Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells
Abstract
1. Introduction
2. Results and Discussion
2.1. Ginsenoside Inhibits the Proliferation of A549 Cells Under Serum Starvation
2.2. Ginsenoside Induces the Apoptosis of A549 Cells Under Serum Starvation
2.3. Network Pharmacology Analysis of Ginsenosides
2.4. Bioinformatics Analysis of Ginsenosides
2.5. Ginsenoside Promotes the Apoptosis of A549 Cells by Regulating Key Molecules in the PI3K/Akt/FoxO Signaling Pathway Under Serum Starvation
2.6. Ginsenosides Decreased the Mitochondrial Membrane Potential of A549 Cells Under Serum Starvation
3. Materials and Methods
3.1. Materials
3.2. Culture of A549 Cells
3.3. Cell Viability Assay
3.4. Hoechst 33258 Staining Detection
3.5. Flow Cytometry Assays
3.6. Bioinformatics Analysis
3.7. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)
3.8. Mitochondrial Membrane Potential Measurement
3.9. Statistics and Analysis
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
| Akt | Protein kinase B |
| Bim | Bcl-2-like protein 11 |
| CDK4 | Cyclin-dependent kinase 4 |
| FoxO | Forkhead box O |
| HES1 | Hairy and enhancer of split 1 |
| ITC | Isothermal titration calorimetry |
| JNK | c-Jun N-terminal kinase |
| MAPKs | Mitogen-activated protein kinases |
| NSCLC | Non-small-cell lung cancer |
| Notch | Neurogenic locus notch homolog protein |
| PI3K | Phosphoinositide 3-kinase |
| p53 | Tumor protein 53 |
References
- Du, T.; Li, H.; Fan, Y.; Yuan, L.; Guo, X.; Zhu, Q.; Yao, Y.; Li, X.; Liu, C.; Yu, X. The deubiquitylase OTUD3 stabilizes GRP78 and promotes lung tumorigenesis. Nat. Commun. 2019, 10, 2914. [Google Scholar] [CrossRef] [Scilit]
- Voorn, M.J.; Bongers, B.C.; van Kampen-van den Boogaart, V.E.; Driessen, E.J.; Janssen-Heijnen, M.L. Feasibility of rehabilitation during chemoradiotherapy among patients with stage III non-small cell lung cancer: A proof-of-Concept study. Cancers 2022, 14, 2387. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.-Y.; Huan, M.-L.; Wang, W.; Jia, Z.-Y.; Wan, Y.-H.; Zhou, S.-Y.; Zhang, B.-L. Tumor microenvironment and redox dual stimuli-responsive polymeric nanoparticles for the effective cisplatin-based cancer chemotherapy. Nanotechnology 2022, 34, 035101. [Google Scholar] [CrossRef] [Scilit]
- Zhang, S.; Zheng, F.; Liu, K.; Liu, S.; Xiao, T.; Zhu, Y.; Xu, L. Mitochondria-Targeting polymer micelles in stepwise response releasing gemcitabine and destroying the mitochondria and nucleus for combined antitumor chemotherapy. Int. J. Mol. Sci. 2022, 23, 12624. [Google Scholar] [CrossRef] [Scilit]
- Kazakova, O.; Smirnova, I.; Tret’yakova, E.; Csuk, R.; Hoenke, S.; Fischer, L. Cytotoxic potential of a-azepano-and 3-amino-3, 4-seco-triterpenoids. Int. J. Mol. Sci. 2021, 22, 1714. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- She, L.; Tang, H.; Zeng, Y.; Li, L.; Xiong, L.; Sun, J.; Chen, F.; Ren, J.; Zhang, J.; Wang, W.; et al. Ginsenoside RK3 promotes neurogenesis in Alzheimer’s disease through activation of the CREB/BDNF pathway. J. Ethnopharmacol. 2024, 321, 117462. [Google Scholar] [CrossRef] [Scilit]
- Zhou, H.; Liu, Y.; Su, Y.; Ji, P.; Kong, L.; Sun, R.; Zhang, D.; Xu, H.; Li, W.; Li, W. Ginsenoside Rg1 attenuates lipopolysaccharide-induced chronic liver damage by activating Nrf2 signaling and inhibiting inflammasomes in hepatic cells. J. Ethnopharmacol. 2024, 324, 117794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, Q.; Li, G.; Zu, Y.; Xu, Y.; Wang, C.; Xiang, D.; He, W.; Shang, T.; Cheng, X.; Liu, D.; et al. Ginsenoside Rg1 alleviates ANIT-induced cholestatic liver injury by inhibiting hepatic inflammation and oxidative stress via SIRT1 activation. J. Ethnopharmacol. 2024, 319, 117089. [Google Scholar] [CrossRef] [Scilit]
