Next Article in Journal
Srtio3-Based Composites for Photocatalytic Panels in Solar Hydrogen Production
Next Article in Special Issue
Bioactive Aromatic Plant Extracts Modulate Metabolism and Inflammation in HeLa Cells
Previous Article in Journal
Utility of the Redox Cycle of Nitrofurantoin for the Development of a New Chemiluminescence Method for Its Analysis in Milk Samples
Previous Article in Special Issue
In Vitro and In Vivo Efficacy of the Essential Oil from the Leaves of Annona amazonica R.E. Fries (Annonaceae) Against Liver Cancer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells

1
School of Biological Engineering, Dalian Polytechnic University, Dalian 116034, China
2
College of Life Science, Dalian Minzu University, Dalian 116600, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Molecules 2025, 30(18), 3697; https://doi.org/10.3390/molecules30183697
Submission received: 4 August 2025 / Revised: 3 September 2025 / Accepted: 6 September 2025 / Published: 11 September 2025
(This article belongs to the Special Issue Advances and Opportunities of Natural Products in Drug Discovery)

Abstract

Lung cancer remains a leading cause of cancer-related mortality worldwide, where conventional chemotherapy is often limited by severe side effects and drug resistance. Ginsenosides, the primary bioactive triterpenoid saponins isolated from the root of Panax ginseng C. A. Mey, have demonstrated potential in combating non-small-cell lung cancer (NSCLC). However, their efficacy under nutrient-deficient conditions remains unclear. This study aimed to investigate the effects of ginsenosides on the growth and death of lung cancer cells under low-nutrient conditions and to explore the underlying mechanisms. A549 cells were divided into two groups: one cultured in 10% serum and another under serum-free conditions, followed by treatment with ginsenosides CK, Rh2(S), and Rg3(S) for 24 h. Cell proliferation and apoptosis were evaluated using a CCK-8 assay, Calcein/PI fluorescence staining, Hoechst 33258 staining, and flow cytometry. Potential targets and signaling pathways of ginsenosides were predicted using network pharmacology and bioinformatics analyses. The mRNA expression of key genes was measured by qRT-PCR, and mitochondrial membrane potential was assessed using JC-1 staining. The results showed that ginsenosides induced dose-dependent apoptosis in serum-starved A549 cells. Bioinformatics analysis suggested the involvement of the PI3K/Akt/FoxO signaling pathway, which was supported by decreased Akt mRNA levels and increased FoxO mRNA expression. Furthermore, mRNA levels of Bim, Caspase-3, Caspase-8, and Caspase-9 were significantly upregulated, accompanied by a loss of mitochondrial membrane potential. These findings indicate that under serum deprivation, ginsenosides enhance apoptosis in A549 cells, likely through the regulation of the PI3K/Akt/FoxO pathway.

Graphical Abstract

1. Introduction

Lung cancer represents a leading cause of cancer-related mortality worldwide, characterized by high mortality rates and poor prognoses [1]. It is categorized into two main types: small-cell lung cancer and non-small-cell lung cancer (NSCLC), with the latter constituting the majority, accounting for approximately 85% to 90% of all lung cancers [2]. Currently, chemotherapy remains the cornerstone of the clinical management of lung cancer. However, it is regrettable that commonly used chemotherapy drugs, such as cisplatin, exhibit serious side effects due to their lack of selectivity towards tumor cells [3]. Additionally, as treatment progresses, chemotherapy drugs frequently induce the development of drug resistance, significantly compromising their efficacy [4]. Hence, there is an urgent imperative to explore novel anti-lung cancer drugs capable of acting through novel mechanisms to overcome these challenges. The discovery of novel anti-lung cancer drugs from natural products is regarded as a promising approach [5].
Ginseng (Panax ginseng C. A. Mey) has been utilized for medicinal purposes for centuries in numerous Asian nations, including China, Japan, and South Korea [6]. The plant’s therapeutic properties are meticulously documented in Shen Nong’s Herbal Classic, one of the earliest pharmacological texts in China, highlighting its efficacy in nourishing the internal organs, sedating the nervous system, enhancing cognitive abilities, and prolonging life expectancy [7]. Contemporary medical research has substantiated the plant’s pharmacological activities, including anti-tumorigenic, antioxidative, and anti-inflammatory effects, which are recognized in the Chinese pharmacopoeia [8,9]. Of particular interest are the anti-tumor properties of specific ginsenosides, such as Rg3(S), Rh2(S), and CK, which have been validated in recent experimental and clinical research [10]. Notably, the ginsenoside Rg3 has been developed into an anti-tumor therapeutic agent, “ShenYi Capsule,” and has been incorporated into the National Comprehensive Cancer Network guidelines (2016) [11]. The induction of cancer cell apoptosis is considered one of the primary underlying mechanisms by which ginsenosides exert their anti-cancer effects. The ginsenoside Rg3 is able to trigger cell death in lung cancer cells by targeting the neurogenic locus notch homolog protein (Notch)/hairy and enhancer of split 1 (HES1) pathway and suppressing growth in NCI-H1650, H520, and H1963 cells [12]. The ginsenoside Rh2 stimulates the c-Jun N-terminal kinase (JNK)/mitogen-activated protein kinase (MAPK) signaling pathway, impacting the levels of the cell cycle proteins D1 and cyclin-dependent kinase 4 (CDK4), leading to cell cycle arrest at the G1 phase and subsequent cell death in A549 cells [13]. The ginsenoside CK significantly boosts the activity and expression of cisplatin-induced tumor protein 53 (p53) in H460 and A549 cells, resulting in combined cell death in synergy with cisplatin [14]. Previous research has demonstrated that these ginsenosides can trigger cell death to various extents in A549 cells [15].
Insufficient blood supply in solid tumors leads to changes in the intra-tumoral microenvironment, affecting the aggregation of essential nutrients, oxygen, and metabolic byproducts crucial for tumor cell survival [16,17]. Specifically, malnutrition incites cellular events within the depths of tumors due to incomplete vascular perfusion [18]. Particularly challenging is the nutritional deficit faced by lung carcinoma cells, given their elevated proliferative index, particularly evident during initial tumorigenesis [19]. In vitro, serum provides vital nutrients like growth factors, hormones, and amino acids [20]. Thus, serum starvation is a common methodology to mimic in vivo nutrient deprivation in cancer cell investigations [21]. Additionally, serum inclusion in signal transduction studies may compromise experimental accuracy [22]. Therefore, serum-free culturing conditions facilitate the more-precise assessment of drug impact on tumor cells, encompassing parameters such as proliferation, apoptosis, and metastatic potential, thus aiding in the screening and evaluation of prospective anti-neoplastic agents or therapeutic modalities [23,24]. For instance, cisplatin increases sensitivity in lung and colorectal carcinoma cells under serum deprivation conditions by enhancing the activation of the ataxia telangiectasia mutated (ATM)/checkpoint kinase 2 (Chk2)/P53 signaling axis relative to normal culture conditions [25]. Similarly, extracts of Radix Rehmanniae stimulate the phosphorylation of p38 mitogen-activated protein kinase (p38) and JNK in colorectal carcinoma cells under serum deprivation, leading to cell cycle arrest and apoptosis [26]. Notably, extracts from Calotropis gigantea stem bark inhibit colorectal carcinoma cell proliferation under serum deprivation [27]. Although ginsenosides have been promoted for their anti-neoplastic efficacy, elucidating their anti-tumor effects and mechanistic underpinnings under conditions of nutritional deprivation warrants further investigation.
In this study, we employed in vitro serum starvation to simulate the nutrient-deprived microenvironment of cancer cells in vivo. We investigated the effects of ginsenosides on the proliferation and apoptosis of NSCLC A549 cells. Concurrently, we employed network pharmacology and bioinformatics approaches to predict potential mechanisms of action and validated signaling pathways associated with nutrient metabolism. Our findings contribute to a deeper understanding of the anti-tumor mechanisms of ginsenosides, providing novel theoretical insights and leads for their development as clinical drugs.

