1546. [Google Scholar] [CrossRef] [PubMed]
- Buser, J.C.; Nicod, B. Biochemical polymorphisms in the large white pig and the altered pig and their incidences in the Swiss breed. Schweiz. Arch. Tierheilkd. 1970, 112, 652–657. [Google Scholar] [PubMed]
- Serenius, T.; Sevon-Aimonen, M.L.; Kause, A.; Mantysaari, E.A.; Maki-Tanila, A. Genetic associations of prolificacy with performance, carcass, meat quality, and leg conformation traits in the Finnish Landrace and Large White pig populations. J. Anim. Sci. 2004, 82, 2301–2306. [Google Scholar] [CrossRef] [PubMed]
- Wood, J.D.; Nute, G.R.; Richardson, R.I.; Whittington, F.M.; Southwood, O.; Plastow, G.; Mansbridge, R.; da Costa, N.; Chang, K.C. Effects of breed, diet and muscle on fat deposition and eating quality in pigs. Meat Sci. 2004, 67, 651–667. [Google Scholar] [CrossRef] [PubMed]
- Ma, X.Q.; Lee, P.; Chisholm, D.J.; James, D.E. Control of adipocyte differentiation in different fat depots; implications for pathophysiology or therapy. Front. Endocrinol. 2015, 6, 1. [Google Scholar] [CrossRef] [PubMed]
- Bost, F.; Aouadi, M.; Caron, L.; Binetruy, B. The role of MAPKs in adipocyte differentiation and obesity. Biochimie 2005, 87, 51–56. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lee, S.; Dong, H.H. FoxO integration of insulin signaling with glucose and lipid metabolism. J. Endocrinol. 2017, 233, R67–R79. [Google Scholar] [CrossRef] [PubMed]
- Zou, P.; Liu, L.; Zheng, L.; Liu, L.; Stoneman, R.E.; Cho, A.; Emery, A.; Gilbert, E.R.; Cheng, Z. Targeting FoxO1 with AS1842856 suppresses adipogenesis. Cell Cycle 2014, 13, 3759–3767. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Zheng, L.D.; Zou, P.; Brooke, J.; Smith, C.; Long, Y.C.; Almeida, F.A.; Liu, D.; Cheng, Z. FoxO1 antagonist suppresses autophagy and lipid droplet growth in adipocytes. Cell Cycle 2016, 15, 2033–2041. [Google Scholar] [CrossRef] [PubMed]
- Addison, O.; Marcus, R.L.; Lastayo, P.C.; Ryan, A.S. Intermuscular fat: A review of the consequences and causes. Int. J. Endocrinol. 2014, 2014, 309570. [Google Scholar] [CrossRef] [PubMed]
- Komolka, K.; Albrecht, E.; Wimmers, K.; Michal, J.J.; Maak, S. Molecular heterogeneities of adipose depots—Potential effects on adipose-muscle cross-talk in humans, mice and farm animals. J. Genom. 2014, 2, 31–44. [Google Scholar] [CrossRef] [PubMed]
Gene | Forward (5′–3′) | Reverse (5′–3′) |
---|---|---|
PDGFRα | ACGACCACCACGGCTCTAAT | TTCTTAGCCAAGCATCGGACT |
FoxO1 | GCAAATCGAGTTACGGAGGC | AATGTCATTATGGGGAGGAGAGT |
PPARg | AGGACTACCAAAGTGCCATCAAA | GAGGCTTTATCCCCACAGACAC |
aP2 | GAGCACCATAACCTTAGATGGA | AAATTCTGGTAGCCGTGACA |
GAPDH | AGGTCGGAGTGAACGGATTTG | ACCATGTAGTGGAGGTCAATGAAG |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, Y.-M.; Qin, J.; Liu, S.-G.; Cai, R.; Chen, X.-C.; Wang, X.-M.; Pang, W.-J. PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway. Int. J. Mol. Sci. 2017, 18, 2424. https://doi.org/10.3390/ijms18112424
Sun Y-M, Qin J, Liu S-G, Cai R, Chen X-C, Wang X-M, Pang W-J. PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway. International Journal of Molecular Sciences. 2017; 18(11):2424. https://doi.org/10.3390/ijms18112424
Chicago/Turabian StyleSun, Yun-Mei, Jin Qin, Shu-Ge Liu, Rui Cai, Xiao-Chang Chen, Xiang-Ming Wang, and Wei-Jun Pang. 2017. "PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway" International Journal of Molecular Sciences 18, no. 11: 2424. https://doi.org/10.3390/ijms18112424
APA StyleSun, Y.-M., Qin, J., Liu, S.-G., Cai, R., Chen, X.-C., Wang, X.-M., & Pang, W.-J. (2017). PDGFRα Regulated by miR-34a and FoxO1 Promotes Adipogenesis in Porcine Intramuscular Preadipocytes through Erk Signaling Pathway. International Journal of Molecular Sciences, 18(11), 2424. https://doi.org/10.3390/ijms18112424