Rapid Microsatellite Marker Development Using Next Generation Pyrosequencing to Inform Invasive Burmese Python—Python molurus bivittatus—Management
Abstract
:1. Introduction
2. Results and Discussion
3. Experimental Section
3.1. Sample Preparation and 454 Pyrosequencing
3.2. Marker Selection
3.3. Marker Optimization
4. Conclusions
Supplementary Information
ijms-14-04793-s001.docxAcknowledgments
Conflict of Interest
References
- Hess, J.E.; Swalla, B.J.; Moran, P. New molecular markers to genetically differentiate populations of Didemnum vexilluman (Kott, 2002)—An invasive ascidian species. Aquatic Invasions 2008, 4, 299–310. [Google Scholar]
- King, T.L.; Eackles, M.S.; Chapman, D.C. Tools for assessing kinship, population structure, phylogeography, and interspecific hybridization in Asian carps invasive to the Mississippi River, USA: Isolation and characterization of novel tetranucleotide microsatellite DNA loci in silver carp Hypophthalmichthys molitrix. Conserv. Genet. Resour 2011, 3, 397–401. [Google Scholar]
- Richardson, M.F.; Stanley, A.M.; Sherman, C.D.H. Development of novel microsatellite markers for the invasive Northern Pacific seastar, Asterias amurensis. Conserv. Genet. Resour 2012, 4, 327–330. [Google Scholar]
- Santana, Q.C.; Coetzee, M.P.A.; Steenkamp, E.T.; Mlonyeni, O.X.; Hammond, G.N.A.; Wingfield, M.J.; Wingfield, B.D. Microsatellite discovery by deep sequencing of enriched genomic libraries. BioTechniques 2009, 46, 217–223. [Google Scholar]
- Zane, L.; Bargelloni, L.; Patarnello, T. Strategies for microsatellite isolation: A review. Mol. Ecol 2002, 11, 1–16. [Google Scholar]
- Andrés, J.A.; Bogdanowicz, S.M. Isolating Microsatellite Loci: Looking Back, Looking Ahead. In Molecular Methods for Evolutionary Genetics; Orgogozo, V., Rockman, M.V., Eds.; Humana Press: Clifton, NJ, USA, 2011; Volume 772, pp. 211–232. [Google Scholar]
- Saarinen, E.V.; Austin, J.D. When technology meets conservation: Increased microsatellite marker production using 454 genome sequencing on the endangered okaloosa darter (Etheostoma okaloosae). J. Hered 2010, 101, 784–788. [Google Scholar]
- Blair, C.; Jiménez-Arcos, V.; la Cruz, F.M.; Murphy, R. Using next-generation DNA sequencing for rapid microsatellite discovery in Mexican leaf-toed geckos (Phyllodactylus tuberculosus). Conserv. Genet. Resour 2012, 4, 807–810. [Google Scholar]
- Perry, J.C.; Rowe, L. Rapid microsatellite development for water striders by next-generation sequencing. J. Hered 2011, 102, 125–129. [Google Scholar]
- Frenkel, O.; Portillo, I.; Brewer, M.T.; Péros, J.P.; Cadle-Davidson, L.; Milgroom, M.G. Development of microsatellite markers from the transcriptome of Erysiphe necator for analysing population structure in North America and Europe. Plant Pathol 2012, 61, 106–119. [Google Scholar]
- Castoe, T.A.; Poole, A.W.; Gu, W.J.; de Koning, A.P.J.; Daza, J.M.; Smith, E.N.; Pollock, D.D. Rapid identification of thousands of copperhead snake (Agkistrodon contortrix) microsatellite loci from modest amounts of 454 shotgun genome sequence. Mol. Ecol. Resour 2010, 10, 341–347. [Google Scholar]
- Castoe, T.A.; Poole, A.W.; de Koning, A.P.J.; Jones, K.L.; Tomback, D.F.; Oyler-McCance, S.J.; Fike, J.A.; Lance, S.L.; Streicher, J.W.; Smith, E.N.; et al. Rapid microsatellite identification from Illumina paired-end genomic sequencing in two birds and a snake. Plos One 2012, 7, e30953. [Google Scholar]