2. Results and Discussion

2.1. Ginsenoside Inhibits the Proliferation of A549 Cells Under Serum Starvation

The experiment comprised two groups: one exposed to 10% serum and another to serum-free conditions, with each group treated with ginsenosides CK, Rh2(S), and Rg3(S) for 24 h on A549 cells. Cell viability was evaluated using the cell counting kit-8 (CCK8) assay, and the results are depicted in Figure 1A–C. Corresponding fluorescent images representing cell viability are provided in Figure 1D–F, with green fluorescence indicating viable cells and red fluorescence indicating dead cells. As depicted, under conditions of 10% serum culture, no significant difference in cell viability was observed between the treatment and control groups. However, the induction of serum starvation in A549 cells using a serum-free culture medium and subsequent treatment with varying concentrations of ginsenosides resulted in varying degrees of cell death. Specifically, after 24 h of treatment with low concentrations of ginsenosides CK, Rh2(S), and Rg3(S), the viability of A549 cells was measured at 51.13%, 60.64%, and 43.98%, respectively. Subsequent to treatment with high concentrations of ginsenosides, the viability of A549 cells dropped below 5%. Fluorescent images depicting cell viability validated these results, demonstrating a decrease in green fluorescence and an increase in red fluorescence with rising concentrations of ginsenosides in the serum-free group. Collectively, these results demonstrate that ginsenosides significantly inhibit the proliferation of A549 cells in a dose-dependent manner under serum starvation conditions. The structures of ginsenosides CK, Rh2(S), and Rg3(S), along with their IC50 values under serum-free conditions, are presented in Figure 2A. Based on the IC50 values, the concentrations used in subsequent experiments were set at 10 μM for ginsenosides CK and Rh2(S), and 50 μM for Rg3(S).

2.2. Ginsenoside Induces the Apoptosis of A549 Cells Under Serum Starvation

To further explore the impact of serum starvation on ginsenoside-induced apoptosis in A549 cells, the cells were treated with medium concentrations of ginsenosides for 24 h. Subsequently, cell morphology was characterized using Hoechst 33258 staining, as illustrated in Figure 2B. Apoptosis levels in A549 cells were evaluated using flow cytometry and subjected to quantitative analysis (refer to Figure 2C,D). The results indicate that under 10% serum culture conditions, no significant morphological changes were observed in either the treatment or control group, and there was no notable difference in apoptosis rates. However, under serum starvation conditions, a substantial increase in apoptosis was evident in the treatment group, characterized by decreased cell numbers and densely stained cell nuclei exhibiting blue-white fluorescence. Flow cytometry apoptosis analysis data supported these findings, showing a significant increase in apoptotic rates in the treatment group compared to the control group, particularly in early-stage apoptosis. Additionally, among the three types of ginsenosides, the ginsenoside CK exhibited the strongest induction of apoptosis in A549 cells, followed by Rh2(S). The interaction between serum starvation and ginsenoside treatment was analyzed using two-way ANOVA, and Figure S1A–C (see Supplementary Materials) indicate that the combined effect is synergistic.

2.3. Network Pharmacology Analysis of Ginsenosides

To elucidate the mechanism underlying ginsenoside-induced apoptosis in A549 cells under serum starvation conditions, we conducted a network pharmacology analysis. Previous investigations have revealed that ginsenosides CK, Rh2(S), and Rg3(S) undergo oxidative deglycosylation during hepatic metabolism, resulting in metabolites such as monooxygenated ginsenoside Rh2(S), protopanaxadiol-type saponin, and monooxygenated protopanaxadiol [15]. Therefore, we employed ginsenosides CK, Rh2(S), and Rg3(S) and their metabolites as drug components and predicted their targets using the SwissTargetPrediction platform. Detailed information regarding the drug components is presented in Table 1. Subsequently, the drug targets were intersected with targets associated with NSCLC and cell apoptosis, yielding 54 intersecting targets (Figure 3A). These targets were input into the STRING database, with species limited to Homo sapiens, resulting in a protein–protein interaction network. We conducted visualization analysis using Cytoscape (Figure 3B), revealing a network comprising 54 nodes and 880 edges. Employing the cytoHubba plugin, we identified the top three key targets ranked by degree as STAT3, ESR1, and HSP90AA1. KEGG pathway enrichment screening identified a total of 117 enriched terms, excluding nonspecific entries. The terms were sorted by p-value and the number of enriched targets, and we depicted the top 30 enriched terms as a bubble plot (Figure 3C). Among them, cancer pathways, the phosphoinositide 3-kinase (PI3K)/protein kinase B (Akt) signaling pathway, the Ras signaling pathway, and the Ras-related protein 1 (Rap1) signaling pathway emerged as potentially significant pathways. These pathways were categorized according to KEGG classification into four classes: environmental information processing, cellular processes, organismal systems, and human diseases (Figure 3D). Within the environmental information processing category, pathways related to nutrient metabolism were selected, revealing the PI3K/Akt signaling pathway and the forkhead box O (FoxO) signaling pathway. Previous studies have demonstrated that the FoxO signaling pathway is downstream of the PI3K/Akt signaling pathway and is regulated by it [28]. Thus, it is hypothesized that under serum starvation conditions, ginsenosides may induce apoptosis in A549 cells through the PI3K/Akt/FoxO signaling pathway. Furthermore, we constructed a visual network depicting the connectivity between ginsenosides, targets, and signaling pathways (Figure 3E). From the network, it is evident that ginsenosides act on multiple targets and pathways, particularly the PI3K/Akt signaling pathway, to promote cell apoptosis, thereby exerting therapeutic effects on NSCLC.

2.4. Bioinformatics Analysis of Ginsenosides

The degree of receptor–ligand binding can be assessed by the level of binding energy as observed in molecular docking results. If the binding energy is less than −5.0 kcal·mol−1, it suggests a certain binding activity between the target and the compound, with lower binding energies indicating better docking efficacy. Molecular docking was performed between ginsenosides CK, Rh2(S), and Rg3(S), and the key targets PI3K, Akt, and FoxO within the PI3K/Akt/FoxO signaling pathway. Specific docking results are elaborated on in Table 2 and Figure 4D. Detailed docking conformations are illustrated in Figure 4A–C. Visual inspection of molecular docking results reveals that ginsenosides enter the active sites of the key target proteins and interact with certain amino acid residues through the formation of multiple hydrogen bonds. Furthermore, within the visualization results, the hydrogen bond lengths formed between ginsenosides and the key targets are all less than 3 Å, indicating close proximity between the amino acids and the compounds, thereby suggesting tight binding. The docking results indicate that ginsenosides CK, Rh2(S), and Rg3(S) form stable interactions with the key targets PI3K, Akt, and FoxO, suggesting that ginsenosides can spontaneously bind to target proteins, thereby inducing cell apoptosis and exerting therapeutic effects on NSCLC.