- Hu, Q.-R.; Hong, H.; Zhang, Z.-H.; Feng, H.; Luo, T.; Li, J.; Deng, Z.-Y.; Chen, F. Methods on improvements of the poor oral bioavailability of ginsenosides: Pre-processing, structural modification, drug combination, and micro-or nano-delivery system. J. Ginseng Res. 2023, 47, 694–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, H.; Xue, Q.; Zhang, Q.; Li, C.; Liu, X.; Liu, J.; Li, H.; Yang, J. How Ginsenosides Trigger Apoptosis in Human Lung Adenocarcinoma Cells. Am. J. Chin. Med. 2019, 47, 1737–1754. [Google Scholar] [CrossRef] [Scilit]
- Li, K.; Li, J.; Li, Z.; Men, L.; Zuo, H.; Gong, X. Cisplatin-based combination therapies: Their efficacy with a focus on ginsenosides co-administration. Pharmacol. Res. 2024, 203, 107175. [Google Scholar] [CrossRef] [Scilit]
- Zheng, R.; Rao, Y.; Jiang, H.; Liu, X.; Zhu, X.; Li, J.; Xu, J. Therapeutic potential of Ginsenoside Rg3 via inhibiting Notch/HES1 pathway in lung cancer cells. Transl. Cancer Res. 2016, 5, 464–469. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Sun, Y.; Yue, L.; Li, S.; Qi, X.; Zhao, H.; Yang, Y.; Zhang, C.; Yu, H. JNK pathway and relative transcriptional factor were involved in ginsenoside Rh2-mediated G1 growth arrest and apoptosis in human lung adenocarcinoma A549 cells. Genet. Mol. Res. 2016, 15, 1–13. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Zhou, T.; Ma, C.Y.; Song, W.W.; Zhang, J.; Yu, Z.X. Ginsenoside metabolite compound K enhances the efficacy of cisplatin in lung cancer cells. J. Thorac. Dis. 2015, 7, 400. [Google Scholar]
- Li, Z.; Li, J.; Sun, M.; Men, L.; Wang, E.; Zhao, Y.; Li, K.; Gong, X. Analysis of metabolites and metabolism-mediated biological activity assessment of ginsenosides on microfluidic co-culture system. Front. Pharmacol. 2023, 14, 1046722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Wang, P.; Qin, Z.; Yang, X.; Pan, B.; Nie, F.; Bi, H. Altered glucose metabolism and cell function in keloid fibroblasts under hypoxia. Redox Biol. 2021, 38, 101815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shen, X.; Zhong, J.; He, J.; Han, J.; Chen, N. Identification of m6A modification patterns and development of m6A–hypoxia prognostic signature to characterize tumor microenvironment in triple-negative breast cancer. Front. Immunol. 2022, 13, 978092. [Google Scholar] [CrossRef] [Scilit]
- Takahashi, T.; Ando, Y.; Ichikawa, H.; Tsuneyama, K.; Hijikata, T. Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1. FEBS J. 2023, 290, 4126–4144. [Google Scholar] [CrossRef] [Scilit]
- Yousaf, I.; Kaeppler, J.; Frost, S.; Seymour, L.W.; Jacobus, E.J. Attenuation of the hypoxia inducible factor pathway after oncolytic adenovirus infection coincides with decreased vessel perfusion. Cancers 2020, 12, 851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Raja, R.; Lata, S.; Trivedi, S.; Banerjea, A.C. Serum deprivation/starvation leads to reactivation of HIV-1 in latently infected monocytes via activating ERK/JNK pathway. Sci. Rep. 2018, 8, 14496. [Google Scholar] [CrossRef] [Scilit]
- Ahmadiankia, N. In vitro and in vivo studies of cancer cell behavior under nutrient deprivation. Cell Biol. Int. 2020, 44, 1588–1597. [Google Scholar] [CrossRef] [Scilit]