- Castoe, T.A.; Streicher, J.W.; Meik, J.M.; Ingrasci, M.J.; Poole, A.W.; de Koning, A.P.J.; Campbell, J.A.; Parkinson, C.L.; Smith, E.N.; Pollock, D.D. Thousands of microsatellite loci from the venomous coralsnake Micrurus fulvius and variability of select loci across populations and related species. Mol. Ecol. Resour 2012, 12, 1105–1113. [Google Scholar]
- Primmer, C.R.; Painter, J.N.; Koskinen, M.T.; Palo, J.U.; Merila, J. Factors affecting avian cross-species microsatellite amplification. J. Avian Biol 2005, 36, 348–360. [Google Scholar]
- Hunter, M.; Broderick, D.; Ovenden, J.R.; Tucker, K.P.; Bonde, R.K.; McGuire, P.M.; Lanyon, J.M. Characterization of highly informative cross-species microsatellite panels for the Australian dugong (Dugong dugon) and Florida manatee (Trichechus manatus latirostris) including five novel primers. Mol. Ecol. Resour 2010, 10, 368–377. [Google Scholar]
- Jacobs, H.J.; Auliya, M.; Böhme, W. Zur Taxonomie des Dunklen Tigerpythons, Python molurus bivittatus Kuhl, 1820, speziell der Population von Sulawesi. Sauria 2009, 31, 5–16. [Google Scholar]
- Snow, R.W.; Krysko, K.L.; Enge, K.M.; Oberhofer, L.; Warren-Bradley, A.; Wilkins, L. Introduced Populations of Boa constrictor (Boidae) and Python molurus bivittatus (Pythonidae) in Southern Florida. In Biology of the Boas and Pythons; Henderson, R.W., Powell, R., Eds.; Eagle Mountain Publishing: Eagle Mountain, UT, USA, 2007; pp. 416–438. [Google Scholar]
- Willson, J.D.; Dorcas, M.E.; Snow, R.W. Identifying plausible scenarios for the establishment of invasive Burmese pythons (Python molurus) in Southern Florida. Biol. Invasions 2011, 13, 1493–1504. [Google Scholar]
- Collins, T.; Freeman, B.; Snow, S. Final Report: Genetic characterization of populations of the nonindigenous Burmese python in Everglades National Park; Final report for the South Florida Water Management District; Department of Biological Sciences, Florida International University: Miami, Florida, 2008. [Google Scholar]
- Crabbe, N. Giant python had 87 eggs: Points to challenge of nonnative species. The Gainesville Sun 2012. [Google Scholar]
- Reed, R.; Rodda, G. Giant Constrictors: Biological and Management Profiles and An Establishment Risk Assessment for Nine Large Species of Pythons, Anacondas, and The Boa Constrictor; U.S. Geological Survey Open-File Report 2009-1202; US Geological Survey: Reston, VA, USA, 2009. [Google Scholar]
- Dorcas, M.E.; Willson, J.D.; Reed, R.N.; Snow, R.W.; Rochford, M.R.; Miller, M.A.; Meshaka, W.E.; Andreadis, P.T.; Mazzotti, F.J.; Romagosa, C.M.; et al. Severe mammal declines coincide with proliferation of invasive Burmese pythons in Everglades National Park. Proc. Natl. Acad. Sci. USA 2012, 109, 2418–2422. [Google Scholar]
- Snow, R.W.; Brien, M.L.; Cherkiss, M.S.; Wilkins, L.; Mazzotti, F.J. Dietary habits of Burmese python, Python molurus bivittatus, from Everglades National Park, Florida. Herpetol. Bull 2007, 101, 5–7. [Google Scholar]
- Reed, R.N. An ecological risk assessment of nonnative boas and pythons as potentially invasive species in the United States. Risk Anal 2005, 25, 753–766. [Google Scholar]
- Faircloth, B.C. MSATCOMMANDER: Detection of microsatellite repeat arrays and automated, locus-specific primer design. Mol. Ecol. Resour 2008, 8, 92–94. [Google Scholar]
- Jordan, P.W.; Goodman, A.E.; Donnellan, S. Microsatellite primers for Australian and New Guinean pythons isolated with an efficient marker development method for related species. Mol. Ecol. Notes 2002, 2, 78–82. [Google Scholar]
- Stuart, B.; Nguyen, T.Q.; Thy, N.; Grismer, L.; Chan-Ard, T.; Iskandar, D.; Golynsky, E.; Lau, M.W.N. IUCN Red List of Threatened Species. Available online: http://www.iucnredlist.org accessed on 9 August 2012.