2.5. Ginsenoside Promotes the Apoptosis of A549 Cells by Regulating Key Molecules in the PI3K/Akt/FoxO Signaling Pathway Under Serum Starvation

Validation of the bioinformatics analysis results of ginsenosides was conducted using quantitative reverse transcription-polymerase chain reaction (qRT-PCR) detection technology. A549 cells in both the 10% serum and serum-free groups were treated with moderate concentrations of ginsenosides for 24 h, followed by mRNA expression level measurements of key molecules in the signaling pathway, including PI3K, Akt, and FoxO (refer to Figure 5A–C). In the 10% serum group, the addition of ginsenosides resulted in an increase in PI3K mRNA expression levels and a decrease in Akt and FoxO mRNA expression levels. In the control samples of both the 10% serum and serum-free groups, there were no significant differences in the mRNA expression levels of the three key molecules, indicating that serum starvation alone did not affect the PI3K/Akt/FoxO signaling pathway. However, under serum starvation conditions with ginsenoside treatment, the mRNA expression level of Akt in A549 cells significantly decreased, to even lower than that observed with ginsenoside treatment alone. Notably, the mRNA expression level of FoxO significantly increased, contrary to the results of ginsenoside treatment alone. Overall, under serum starvation conditions, ginsenosides inhibit the expression of Akt and activate FoxO in serum-starved A549 cells.
Concurrently, changes in the mRNA expression levels of apoptosis-related proteins were examined, including the pro-apoptotic molecules Bcl-2-like protein 11 (Bim), and Caspase family proteins such as Caspase-3, Caspase-8, and Caspase-9 downstream of the PI3K/Akt/FoxO signaling pathway (Figure 5D–G). The results revealed that in A549 cells treated solely with ginsenosides, the mRNA expression levels of the aforementioned pro-apoptotic proteins increased. Treatment solely with serum starvation led to increased mRNA expression levels of both Bim and Caspase-3. Under serum starvation conditions with ginsenoside treatment, significant increases in the expression levels of Bim, Caspase-3, Caspase-8, and Caspase-9 were observed. Particularly noteworthy was the increase in Caspase-8, whose mRNA expression level exceeded that of treatment with ginsenosides alone. This indicates that under conditions of serum starvation, ginsenosides primarily induce apoptosis in A549 cells by increasing the mRNA expression levels of Caspase-8. This outcome is likely mediated by the inhibition of Akt expression by ginsenosides, thereby promoting FoxO expression.

2.6. Ginsenosides Decreased the Mitochondrial Membrane Potential of A549 Cells Under Serum Starvation

Cell apoptosis typically involves a decrease in mitochondrial membrane permeability [29]. We assessed the mitochondrial membrane potential of A549 cells using JC-1 staining. When mitochondria have a high membrane potential, JC-1 forms aggregates emitting red fluorescence, whereas a low membrane potential results in green fluorescence. Figure 6A,B depict fluorescence micrographs of cellular mitochondrial membrane potential, and Figure 6C presents the corresponding fluorescence quantification. The ratio of green to red fluorescence reflects changes in mitochondrial membrane potential; higher ratios indicate lower membrane potentials. In Figure 6A, cells treated with various concentrations of ginsenosides exhibited red fluorescence, and their mitochondrial membrane potentials did not significantly differ from those of the control group, indicating that treatment with moderate concentrations of ginsenosides alone does not reduce mitochondrial membrane potential. Similarly, the control group in Figure 6B also displayed noticeable red fluorescence, suggesting that serum starvation alone does not alter mitochondrial membrane potential. However, under serum starvation conditions with ginsenoside treatment, a significant reduction in mitochondrial membrane potential was observed in A549 cells, accompanied by a sharp decrease in cell count and enhanced green fluorescence, with weakened or absent red fluorescence in the fluorescence micrographs. Notably, the results for ginsenosides CK and Rh2(S) closely resembled those of the positive control carbonyl cyanide 3-chlorophenylhydrazone (CCCP), suggesting that, under serum starvation, ginsenosides can decrease the mitochondrial membrane potential of A549 cells.
NSCLC represents the most prevalent form of lung cancer, characterized by reported five-year survival rates of merely 16% in advanced stages. Researchers worldwide have devoted substantial efforts to pursue novel, highly efficient, and low-toxicity anti-NSCLC drugs [30,31]. Ginsenosides, the primary active components of ginseng, have garnered extensive attention and validation for their potential in anti-tumor therapy in recent years. Specifically, the protopanaxadiol-type ginsenosides Rg3(S), Rh2(S), and CK have exhibited notable anti-tumor activity and less biotoxicity, and are frequently employed in conjunction with chemotherapy drugs for clinical lung cancer management. Based on the current literature, under 10% serum culture conditions, the 24 h IC50 values of Rh2(S) and CK against lung cancer A549 cells were 59.55 μM and 40.83 μM, respectively, whereas the IC50 value of Rg3(S) exceeded 50 μM [32,33,34,35]. Significantly, under serum starvation conditions, the 24 h IC50 values of all three ginsenosides against A549 cells were notably reduced, with Rh2(S) and CK even below 10 μM. Cell viability assays revealed that under serum starvation conditions, ginsenosides had a stronger inhibitory effect on the proliferation of A549 cells. Apoptosis assays indicated that under serum starvation conditions, ginsenosides elicited early apoptosis in A549 cells. Similar findings were confirmed in studies employing Rh2(S) and Rg3(S) for cervical cancer treatment [36,37].
The KEGG pathway enrichment analysis indicated that the targets were predominantly enriched in the PI3K/Akt/FoxO signaling pathway. qRT-PCR experiments revealed decreased mRNA expression of Akt and increased mRNA expression of FoxO under serum starvation conditions induced by ginsenosides. The PI3K/Akt/FoxO signaling pathway, as a central pathway governing cell growth and metabolism, plays a role in modulating various physiological processes, such as cell proliferation, apoptosis, and insulin resistance [38,39]. In particular, the PI3K/Akt pathway negatively regulates FoxO transcriptional activity, leading to the expression of the pro-apoptotic protein Bim, thereby facilitating epithelial cell apoptosis [40,41]. Moreover, the FoxO family of transcription factors might influence mitochondrial membrane potential by regulating the expression of mitochondria-related genes, thereby activating both mitochondrial-dependent and -independent apoptosis pathways [42,43]. Under serum starvation conditions, a reduction in mitochondrial membrane potential was observed alongside the increased mRNA expression of the pro-apoptotic proteins Bim, Caspase-3, Caspase-8, and Caspase-9, suggesting that ginsenosides could induce typical apoptosis through both extrinsic and intrinsic pathways.
This study hypothesizes that, under serum starvation conditions, ginsenosides inhibit Akt and activate FoxO by regulating the PI3K/Akt/FoxO signaling pathway in A549 cells. The activation of FoxO decreases mitochondrial membrane potential, indirectly influencing the activity of the Caspase protein family. In the intrinsic pathway of apoptosis, the heightened permeability of the mitochondrial membrane results in the release of specific proteins (such as cytochrome c) into the cytoplasm, subsequently activating the Caspase protein family and initiating apoptosis [44]. Figure 7 illustrates the potential mechanistic pathway through which serum starvation may enhance ginsenoside-induced apoptosis in A549 lung cancer cells.
Indeed, when compared to cell cultures under normal serum conditions, cells subjected to serum starvation display a survival state more closely resembling the actual tumor microenvironment in vivo. The network pharmacology analysis results revealed that G7, G5, and G6 were the top three active ingredients of ginsenosides, all of which are metabolic products of ginsenosides Rg3(S), Rh2(S), and CK in vivo. Our prior studies have demonstrated that these metabolites exhibit stronger anti-tumor activities compared to the parent compounds [15]. The present investigation reveals that when cancer cells were placed in a nutrient-deficient environment, ginsenosides exhibited a stronger anti-tumor effect. As a result, the development of novel drug delivery systems to ensure the targeted accumulation of ginsenosides at tumor sites post-administration represents a promising strategy for enhancing their therapeutic efficacy.
The strong docking scores obtained in this study suggest promising interactions between the compounds and the target of interest. It should be noted, however, that molecular docking is a predictive computational tool and cannot independently confirm actual binding or functional activity in a biological context. While these results provide a supportive in silico model, future experimental validation using techniques such as surface plasmon resonance (SPR) or isothermal titration calorimetry (ITC) to quantify binding affinity, together with functional cellular assays, will be essential to unequivocally establish the biological significance of these interactions.