- Searle, B.C.; Pino, L.K.; Egertson, J.D.; Ting, Y.S.; Lawrence, R.T.; MacLean, B.X.; Villén, J.; MacCoss, M.J. Chromatogram libraries improve peptide detection and quantification by data independent acquisition mass spectrometry. Nat. Commun. 2018, 9, 5128. [Google Scholar] [CrossRef] [Scilit]
- Smith, A.S.; Luttrell, S.M.; Dupont, J.-B.; Gray, K.; Lih, D.; Fleming, J.W.; Cunningham, N.J.; Jepson, S.; Hesson, J.; Mathieu, J. High-throughput, real-time monitoring of engineered skeletal muscle function using magnetic sensing. J. Tissue Eng. 2022, 13, 20417314221122127. [Google Scholar] [CrossRef] [Scilit]
- Postnikova, E.; Cong, Y.; DeWald, L.E.; Dyall, J.; Yu, S.; Zhou, H.; Gross, R.; Logue, J.; Cai, Y.; Deiuliis, N. Testing therapeutics in cell-based assays: Factors that influence the apparent potency of drugs. PLoS ONE 2018, 13, e0194880. [Google Scholar] [CrossRef] [Scilit]
- Shi, Y.; Felley-Bosco, E.; Marti, T.M.; Orlowski, K.; Pruschy, M.; Stahel, R.A. Starvation-induced activation of ATM/Chk2/p53 signaling sensitizes cancer cells to cisplatin. BMC Cancer 2012, 12, 571. [Google Scholar] [CrossRef] [Scilit]
- Ji, K.-Y.; Kim, K.M.; Kim, Y.H.; Shim, K.-S.; Lee, J.Y.; Kim, T.; Chae, S. Serum Starvation Sensitizes Anticancer Effect of Anemarrhena asphodeloides via p38/JNK-Induced Cell Cycle Arrest and Apoptosis in Colorectal Cancer Cells. Am. J. Chin. Med. 2021, 49, 1001–1016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Simanurak, O.; Pekthong, D.; Somran, J.; Wangteeraprasert, A.; Srikummool, M.; Kaewpaeng, N.; Parhira, S.; Srisawang, P. Enhanced apoptosis of HCT116 colon cancer cells treated with extracts from Calotropis gigantea stem bark by starvation. Heliyon 2023, 9, e18013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, M.; Wu, W.; Li, L.; He, J.; Huang, S.; Chen, S.; Chen, J.; Long, M.; Yang, S.; Li, P. Analysis of the miRNA expression profiles in the zearalenone-exposed TM3 Leydig cell line. Int. J. Mol. Sci. 2019, 20, 635. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Q.; Zhao, W.; Wu, C.; Wang, X.; Chen, J.; Shi, X.; Sha, S.; Li, J.; Liang, X.; Yang, Y. Lemon-Derived Extracellular Vesicles Nanodrugs Enable to Efficiently Overcome Cancer Multidrug Resistance by Endocytosis-Triggered Energy Dissipation and Energy Production Reduction. Adv. Sci. 2022, 9, 2105274. [Google Scholar] [CrossRef] [Scilit]
- Ma, D.; Qin, Y.; Huang, C.; Chen, Y.; Han, Z.; Zhou, X.; Liu, H. Circular RNA ABCB10 promotes non-small cell lung cancer progression by increasing E2F5 expression through sponging miR-584-5p. Cell Cycle 2020, 19, 1611–1620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maemondo, M.; Inoue, A.; Kobayashi, K.; Sugawara, S.; Oizumi, S.; Isobe, H.; Gemma, A.; Harada, M.; Yoshizawa, H.; Kinoshita, I. Gefitinib or chemotherapy for non–small-cell lung cancer with mutated EGFR. N. Engl. J. Med. 2010, 362, 2380–2388. [Google Scholar] [CrossRef] [Scilit]
- Sun, X.; Zhao, P.; Li, H.; Liu, Y.; Wang, T.; Cheng, Y. Ginsenoside Rh2 inhibits glycolysis through the STAT3/c-MYC axis in non-small-cell lung cancer. J. Oncol. 2021, 2021, 9715154. [Google Scholar] [CrossRef] [Scilit]
- Yang, L.; Zhang, Z.; Hou, J.; Jin, X.; Ke, Z.; Liu, D.; Du, M.; Jia, X.; Lv, H. Targeted delivery of ginsenoside compound K using TPGS/PEG-PCL mixed micelles for effective treatment of lung cancer. Int. J. Nanomed. 2017, 12, 7653–7667. [Google Scholar] [CrossRef] [Scilit]