- Buschiazzo, E. The rise, fall and renaissance of microsatellites in eukaryotic genomes. Bioessays 2006, 28, 1040–1050. [Google Scholar]
- Kelkar, Y.D.; Tyekucheva, S.; Chiaromonte, F.; Makova, K.D. The genome-wide determinants of human and chimpanzee microsatellite evolution. Genome Res 2008, 18, 30–38. [Google Scholar]
- Lepais, O.; Bacles, C.F.E. De novo discovery and multiplexed amplification of microsatellite markers for black alder (Alnus glutinosa) and related species using SSR-enriched shotgun pyrosequencing. J. Hered 2011, 102, 627–632. [Google Scholar]
- Rozen, S.; Skaletsky, H. Primer3 on the WWW for General Users and for Biologist Programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Serapion, J.; Kucuktas, H.; Feng, J.A.; Liu, Z.J. Bioinformatic mining of type I microsatellites from expressed sequence tags of channel catfish (Ictalurus punctatus). Mar. Biotechnol 2004, 6, 364–377. [Google Scholar]
- Holleley, C.E.; Geerts, P.G. Multiplex Manager 1.0: A cross-platform computer program that plans and optimizes multiplex PCR. BioTechniques 2009, 46, 511–517. [Google Scholar]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar]
- Raymond, M.; Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Hered 1995, 86, 248–249. [Google Scholar]
- Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.M.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar]
- Wilberg, M.J.; Dreher, B.P. GENECAP: A program for analysis of multilocus genotype data for non-invasive sampling and capture-recapture population estimation. Mol. Ecol. Notes 2004, 4, 783–785. [Google Scholar]
- Paetkau, D.; Strobeck, C. Microsatellite analysis of genetic variation in black bear populations. Mol. Ecol 1994, 3, 489–495. [Google Scholar]
- Evett, I.W.; Weir, B.S. Interpreting DNA Evidence: Statistical Genetics for Forensic Scientists; Sinauer Associates, Inc: Sunderland, MA, USA, 1998; p. 278. [Google Scholar]
Repeat motif | Repeats/locus | Sequenced loci | Loci with designed primers | Compound loci | Compound/Interrupted loci |
---|---|---|---|---|---|
Dinucleotide | All (≥6) | 2411 | 423 | 8 | 38 |
≥10 | 868 | 55 | - | 7 | |
≥20 | 70 | - | - | - | |
Trinucleotide | All (≥4) | 2134 | 334 | 29 | 48 |
≥10 | 341 | 12 | 11 | 4 | |
≥20 | 12 | - | 0 | - | |