3. Materials and Methods

3.1. Materials

Ginsenosides CK, Rh2(S), and Rg3(S) (purity > 98%) were purchased from Chengdu Must Bio-Technology (Chengdu, China). A549 cells were obtained from the Shanghai Cell Bank of the Chinese Academy of Science (Shanghai, China). RPMI-1640 medium and penicillin-streptomycin were ordered from Hyclone (Logan, UT, USA). Fetal bovine serum (FBS) was ordered from Sorfa (Huzhou, China). Also, 0.25% trypsin−EDTA solution was ordered from Gibco (San Francisco, CA, USA). Dimethyl sulfoxide (DMSO) and RNAsimple total RNA kit were ordered from Solarbio (Beijing, China). The cell counting kit-8 (CCK-8) assay was ordered from APExBIO (Shanghai, China). The calcein/propidium iodide (PI) cell viability/cytotoxicity assay kit, Hoechst 33258 staining kit, Annexin V-FITC apoptosis detection kit, and mitochondrial membrane potential assay kit with J-aggregates (JC-1) were purchased from Beyotime (Shanghai, China). The FastKing RT kit and SYBR Premix Ex Taq were purchased from Tiangen (Beijing, China).

3.2. Culture of A549 Cells

A549 lung cancer cells were cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin as a complete growth medium. Cells were incubated in a CO2 incubator maintained at 37 °C with 5% CO2. Cells were divided into two groups for treatment: Group 1 received a complete medium supplemented with 10% FBS (10% serum), and Group 2 underwent serum starvation with 0% FBS (serum-free).

3.3. Cell Viability Assay

A549 cells were treated with various concentrations of ginsenoside for 24 h. Cell viability was assessed using the cell counting kit-8 (CCK-8) assay and calcein/propidium iodide (PI) cell viability/cytotoxicity assay according to the manufacturer’s protocol. The results of the CCK-8 assay were determined by measuring the optical density at 450 nm in each well using a microplate reader (Bio-Rad, Hercules, CA, USA). After incubation with the calcein/PI buffer for 30 min, live and dead cells were observed under a fluorescent microscope.

3.4. Hoechst 33258 Staining Detection

The detection of apoptosis in A549 cells was performed using Hoechst 33258 staining. A549 cells were incubated with various concentrations of ginsenoside for 24 h, followed by fixation with 4% formaldehyde for 15 min at room temperature, and then stained with Hoechst 33258 for 15 min. Cells with nuclei containing condensed chromatin or fragmented nuclei were identified as apoptotic cells through visualization.

3.5. Flow Cytometry Assays

After 24 h of treatment with ginsenosides, A549 cells were stained with the Annexin V-FITC apoptosis detection kit. Flow cytometry (CytoFLEX, Beckman, CA, USA) was employed to analyze the samples and quantify the percentage of apoptotic cells.

3.6. Bioinformatics Analysis

The bioinformatics analysis was conducted according to the protocol outlined by Aqsa Kanwal and colleagues [45]. Chemical structures were prepared with ChemDraw software (version 20.0.0.41), and the corresponding canonical SMILES were analyzed using the SwissTargetPrediction platform to predict potential targets (http://www.swisstargetprediction.ch/) (accessed on 8 October 2024). The predicted targets were identified and validated through the UniProt database (https://www.uniprot.org/) (accessed on 8 October 2024). Subsequent network pharmacology analysis was performed using Cytoscape software (version 3.9.1).
Network pharmacology was utilized to preliminarily predict potential targets, pathways, and mechanisms associated with the anti-NSCLC activity of bioactive components. The GeneCards and DisGeNET databases were employed to identify NSCLC-related genes using the keyword “non-small cell lung cancer,” and cell apoptosis-related genes were selected using the keyword “apoptosis” [46,47]. Common targets of ginsenosides against NSCLC were identified based on their induction of cell apoptosis, illustrated in a Venn diagram generated using the Venn website [48]. Additionally, a protein–protein interaction (PPI) network model, with the species set to “Homo sapiens,” was constructed using the STRING database online platform [49]. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis was performed using the Database for Annotation, Visualization, and Integrated Discovery (DAVID), and network relationships were visualized using Cytoscape software [50].
Protein–ligand docking was performed using AutoDock Vina (version 1.1.2) to predict the predominant binding mode of the ligand with the protein [51]. The active constituents were employed as ligands, whereas the targets were utilized as receptors. Subsequently, the optimal docking results were chosen and visualized with PyMOL (version 2.6.0a0).

3.7. Quantitative Reverse Transcription-Polymerase Chain Reaction (qRT-PCR)

The qRT-PCR analysis utilized the CFX96™ real-time system (Bio-Rad, USA). A 20 µL reaction mixture was prepared, comprising 2 µL of template, 0.6 µL of each primer (400 nM final concentration), and 10 µL of 2 × Talent qPCR PreMix (Tiangen, Beijing, China). The PCR protocol followed the manufacturer’s guidelines, starting with an initial denaturation at 95 °C for 3 min, followed by 40 cycles of 5 s at 95 °C and 15 s at 60 °C. Melting curve analysis included 30 s at 95 °C, 30 s at 65 °C, and 30 s at 95 °C. Normalization against β-actin mRNA levels enabled relative gene expression quantification using the 2-ΔΔCT method. The primer sequences are provided in Table 3.

3.8. Mitochondrial Membrane Potential Measurement

Mitochondrial membrane potential (MMP) in cells was assessed using a mitochondrial membrane potential detection kit (JC-1) (C2006, Beyotime, Shanghai, China). A549 cells were washed and then incubated with JC-1 working solutions for 30 min at 37 degrees Celsius in the incubator. Additionally, those treated with carbonyl cyanide 3-chlorophenylhydrazone (CCCP) served as negative controls during MMP evaluation, following the provided instructions. Subsequently, live cells were imaged using a confocal laser scanning microscope (FV3000, Olympus, Tokyo, Japan) after incubation. Confocal images were rapidly acquired and then quantified for mean fluorescence intensities in arbitrary regions using ImageJ (version 1.52a).

3.9. Statistics and Analysis

All experiments in this study were conducted with at least three independent replicates, and data are presented as the mean ± standard deviation. The normality (Shapiro–Wilk test) and homoscedasticity (Levene’s test) of data were confirmed prior to analysis. Statistical significance between treatment groups was determined using one-way ANOVA followed by Tukey’s post hoc test for multiple comparisons. Significance levels are denoted as follows: * p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001.

4. Conclusions

In summary, we assessed the anti-lung cancer activity of ginsenosides under serum starvation conditions and explored their potential mechanisms. Our results demonstrated that ginsenosides inhibited the proliferation of and induced apoptosis in A549 cells under serum deprivation, suggesting potent anti-tumor effects. Mechanistically, our multi-faceted approach indicated that ginsenosides likely regulate the PI3K/Akt/FoxO signaling pathway, as evidenced by inhibited Akt and activated FoxO expression. Nevertheless, a limitation of this study is its reliance on mRNA expression and bioinformatic predictions to infer pathway involvement. Future studies employing pathway-specific inhibitors or genetic approaches are essential to conclusively establish causality. By simulating the nutrient-deprived tumor microenvironment in vitro, we provided evidence that ginsenosides may exert enhanced anti-tumor effects under metabolic stress. These findings offer valuable insights for developing ginsenosides as potential clinical therapeutics targeting adverse tumor microenvironments.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/molecules30183697/s1, Figure S1: Synergistic effects of ginsenosides and serum starvation on apoptosis in A549 cells. Interaction effects between (A) ginsenoside CK, (B) ginsenoside Rh2(S), (C) ginsenoside Rg3(S) and serum starvation were analyzed by two-way ANOVA. Results indicate a statistically significant synergistic interaction for all three ginsenosides (p < 0.05), suggesting enhanced apoptotic effects under serum-deprived conditions. Error bars represent mean ± SD; n = 3. (* p < 0.05, ** p < 0.01, *** p < 0.001).