- Xie, Q.; Wen, H.; Zhang, Q.; Zhou, W.; Lin, X.; Xie, D.; Liu, Y. Inhibiting PI3K-AKt signaling pathway is involved in antitumor effects of ginsenoside Rg3 in lung cancer cell. Biomed. Pharmacother. 2017, 85, 16–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.; Xiao, S.N.; Yuan, W.H.; Cui, J.M.; Su, G.Y.; Zhao, Y.Q. Synthesis and Anticancer Activity Evaluation of Hydrolyzed Derivatives of Panaxnotoginseng Saponins. Molecules 2018, 23, 3021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Bian, S.; Wang, S.; Yang, S.; Zhang, W.; Zhao, D.; Liu, M.; Bai, X. Ginsenoside Rh2 represses autophagy to promote cervical cancer cell apoptosis during starvation. Chin. Med. 2020, 15, 118. [Google Scholar] [CrossRef] [Scilit]
- Bian, S.; Zhao, Y.; Li, F.; Lu, S.; Wang, S.; Bai, X.; Liu, M.; Zhao, D.; Wang, J.; Guo, D. 20(S)-Ginsenoside Rg3 Promotes HeLa Cell Apoptosis by Regulating Autophagy. Molecules 2019, 24, 3655. [Google Scholar] [CrossRef] [Scilit]
- Goldbraikh, D.; Neufeld, D.; Eid-Mutlak, Y.; Lasry, I.; Gilda, J.E.; Parnis, A.; Cohen, S. USP1 deubiquitinates Akt to inhibit PI 3K-Akt-FoxO signaling in muscle during prolonged starvation. EMBO Rep. 2020, 21, e48791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, Y.; Yang, J.; Liu, Q.; Cai, J.; Zheng, Y.; Zhang, Y.; Yu, D.; Liu, H.; Zhang, Z. IGF1 Knockdown hinders myocardial development through energy metabolism dysfunction caused by ROS-dependent FOXO activation in the chicken heart. Oxid. Med. Cell. Longev. 2019, 2019, 7838754. [Google Scholar] [CrossRef] [Scilit]
- Tsuji, T.; Maeda, Y.; Kita, K.; Murakami, K.; Saya, H.; Takemura, H.; Inaki, N.; Oshima, M.; Oshima, H. FOXO3 is a latent tumor suppressor for FOXO3-positive and cytoplasmic-type gastric cancer cells. Oncogene 2021, 40, 3072–3086. [Google Scholar] [CrossRef] [Scilit]
- Yu, W.-N.; Nogueira, V.; Sobhakumari, A.; Patra, K.C.; Bhaskar, P.T.; Hay, N. Systemic Akt1 deletion after tumor onset in p53−/− mice increases lifespan and regresses thymic lymphoma emulating p53 restoration. Cell Rep. 2015, 12, 610–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lee, C.M.; Lee, J.; Nam, M.J.; Park, S.-H. Indole-3-carbinol induces apoptosis in human osteosarcoma MG-63 and U2OS cells. BioMed Res. Int. 2018, 2018, 7970618. [Google Scholar] [CrossRef] [Scilit]
- Fu, Z.; Tindall, D. FOXOs, cancer and regulation of apoptosis. Oncogene 2008, 27, 2312–2319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kauerová, T.; Goněc, T.; Jampílek, J.; Hafner, S.; Gaiser, A.-K.; Syrovets, T.; Fedr, R.; Souček, K.; Kollar, P. Ring-substituted 1-hydroxynaphthalene-2-carboxanilides inhibit proliferation and trigger mitochondria-mediated apoptosis. Int. J. Mol. Sci. 2020, 21, 3416. [Google Scholar] [CrossRef] [Scilit]
- Kanwal, A.; Azeem, F.; Nadeem, H.; Ashfaq, U.A.; Aadil, R.M.; Kober, A.H.; Rajoka, M.S.R.; Rasul, I. Molecular Mechanisms of Cassia fistula against Epithelial Ovarian Cancer Using Network Pharmacology and Molecular Docking Approaches. Pharmaceutics 2022, 14, 1970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Safran, M.; Rosen, N.; Twik, M.; BarShir, R.; Stein, T.I.; Dahary, D.; Fishilevich, S.; Lancet, D. The genecards suite. In Practical Guide to Life Science Databases; Springer: Singapore, 2021; pp. 27–56. [Google Scholar] [CrossRef] [Scilit]
- Piñero, J.; Saüch, J.; Sanz, F.; Furlong, L.I. The DisGeNET cytoscape app: Exploring and visualizing disease genomics data. Comput. Struct. Biotechnol. J. 2021, 19, 2960–2967. [Google Scholar] [CrossRef] [Scilit]
- Venny, O.J. An Interactive Tool for Comparing Lists with Venn’s Diagrams. 2007–2015. 2016. Available online: https://bioinfogp.cnb.csic.es/tools/venny/index.html (accessed on 8 October 2024).
- Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P. The STRING database in 2021: Customizable protein–protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [Scilit]
- Kuang, W.; Yang, J.; Liu, Z.; Zeng, J.; Xia, X.; Chen, X.; Zhong, S.; Huang, R. Catechin mediates ferroptosis to exert an anti-inflammatory effect on RAW 264.7 cells. Foods 2022, 11, 1572. [Google Scholar] [CrossRef] [Scilit]
- Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New docking methods, expanded force field, and python bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef] [Scilit]







| Number | PubChem CID | Molecule Name | Degree |
|---|---|---|---|
| G1 | 9918693 | 20(S)-Ginsenoside Rg3 | 10 |
| G2 | 119307 | 20(S)-ginsenoside Rh2 | 10 |
| G3 | 9852086 | Ginsenoside CK | 9 |
| G4 | 118753486 | 20(S)-Ginsenoside Rh2 Metabolite M1-1 | 7 |
| G5 | 11213350 | 20(S)-Protopanaxadiol | 22 |
| G6 | 101228398 | Protopanaxadiol Oxide | 17 |
| G7 | 118753219 | 20(S)-Protopanaxadiol Metabolite M1-1 | 25 |
| G8 | 12314836 | 20(S)-Protopanaxadiol Metabolite M1-2 | 9 |
| G9 | 73352321 | 20(S)-Protopanaxadiol Metabolite M1-3 | 13 |
| Target Protein | PDB ID | Compound | Affinity (kcal/mol) | H Bonds |
|---|---|---|---|---|
| PI3K | 4BFR | Rg3(S) | −8.312 | ARG805 (2.0 Å, 2.6 Å) |
| Rh2(S) | −8.647 | ARG988 (2.1 Å, 2.8 Å), ASN992 (2.0 Å) | ||
| CK | −8.201 | ASN992 (2.0 Å), GLU1029 (2.7 Å), and LEU1024 (2.5 Å) | ||
| Akt | 6HHI | Rg3(S) | −7.475 | GLN404 (2.3 Å, 2.4 Å), ILE411 (2.1 Å), and TRP413 (2.2 Å) |
| Rh2(S) | −9.203 | GLU85 (2.5 Å), LYS297 (1.8 Å) | ||
| CK | −7.602 | ALA58 (2.7 Å) | ||
| FoxO | 7V9B | Rg3(S) | −8.223 | GLU134 (2.2 Å), SER64 (2.4 Å, 2.4 Å) |
| Rh2(S) | −8.342 | GLN16 (2.3 Å), GLU15 (2.2 Å) | ||
| CK | −7.486 | ARG61 (2.4 Å), ARG248 (2.7 Å), and SER64 (2.6 Å) |
| Gene | Forward Primers (From 5′ to 3′) | Reverse Primers (From 5′ to 3′) |
|---|---|---|
| PI3K | GGTTGGTGGCTGTTCTTACTGTC | CAAGTCTGGCTGGAATGATGCTAT |
| AKT | CCACTGTCATCGAACGCACCTT | GAAGTCCATCTCCTCCTCCTCCTG |
| FoxO3a | AGTTCCCTCATTCTGGACCC | CTTCAAGGATAAGGGCGACA |
| Bim | GATAGTGGTTGAAGGCCTGG | CCTCCCTACAGACAGAGCCA |
| Caspase-3 | TGCAGTCATTATGAGAGGCAAT | AAGGTTTGAGCCTTTGACCA |
| Caspase-8 | GAAGATAATCAACGACTATG | TTCACTATCCTGTTCTCT |
| Caspase-9 | ACATGCTGGCTTCGTTTCTG | TCTCAAGAGCACCGACATCA |
| β-actin | GCAAGCAGGAGTATGACGAG | CAAATAAAGCCATGCCAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, J.; Li, K.; Sun, M.; Gu, Z.; Men, L.; Gong, X.; Li, Z. Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules 2025, 30, 3697. https://doi.org/10.3390/molecules30183697
Li J, Li K, Sun M, Gu Z, Men L, Gong X, Li Z. Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules. 2025; 30(18):3697. https://doi.org/10.3390/molecules30183697
Chicago/Turabian StyleLi, Jiwen, Keke Li, Mei Sun, Zhihong Gu, Lei Men, Xiaojie Gong, and Zhongyu Li. 2025. "Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells" Molecules 30, no. 18: 3697. https://doi.org/10.3390/molecules30183697
APA StyleLi, J., Li, K., Sun, M., Gu, Z., Men, L., Gong, X., & Li, Z. (2025). Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules, 30(18), 3697. https://doi.org/10.3390/molecules30183697