Tetranucleotide | All (≥4) | 2071 | 447 | 27 | 56 |
≥10 | 624 | 90 | 8 | 11 | |
≥20 | 20 | 4 | - | - |
Locus | Repeat motif | Primer sequence (5′-3′) | Dye | Allele range | MP | Ta | Na | Ne | Ho | He | P. sebae | P. regius |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Pmb-A01 | (CCT)7 | F: AAGCTGCTGATGTCCAGGC | 6-FAM | 246–249 | MP4 | 59 | 2 | 1.98 | 0.50 | 0.51 | 1 | X |
R: ATGGCTATCTCCGCTGTCC | 246 | |||||||||||
Pmb-B02 | (ACAT)8 | F: GGAGTTCTGTTCTACAGGTGC | HEX | 234–242 | MP2 | 61 | 3 | 2.74 | 0.55 | 0.65 | X | X |
R: TGTGCCTTCAAATCCAGCG | ||||||||||||
Pmb-D04 | (CATT)12 | F: TCATCAACCTGAGCCAACAG | 6-FAM | 307–323 | MP2 | 61 | 4 | 2.84 | 0.60 | 0.66 | 1 | 2 |
R: GAGCAATTGGGAGTCAGGC | 312 | 258 | ||||||||||
Pmb-F06 | (ACAT)11 | F: TCAAACTCTCAGGCCTCTGG | HEX | 266–274 | MP3 | 62 | 2 | 1.60 | 0.40 | 0.38 | 2 | X |
R: ATAGGGTCCATGGGAGCAG | 263 | |||||||||||
Pmb-G07 | (GAT)15 | F: TCTCTGGAATCAGGCAGAACC | HEX | 169–183 | MP8 | 62 | 3 | 2.66 | 0.60 | 0.64 | X | X |
R: ATCCCTCCAGACACACACC | ||||||||||||
Pmb-J10 | (ATGT)10 | F: TCCTCGGCTGACTTCCTTG | 6-FAM | 305–309 | MP5 | 60 | 2 | 1.96 | 0.55 | 0.50 | 1 | X |
R: TCCATCTAACGACCCTTGC | 314 | |||||||||||
Pmb-K11 | (AGAT)14 | F: TTTGCTGCCCAGAGTTGTC | FAM | 194–202 | MP6 | 57 | 3 | 2.87 | 0.65 | 0.67 | 3 | 2 |
R: AGCAGTTTGACCTCATTCCAG | 186 | 182 | ||||||||||
Pmb-L12 | (ATC)12 | F: GCCACGTCTAAGGTTGAGC | HEX | 157–169 | MP6 | 57 | 4 | 2.37 | 0.55 | 0.59 | 2 | 2 |
R: AAAGCAGGTCTCTGTTGGG | 146 | 142 | ||||||||||
Pmb-N14 | (GAT)13 | F: TTGGTAGTGGTGGTGGTGG | 6-FAM | 207–216 | MP3 | 62 | 4 | 3.04 | 0.60 | 0.69 | 3 | 2 |
R: GGCTGGCTGCTACTGAAAC | 148 | 188 | ||||||||||
Pmb-O15 | (AATC)7 | F: TAGAGGGCAGTTTGGACCC | 6-FAM | 184–196 | MP2 | 61 | 3 | 2.82 | 0.60 | 0.66 | X | 3 |
R: ATGGGCACACTTTGAAGCC | 190 | |||||||||||
Pmb-Q17 | (AAAT)11 | F: CTGTTCTACCTGACAACTTCCC | HEX | 154–182 | MP3 | 62 | 5 | 4.02 | 0.80 | 0.77 | 2 | 1 |
R: TCTAGCCCAAGTGACAGGAAC | 106 | 163 | ||||||||||
Pmb-R18 | (ATTT)10 | F: AGCAGCCCACGTAGAGTATG | 6-FAM | 189–221 | MP5 | 60 | 4 | 2.86 | 0.65 | 0.67 | X | 2 |
R: GGTCACCAAGATGGTTGGG | 187 | |||||||||||
Pmb-S19 | (ATTT)11 | F: AGCTAGTAAGCATAGGGAAGGC | NED | 160–172 | MP2 | 61 | 3 | 1.87 | 0.60 | 0.48 | X | X |
R: TCCTTTGTTGAAATGGGTGGC | ||||||||||||
Pmb-T20 | (AGG)8 | F: GGGTTCGCTACTTTTCCGC | 6-FAM | 226–233 | MP8 | 62 | 3 | 1.70 | 0.35 | 0.42 | X | X |