Author Contributions

Conceptualization, Z.L.; methodology, J.L.; investigation, K.L.; data curation, M.S.; formal analysis, Z.G. and L.M.; writing—original draft preparation, J.L.; writing—review and editing, J.L. and Z.L.; project administration, K.L. and X.G.; funding acquisition, X.G. and Z.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the National Natural Science Foundation of China (82173913), Liaoning Province Education Administration (LJ232412026011), Key R&D Projects of Liaoning Province (2024JH2/102600098, 2023JH2/101300111, and 2023JH2/101700074), and Dalian High-level Talent Innovation Support Program-Cutting-edge and Leading Talent (2021RD10). Fundamental Research Funds for the Central Universities (044420250061, 044420250062).

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors thank BioRender (https://biorender.com/) (accessed on 2 September 2025) for providing the images.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
AktProtein kinase B
BimBcl-2-like protein 11
CDK4Cyclin-dependent kinase 4
FoxOForkhead box O
HES1Hairy and enhancer of split 1
ITCIsothermal titration calorimetry
JNKc-Jun N-terminal kinase
MAPKsMitogen-activated protein kinases
NSCLCNon-small-cell lung cancer
NotchNeurogenic locus notch homolog protein
PI3KPhosphoinositide 3-kinase
p53Tumor protein 53