R: TTCGCCTCACCCTTTCTGG | ||||||||||||
Pmb-U21 | (AATG)11 | F: GGAGTTTAGCGAAGTTGGGC | 6-FAM | 252–285 | MP2 | 60 | 4 | 2.64 | .025 | 0.64 | X | 3 |
R: CAGTCTAAGCTATGACCTTGGG | 190 | |||||||||||
Pmb-V22 | (ATTT)7 | F: TCGGATGTGGCACTGAAGG | HEX | 233–253 | MP5 | 60 | 4 | 2.12 | 0.60 | 0.54 | 1 | 3 |
R: GCCCAATGTGTGACAAGGC | 220 | 184 | ||||||||||
Pmb-W23 | (AATG)13 | F: AGCCACAATAAGCAATGTAGGTC | NED | 156–168 | MP4 | 59 | 4 | 3.94 | 0.75 | 0.77 | 1 | 2 |
R: CCAAGTTACACTCTTCCATGTTCC | 170 | 142 | ||||||||||
Pmb-Z26 | (CATT)10 | F: ATGCCAAGGTATCAGGGCTC | NED | 148–160 | MP5 | 60 | 4 | 2.81 | 0.55 | 0.66 | 1 | 3 |
R: AGCTAGAGCTCAATTCTCCAG | 150 | 143 |
Locus | Dye | Allele range | MP | Ta | Na | Ne | Ho | He | P. sebae | P. regius | ||
---|---|---|---|---|---|---|---|---|---|---|---|---|
Na | Allele size | Na | Allele size | |||||||||
MS9 | 6-FAM | 177–194 | MP1 | 54 | 5 | 2.27 | 0.60 | 0.57 | 2 | 168 | 3 | 172 |
MS10 | HEX | 218–238 | MP4 | 59 | 5 | 2.08 | 0.60 | 0.53 | 1 | 249 | 3 | 189 |
MS11 | HEX | 344–400 | MP7 | 57 | 6 | 2.80 | 0.85 | 0.66 | X | - | 3 | 447 |
MS13 | HEX | 176–198 | MP7 | 57 | 3 | 2.53 | 0.55 | 0.62 | X | - | 4 | 243 |
MS16 | 6-FAM | 355–383 | MP6 | 57 | 4 | 3.14 | 0.75 | 0.70 | 1 | 343 | 3 | 351 |
MS22 | 6-FAM | 394–423 | MP4 | 59 | 4 | 3.07 | 0.60 | 0.69 | X | - | 2 | 349 |
© 2013 by the authors; licensee MDPI, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Hunter, M.E.; Hart, K.M. Rapid Microsatellite Marker Development Using Next Generation Pyrosequencing to Inform Invasive Burmese Python—Python molurus bivittatus—Management. Int. J. Mol. Sci. 2013, 14, 4793-4804. https://doi.org/10.3390/ijms14034793
Hunter ME, Hart KM. Rapid Microsatellite Marker Development Using Next Generation Pyrosequencing to Inform Invasive Burmese Python—Python molurus bivittatus—Management. International Journal of Molecular Sciences. 2013; 14(3):4793-4804. https://doi.org/10.3390/ijms14034793
Chicago/Turabian StyleHunter, Margaret E., and Kristen M. Hart. 2013. "Rapid Microsatellite Marker Development Using Next Generation Pyrosequencing to Inform Invasive Burmese Python—Python molurus bivittatus—Management" International Journal of Molecular Sciences 14, no. 3: 4793-4804. https://doi.org/10.3390/ijms14034793