References

  1. Du, T.; Li, H.; Fan, Y.; Yuan, L.; Guo, X.; Zhu, Q.; Yao, Y.; Li, X.; Liu, C.; Yu, X. The deubiquitylase OTUD3 stabilizes GRP78 and promotes lung tumorigenesis. Nat. Commun. 2019, 10, 2914. [Google Scholar] [CrossRef] [Scilit]
  2. Voorn, M.J.; Bongers, B.C.; van Kampen-van den Boogaart, V.E.; Driessen, E.J.; Janssen-Heijnen, M.L. Feasibility of rehabilitation during chemoradiotherapy among patients with stage III non-small cell lung cancer: A proof-of-Concept study. Cancers 2022, 14, 2387. [Google Scholar] [CrossRef] [Scilit]
  3. Jia, Y.-Y.; Huan, M.-L.; Wang, W.; Jia, Z.-Y.; Wan, Y.-H.; Zhou, S.-Y.; Zhang, B.-L. Tumor microenvironment and redox dual stimuli-responsive polymeric nanoparticles for the effective cisplatin-based cancer chemotherapy. Nanotechnology 2022, 34, 035101. [Google Scholar] [CrossRef] [Scilit]
  4. Zhang, S.; Zheng, F.; Liu, K.; Liu, S.; Xiao, T.; Zhu, Y.; Xu, L. Mitochondria-Targeting polymer micelles in stepwise response releasing gemcitabine and destroying the mitochondria and nucleus for combined antitumor chemotherapy. Int. J. Mol. Sci. 2022, 23, 12624. [Google Scholar] [CrossRef] [Scilit]
  5. Kazakova, O.; Smirnova, I.; Tret’yakova, E.; Csuk, R.; Hoenke, S.; Fischer, L. Cytotoxic potential of a-azepano-and 3-amino-3, 4-seco-triterpenoids. Int. J. Mol. Sci. 2021, 22, 1714. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. She, L.; Tang, H.; Zeng, Y.; Li, L.; Xiong, L.; Sun, J.; Chen, F.; Ren, J.; Zhang, J.; Wang, W.; et al. Ginsenoside RK3 promotes neurogenesis in Alzheimer’s disease through activation of the CREB/BDNF pathway. J. Ethnopharmacol. 2024, 321, 117462. [Google Scholar] [CrossRef] [Scilit]
  7. Zhou, H.; Liu, Y.; Su, Y.; Ji, P.; Kong, L.; Sun, R.; Zhang, D.; Xu, H.; Li, W.; Li, W. Ginsenoside Rg1 attenuates lipopolysaccharide-induced chronic liver damage by activating Nrf2 signaling and inhibiting inflammasomes in hepatic cells. J. Ethnopharmacol. 2024, 324, 117794. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  8. Gao, Q.; Li, G.; Zu, Y.; Xu, Y.; Wang, C.; Xiang, D.; He, W.; Shang, T.; Cheng, X.; Liu, D.; et al. Ginsenoside Rg1 alleviates ANIT-induced cholestatic liver injury by inhibiting hepatic inflammation and oxidative stress via SIRT1 activation. J. Ethnopharmacol. 2024, 319, 117089. [Google Scholar] [CrossRef] [Scilit]
  9. Hu, Q.-R.; Hong, H.; Zhang, Z.-H.; Feng, H.; Luo, T.; Li, J.; Deng, Z.-Y.; Chen, F. Methods on improvements of the poor oral bioavailability of ginsenosides: Pre-processing, structural modification, drug combination, and micro-or nano-delivery system. J. Ginseng Res. 2023, 47, 694–705. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  10. Xiao, H.; Xue, Q.; Zhang, Q.; Li, C.; Liu, X.; Liu, J.; Li, H.; Yang, J. How Ginsenosides Trigger Apoptosis in Human Lung Adenocarcinoma Cells. Am. J. Chin. Med. 2019, 47, 1737–1754. [Google Scholar] [CrossRef] [Scilit]
  11. Li, K.; Li, J.; Li, Z.; Men, L.; Zuo, H.; Gong, X. Cisplatin-based combination therapies: Their efficacy with a focus on ginsenosides co-administration. Pharmacol. Res. 2024, 203, 107175. [Google Scholar] [CrossRef] [Scilit]
  12. Zheng, R.; Rao, Y.; Jiang, H.; Liu, X.; Zhu, X.; Li, J.; Xu, J. Therapeutic potential of Ginsenoside Rg3 via inhibiting Notch/HES1 pathway in lung cancer cells. Transl. Cancer Res. 2016, 5, 464–469. [Google Scholar] [CrossRef] [Scilit]
  13. Liu, X.; Sun, Y.; Yue, L.; Li, S.; Qi, X.; Zhao, H.; Yang, Y.; Zhang, C.; Yu, H. JNK pathway and relative transcriptional factor were involved in ginsenoside Rh2-mediated G1 growth arrest and apoptosis in human lung adenocarcinoma A549 cells. Genet. Mol. Res. 2016, 15, 1–13. [Google Scholar] [CrossRef] [Scilit]
  14. Li, Y.; Zhou, T.; Ma, C.Y.; Song, W.W.; Zhang, J.; Yu, Z.X. Ginsenoside metabolite compound K enhances the efficacy of cisplatin in lung cancer cells. J. Thorac. Dis. 2015, 7, 400. [Google Scholar]
  15. Li, Z.; Li, J.; Sun, M.; Men, L.; Wang, E.; Zhao, Y.; Li, K.; Gong, X. Analysis of metabolites and metabolism-mediated biological activity assessment of ginsenosides on microfluidic co-culture system. Front. Pharmacol. 2023, 14, 1046722. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Wang, Q.; Wang, P.; Qin, Z.; Yang, X.; Pan, B.; Nie, F.; Bi, H. Altered glucose metabolism and cell function in keloid fibroblasts under hypoxia. Redox Biol. 2021, 38, 101815. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Shen, X.; Zhong, J.; He, J.; Han, J.; Chen, N. Identification of m6A modification patterns and development of m6A–hypoxia prognostic signature to characterize tumor microenvironment in triple-negative breast cancer. Front. Immunol. 2022, 13, 978092. [Google Scholar] [CrossRef] [Scilit]
  18. Takahashi, T.; Ando, Y.; Ichikawa, H.; Tsuneyama, K.; Hijikata, T. Serum/glucose starvation strikingly reduces heterogeneous nuclear ribonucleoprotein A1 protein and its target, cyclin D1. FEBS J. 2023, 290, 4126–4144. [Google Scholar] [CrossRef] [Scilit]
  19. Yousaf, I.; Kaeppler, J.; Frost, S.; Seymour, L.W.; Jacobus, E.J. Attenuation of the hypoxia inducible factor pathway after oncolytic adenovirus infection coincides with decreased vessel perfusion. Cancers 2020, 12, 851. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  20. Raja, R.; Lata, S.; Trivedi, S.; Banerjea, A.C. Serum deprivation/starvation leads to reactivation of HIV-1 in latently infected monocytes via activating ERK/JNK pathway. Sci. Rep. 2018, 8, 14496. [Google Scholar] [CrossRef] [Scilit]
  21. Ahmadiankia, N. In vitro and in vivo studies of cancer cell behavior under nutrient deprivation. Cell Biol. Int. 2020, 44, 1588–1597. [Google Scholar] [CrossRef] [Scilit]
  22. Searle, B.C.; Pino, L.K.; Egertson, J.D.; Ting, Y.S.; Lawrence, R.T.; MacLean, B.X.; Villén, J.; MacCoss, M.J. Chromatogram libraries improve peptide detection and quantification by data independent acquisition mass spectrometry. Nat. Commun. 2018, 9, 5128. [Google Scholar] [CrossRef] [Scilit]
  23. Smith, A.S.; Luttrell, S.M.; Dupont, J.-B.; Gray, K.; Lih, D.; Fleming, J.W.; Cunningham, N.J.; Jepson, S.; Hesson, J.; Mathieu, J. High-throughput, real-time monitoring of engineered skeletal muscle function using magnetic sensing. J. Tissue Eng. 2022, 13, 20417314221122127. [Google Scholar] [CrossRef] [Scilit]
  24. Postnikova, E.; Cong, Y.; DeWald, L.E.; Dyall, J.; Yu, S.; Zhou, H.; Gross, R.; Logue, J.; Cai, Y.; Deiuliis, N. Testing therapeutics in cell-based assays: Factors that influence the apparent potency of drugs. PLoS ONE 2018, 13, e0194880. [Google Scholar] [CrossRef] [Scilit]
  25. Shi, Y.; Felley-Bosco, E.; Marti, T.M.; Orlowski, K.; Pruschy, M.; Stahel, R.A. Starvation-induced activation of ATM/Chk2/p53 signaling sensitizes cancer cells to cisplatin. BMC Cancer 2012, 12, 571. [Google Scholar] [CrossRef] [Scilit]
  26. Ji, K.-Y.; Kim, K.M.; Kim, Y.H.; Shim, K.-S.; Lee, J.Y.; Kim, T.; Chae, S. Serum Starvation Sensitizes Anticancer Effect of Anemarrhena asphodeloides via p38/JNK-Induced Cell Cycle Arrest and Apoptosis in Colorectal Cancer Cells. Am. J. Chin. Med. 2021, 49, 1001–1016. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  27. Simanurak, O.; Pekthong, D.; Somran, J.; Wangteeraprasert, A.; Srikummool, M.; Kaewpaeng, N.; Parhira, S.; Srisawang, P. Enhanced apoptosis of HCT116 colon cancer cells treated with extracts from Calotropis gigantea stem bark by starvation. Heliyon 2023, 9, e18013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  28. Wang, M.; Wu, W.; Li, L.; He, J.; Huang, S.; Chen, S.; Chen, J.; Long, M.; Yang, S.; Li, P. Analysis of the miRNA expression profiles in the zearalenone-exposed TM3 Leydig cell line. Int. J. Mol. Sci. 2019, 20, 635. [Google Scholar] [CrossRef] [Scilit]
  29. Xiao, Q.; Zhao, W.; Wu, C.; Wang, X.; Chen, J.; Shi, X.; Sha, S.; Li, J.; Liang, X.; Yang, Y. Lemon-Derived Extracellular Vesicles Nanodrugs Enable to Efficiently Overcome Cancer Multidrug Resistance by Endocytosis-Triggered Energy Dissipation and Energy Production Reduction. Adv. Sci. 2022, 9, 2105274. [Google Scholar] [CrossRef] [Scilit]
  30. Ma, D.; Qin, Y.; Huang, C.; Chen, Y.; Han, Z.; Zhou, X.; Liu, H. Circular RNA ABCB10 promotes non-small cell lung cancer progression by increasing E2F5 expression through sponging miR-584-5p. Cell Cycle 2020, 19, 1611–1620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Maemondo, M.; Inoue, A.; Kobayashi, K.; Sugawara, S.; Oizumi, S.; Isobe, H.; Gemma, A.; Harada, M.; Yoshizawa, H.; Kinoshita, I. Gefitinib or chemotherapy for non–small-cell lung cancer with mutated EGFR. N. Engl. J. Med. 2010, 362, 2380–2388. [Google Scholar] [CrossRef] [Scilit]
  32. Sun, X.; Zhao, P.; Li, H.; Liu, Y.; Wang, T.; Cheng, Y. Ginsenoside Rh2 inhibits glycolysis through the STAT3/c-MYC axis in non-small-cell lung cancer. J. Oncol. 2021, 2021, 9715154. [Google Scholar] [CrossRef] [Scilit]
  33. Yang, L.; Zhang, Z.; Hou, J.; Jin, X.; Ke, Z.; Liu, D.; Du, M.; Jia, X.; Lv, H. Targeted delivery of ginsenoside compound K using TPGS/PEG-PCL mixed micelles for effective treatment of lung cancer. Int. J. Nanomed. 2017, 12, 7653–7667. [Google Scholar] [CrossRef] [Scilit]
  34. Xie, Q.; Wen, H.; Zhang, Q.; Zhou, W.; Lin, X.; Xie, D.; Liu, Y. Inhibiting PI3K-AKt signaling pathway is involved in antitumor effects of ginsenoside Rg3 in lung cancer cell. Biomed. Pharmacother. 2017, 85, 16–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  35. Xu, L.; Xiao, S.N.; Yuan, W.H.; Cui, J.M.; Su, G.Y.; Zhao, Y.Q. Synthesis and Anticancer Activity Evaluation of Hydrolyzed Derivatives of Panaxnotoginseng Saponins. Molecules 2018, 23, 3021. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Wang, J.; Bian, S.; Wang, S.; Yang, S.; Zhang, W.; Zhao, D.; Liu, M.; Bai, X. Ginsenoside Rh2 represses autophagy to promote cervical cancer cell apoptosis during starvation. Chin. Med. 2020, 15, 118. [Google Scholar] [CrossRef] [Scilit]
  37. Bian, S.; Zhao, Y.; Li, F.; Lu, S.; Wang, S.; Bai, X.; Liu, M.; Zhao, D.; Wang, J.; Guo, D. 20(S)-Ginsenoside Rg3 Promotes HeLa Cell Apoptosis by Regulating Autophagy. Molecules 2019, 24, 3655. [Google Scholar] [CrossRef] [Scilit]
  38. Goldbraikh, D.; Neufeld, D.; Eid-Mutlak, Y.; Lasry, I.; Gilda, J.E.; Parnis, A.; Cohen, S. USP1 deubiquitinates Akt to inhibit PI 3K-Akt-FoxO signaling in muscle during prolonged starvation. EMBO Rep. 2020, 21, e48791. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Gong, Y.; Yang, J.; Liu, Q.; Cai, J.; Zheng, Y.; Zhang, Y.; Yu, D.; Liu, H.; Zhang, Z. IGF1 Knockdown hinders myocardial development through energy metabolism dysfunction caused by ROS-dependent FOXO activation in the chicken heart. Oxid. Med. Cell. Longev. 2019, 2019, 7838754. [Google Scholar] [CrossRef] [Scilit]
  40. Tsuji, T.; Maeda, Y.; Kita, K.; Murakami, K.; Saya, H.; Takemura, H.; Inaki, N.; Oshima, M.; Oshima, H. FOXO3 is a latent tumor suppressor for FOXO3-positive and cytoplasmic-type gastric cancer cells. Oncogene 2021, 40, 3072–3086. [Google Scholar] [CrossRef] [Scilit]
  41. Yu, W.-N.; Nogueira, V.; Sobhakumari, A.; Patra, K.C.; Bhaskar, P.T.; Hay, N. Systemic Akt1 deletion after tumor onset in p53−/− mice increases lifespan and regresses thymic lymphoma emulating p53 restoration. Cell Rep. 2015, 12, 610–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Lee, C.M.; Lee, J.; Nam, M.J.; Park, S.-H. Indole-3-carbinol induces apoptosis in human osteosarcoma MG-63 and U2OS cells. BioMed Res. Int. 2018, 2018, 7970618. [Google Scholar] [CrossRef] [Scilit]
  43. Fu, Z.; Tindall, D. FOXOs, cancer and regulation of apoptosis. Oncogene 2008, 27, 2312–2319. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Kauerová, T.; Goněc, T.; Jampílek, J.; Hafner, S.; Gaiser, A.-K.; Syrovets, T.; Fedr, R.; Souček, K.; Kollar, P. Ring-substituted 1-hydroxynaphthalene-2-carboxanilides inhibit proliferation and trigger mitochondria-mediated apoptosis. Int. J. Mol. Sci. 2020, 21, 3416. [Google Scholar] [CrossRef] [Scilit]
  45. Kanwal, A.; Azeem, F.; Nadeem, H.; Ashfaq, U.A.; Aadil, R.M.; Kober, A.H.; Rajoka, M.S.R.; Rasul, I. Molecular Mechanisms of Cassia fistula against Epithelial Ovarian Cancer Using Network Pharmacology and Molecular Docking Approaches. Pharmaceutics 2022, 14, 1970. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Safran, M.; Rosen, N.; Twik, M.; BarShir, R.; Stein, T.I.; Dahary, D.; Fishilevich, S.; Lancet, D. The genecards suite. In Practical Guide to Life Science Databases; Springer: Singapore, 2021; pp. 27–56. [Google Scholar] [CrossRef] [Scilit]
  47. Piñero, J.; Saüch, J.; Sanz, F.; Furlong, L.I. The DisGeNET cytoscape app: Exploring and visualizing disease genomics data. Comput. Struct. Biotechnol. J. 2021, 19, 2960–2967. [Google Scholar] [CrossRef] [Scilit]
  48. Venny, O.J. An Interactive Tool for Comparing Lists with Venn’s Diagrams. 2007–2015. 2016. Available online: https://bioinfogp.cnb.csic.es/tools/venny/index.html (accessed on 8 October 2024).
  49. Szklarczyk, D.; Gable, A.L.; Nastou, K.C.; Lyon, D.; Kirsch, R.; Pyysalo, S.; Doncheva, N.T.; Legeay, M.; Fang, T.; Bork, P. The STRING database in 2021: Customizable protein–protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021, 49, D605–D612. [Google Scholar] [CrossRef] [Scilit]
  50. Kuang, W.; Yang, J.; Liu, Z.; Zeng, J.; Xia, X.; Chen, X.; Zhong, S.; Huang, R. Catechin mediates ferroptosis to exert an anti-inflammatory effect on RAW 264.7 cells. Foods 2022, 11, 1572. [Google Scholar] [CrossRef] [Scilit]
  51. Eberhardt, J.; Santos-Martins, D.; Tillack, A.F.; Forli, S. AutoDock Vina 1.2.0: New docking methods, expanded force field, and python bindings. J. Chem. Inf. Model. 2021, 61, 3891–3898. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Effect of ginsenosides on the proliferation of A549 cells under different culture conditions. Quantitative assay of cell viability of A549 cells treated with ginsenosides CK (A), Rh2(S) (B), and Rg3(S) (C) under different culture conditions. Fluorescent images of ginsenosides CK (D), Rh2(S) (E), and Rg3(S) (F) acting on A549 cells without and with serum. Scale bar: 100 μm. Error bars represent mean ± SD; n = 3. (* p < 0.05, ** p < 0.01, and *** p < 0.001 vs. the control group).
Figure 1. Effect of ginsenosides on the proliferation of A549 cells under different culture conditions. Quantitative assay of cell viability of A549 cells treated with ginsenosides CK (A), Rh2(S) (B), and Rg3(S) (C) under different culture conditions. Fluorescent images of ginsenosides CK (D), Rh2(S) (E), and Rg3(S) (F) acting on A549 cells without and with serum. Scale bar: 100 μm. Error bars represent mean ± SD; n = 3. (* p < 0.05, ** p < 0.01, and *** p < 0.001 vs. the control group).
Molecules 30 03697 g001
Figure 2. Effect of ginsenosides on the apoptosis of A549 cells under different culture conditions. (A) Chemical structures and half-maximal inhibitory concentrations (IC50) of ginsenosides. (B) Morphological assessment of apoptosis by Hoechst 33258 staining. Scale bar: 50 μm. (C) Dot plots showing apoptosis through the flow cytometric analysis of A549 cells using dual annexin V/FITC-PI staining. (D) Comparison of apoptosis levels across various experimental conditions. Apoptosis ratio was calculated by combining early apoptosis and late apoptosis percentages. Error bars represent mean ± SD; n = 3. (* p < 0.05, *** p < 0.001).
Figure 2. Effect of ginsenosides on the apoptosis of A549 cells under different culture conditions. (A) Chemical structures and half-maximal inhibitory concentrations (IC50) of ginsenosides. (B) Morphological assessment of apoptosis by Hoechst 33258 staining. Scale bar: 50 μm. (C) Dot plots showing apoptosis through the flow cytometric analysis of A549 cells using dual annexin V/FITC-PI staining. (D) Comparison of apoptosis levels across various experimental conditions. Apoptosis ratio was calculated by combining early apoptosis and late apoptosis percentages. Error bars represent mean ± SD; n = 3. (* p < 0.05, *** p < 0.001).
Molecules 30 03697 g002
Figure 3. Results of network pharmacology analysis. (A) Diagram in Venn form displays the quantity of common targets among ginsenosides, NSCLC, and apoptosis. (B) PPI network of the common targets based on degree value assessed using Cytoscape software. (C) The top 30 most-enriched KEGG categories for the common targets show the vital ginsenoside-related signaling pathway against NSCLC according to network pharmacology analysis. (D) KEGG secondary classification of the top 30 signaling pathways. (E) Component–target–pathway network diagram; blue represents components, yellow represents targets, and purple represents pathways.
Figure 3. Results of network pharmacology analysis. (A) Diagram in Venn form displays the quantity of common targets among ginsenosides, NSCLC, and apoptosis. (B) PPI network of the common targets based on degree value assessed using Cytoscape software. (C) The top 30 most-enriched KEGG categories for the common targets show the vital ginsenoside-related signaling pathway against NSCLC according to network pharmacology analysis. (D) KEGG secondary classification of the top 30 signaling pathways. (E) Component–target–pathway network diagram; blue represents components, yellow represents targets, and purple represents pathways.
Molecules 30 03697 g003
Figure 4. Results of molecular docking. Visualization of binding patterns of ginsenosides CK, Rh2(S), and Rg3(S) to PI3K (A), Akt (B), and FoxO (C), respectively. (D) Heatmap of binding energy between ginsenosides and target proteins.
Figure 4. Results of molecular docking. Visualization of binding patterns of ginsenosides CK, Rh2(S), and Rg3(S) to PI3K (A), Akt (B), and FoxO (C), respectively. (D) Heatmap of binding energy between ginsenosides and target proteins.
Molecules 30 03697 g004
Figure 5. Ginsenosides induced mRNA transcript expression level changes in A549 cell lines in vitro. The expression levels of PI3K (A), Akt (B), FoxO (C), Bim (D), Caspase-3 (E), Caspase-8 (F), and Caspase-9 (G) were determined by qRT-PCR after ginsenoside administration for 24 h. Error bars represent mean ± SD; n = 3. (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 vs. the control of the 10% serum group; # p < 0.05, ## p < 0.01, ### p < 0.001, and #### p < 0.0001 vs. the control of the serum-free group).
Figure 5. Ginsenosides induced mRNA transcript expression level changes in A549 cell lines in vitro. The expression levels of PI3K (A), Akt (B), FoxO (C), Bim (D), Caspase-3 (E), Caspase-8 (F), and Caspase-9 (G) were determined by qRT-PCR after ginsenoside administration for 24 h. Error bars represent mean ± SD; n = 3. (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001 vs. the control of the 10% serum group; # p < 0.05, ## p < 0.01, ### p < 0.001, and #### p < 0.0001 vs. the control of the serum-free group).
Molecules 30 03697 g005
Figure 6. Ginsenosides induce the loss of mitochondrial membrane potential (ΔΨm) in A549 cells under serum starvation. (A) JC-1 staining in cells cultured with 10% serum. Treatment with ginsenosides alone did not alter ΔΨm, as indicated by predominant red fluorescence. (B) JC-1 staining under serum-free conditions. Serum starvation alone did not reduce ΔΨm, while combined treatment with ginsenosides strongly enhanced green fluorescence, indicating ΔΨm loss. (C) Quantitative analysis of the JC-1 monomer/aggregate ratio. A significant increase in the ratio was observed only in serum-starved cells treated with ginsenosides (# p < 0.05, ## p < 0.01, and ### p < 0.001 vs. serum-free control; * p < 0.05 vs. 10% serum control). Scale bar: 20 μm. Error bars represent mean ± SD; n = 3.
Figure 6. Ginsenosides induce the loss of mitochondrial membrane potential (ΔΨm) in A549 cells under serum starvation. (A) JC-1 staining in cells cultured with 10% serum. Treatment with ginsenosides alone did not alter ΔΨm, as indicated by predominant red fluorescence. (B) JC-1 staining under serum-free conditions. Serum starvation alone did not reduce ΔΨm, while combined treatment with ginsenosides strongly enhanced green fluorescence, indicating ΔΨm loss. (C) Quantitative analysis of the JC-1 monomer/aggregate ratio. A significant increase in the ratio was observed only in serum-starved cells treated with ginsenosides (# p < 0.05, ## p < 0.01, and ### p < 0.001 vs. serum-free control; * p < 0.05 vs. 10% serum control). Scale bar: 20 μm. Error bars represent mean ± SD; n = 3.
Molecules 30 03697 g006
Figure 7. Schematic diagram of the mechanism through which ginsenosides inhibit the proliferation of and promote apoptosis in A549 cells via the PI3K/Akt/FoxO pathway under serum starvation.
Figure 7. Schematic diagram of the mechanism through which ginsenosides inhibit the proliferation of and promote apoptosis in A549 cells via the PI3K/Akt/FoxO pathway under serum starvation.
Molecules 30 03697 g007
Table 1. Information on active ingredients of ginsenosides.
Table 1. Information on active ingredients of ginsenosides.
NumberPubChem CIDMolecule NameDegree
G1991869320(S)-Ginsenoside Rg310
G211930720(S)-ginsenoside Rh210
G39852086Ginsenoside CK9
G411875348620(S)-Ginsenoside Rh2 Metabolite M1-17
G51121335020(S)-Protopanaxadiol22
G6101228398Protopanaxadiol Oxide17
G711875321920(S)-Protopanaxadiol Metabolite M1-125
G81231483620(S)-Protopanaxadiol Metabolite M1-29
G97335232120(S)-Protopanaxadiol Metabolite M1-313
Table 2. Ginsenosides docking with key proteins.
Table 2. Ginsenosides docking with key proteins.
Target ProteinPDB IDCompoundAffinity (kcal/mol)H Bonds
PI3K4BFRRg3(S)−8.312ARG805 (2.0 Å, 2.6 Å)
Rh2(S)−8.647ARG988 (2.1 Å, 2.8 Å), ASN992 (2.0 Å)
CK−8.201ASN992 (2.0 Å), GLU1029 (2.7 Å), and LEU1024 (2.5 Å)
Akt6HHIRg3(S)−7.475GLN404 (2.3 Å, 2.4 Å), ILE411 (2.1 Å), and TRP413 (2.2 Å)
Rh2(S)−9.203GLU85 (2.5 Å), LYS297 (1.8 Å)
CK−7.602ALA58 (2.7 Å)
FoxO7V9BRg3(S)−8.223GLU134 (2.2 Å), SER64 (2.4 Å, 2.4 Å)
Rh2(S)−8.342GLN16 (2.3 Å), GLU15 (2.2 Å)
CK−7.486ARG61 (2.4 Å), ARG248 (2.7 Å), and SER64 (2.6 Å)
Table 3. Primers used in qRT-PCR.
Table 3. Primers used in qRT-PCR.
GeneForward Primers (From 5′ to 3′)Reverse Primers (From 5′ to 3′)
PI3KGGTTGGTGGCTGTTCTTACTGTCCAAGTCTGGCTGGAATGATGCTAT
AKTCCACTGTCATCGAACGCACCTTGAAGTCCATCTCCTCCTCCTCCTG
FoxO3aAGTTCCCTCATTCTGGACCCCTTCAAGGATAAGGGCGACA
BimGATAGTGGTTGAAGGCCTGGCCTCCCTACAGACAGAGCCA
Caspase-3TGCAGTCATTATGAGAGGCAATAAGGTTTGAGCCTTTGACCA
Caspase-8GAAGATAATCAACGACTATGTTCACTATCCTGTTCTCT
Caspase-9ACATGCTGGCTTCGTTTCTGTCTCAAGAGCACCGACATCA
β-actinGCAAGCAGGAGTATGACGAGCAAATAAAGCCATGCCAATC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Li, K.; Sun, M.; Gu, Z.; Men, L.; Gong, X.; Li, Z. Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules 2025, 30, 3697. https://doi.org/10.3390/molecules30183697

AMA Style

Li J, Li K, Sun M, Gu Z, Men L, Gong X, Li Z. Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules. 2025; 30(18):3697. https://doi.org/10.3390/molecules30183697

Chicago/Turabian Style

Li, Jiwen, Keke Li, Mei Sun, Zhihong Gu, Lei Men, Xiaojie Gong, and Zhongyu Li. 2025. "Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells" Molecules 30, no. 18: 3697. https://doi.org/10.3390/molecules30183697

APA Style

Li, J., Li, K., Sun, M., Gu, Z., Men, L., Gong, X., & Li, Z. (2025). Ginsenosides Enhanced Apoptosis of Serum-Free Starved A549 Lung Cancer Cells. Molecules, 30(18), 3697. https://doi.org/10.3390/molecules30183697

Article Metrics

Back to TopTop