Cymbopogon citratus and Citral Overcome Doxorubicin Resistance in Cancer Cells via Modulating the Drug’s Metabolism, Toxicity, and Multidrug Transporters
Abstract
1. Introduction
2. Results
2.1. GC/MS Identification of Active Constituent of LG
2.2. Cytotoxicity of LG and Citral
2.3. Combination of LG and Citral with DOX
2.4. Reversal of DOX Resistance by LG and Citral
2.5. Modulation of Metabolic Genes by LG and Citral
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Extraction of LC Essential Oils
4.3. GC/MS Analysis
4.4. Cell Lines
4.5. Cytotoxicity LG and Citral and Their Combination with DOX
4.6. Efflux Pump Functional Assay
4.7. mRNA Levels Using RT-PCR
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Ferlay, J.; Ervik, M.; Lam, F.; Colombet, M.; Mery, L.; Piñeros, M.; Znaor, A.; Soerjomataram, I.; Bray, F. Global Cancer Observatory: Cancer Today; International Agency for Research on Cancer: Lyon, France, 2020; Available online: https://gco.iarc.fr/today (accessed on 28 February 2021).
- Nguyen, C. Anticancer Activity of Natural Health Products (Dandelion Root, Lemongrass, and Hibiscus Extracts); A Study of Efficacy Interaction and Mechanism of Action; University of Windsor: Windsor, ON, Canada, 2019. [Google Scholar]
- Paskeviciute, M.; Petrikaite, V. Overcoming transporter-mediated multidrug resistance in cancer: Failures and achievements of the last decades. Drug Deliv. Transl. Res. 2019, 9, 379–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lehnert, M. Clinical multidrug resistance in cancer: A multifactorial problem. Eur. J. Cancer 1996, 32, 912–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nour Eldin, E.E.M.; El-Readi, M.Z.; Nour Eldein, M.M.; Alfalki, A.A.; Althubiti, M.A.; Mohamed Kamel, H.F.; Eid, S.Y.; Al-Amodi, H.S.; Mirza, A.A. 8-Hydroxy-2′-deoxyguanosine as a Discriminatory Biomarker for Early Detection of Breast Cancer. Clin. Breast Cancer 2018, 19, e385–e393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Khan, M.; Maryam, A.; Mehmood, T.; Zhang, Y.; Ma, T. Enhancing Activity of Anticancer Drugs in Multidrug Resistant Tumors by Modulating P-Glycoprotein through Dietary Nutraceuticals. Asian Pac. J. Cancer Prev. 2015, 16, 6831–6839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.; Krstin, S.; Wang, S.; Wink, M. Capsaicin and Piperine Can Overcome Multidrug Resistance in Cancer Cells to Doxorubicin. Molecules 2018, 23, 557. [Google Scholar] [CrossRef] [Scilit]
- Eid, S.Y.; El-Readi, M.Z.; Wink, M. Carotenoids reverse multidrug resistance in cancer cells by interfering with ABC-transporters. Phytomedicine 2012, 19, 977–987. [Google Scholar] [CrossRef] [Scilit]
- Wink, M.; Ashour, M.L.; El-Readi, M.Z. Secondary Metabolites from Plants Inhibiting ABC Transporters and Reversing Resistance of Cancer Cells and Microbes to Cytotoxic and Antimicrobial Agents. Front. Microbiol. 2012, 3, 130. [Google Scholar] [CrossRef] [Scilit]
- El-Readi, M.Z.; Hamdan, D.; Farrag, N.; El-Shazly, A.; Wink, M. Inhibition of P-glycoprotein activity by limonin and other secondary metabolites from Citrus species in human colon and leukaemia cell lines. Eur. J. Pharmacol. 2010, 626, 139–145. [Google Scholar] [CrossRef] [Scilit]
- El-Readi, M.Z.; Eid, S.; Abdelghany, A.A.; Al-Amoudi, H.S.; Efferth, T.; Wink, M. Resveratrol mediated cancer cell apoptosis, and modulation of multidrug resistance proteins and metabolic enzymes. Phytomedicine 2019, 55, 269–281. [Google Scholar] [CrossRef] [Scilit]
- Eid, S.Y.; El-Readi, M.Z.; Ashour, M.L.; Wink, M. Fallopia japonica, a Natural Modulator, Can Overcome Multidrug Resistance in Cancer Cells. Evid. Based Complement. Altern. Med. 2015, 2015, 868424. [Google Scholar] [CrossRef] [Scilit]
- El-Readi, M.Z.; Eid, S.; Ashour, M.L.; Tahrani, A.; Wink, M. Modulation of multidrug resistance in cancer cells by chelidonine and Chelidonium majus alkaloids. Phytomedicine 2013, 20, 282–294. [Google Scholar] [CrossRef] [Scilit]
- Dawud, M.A.E.; Suad, A.R. The flora of holy Mecca district, Saudi Arabia. Int. J. Biodivers. Conserv. 2015, 7, 173–189. [Google Scholar] [CrossRef] [Scilit]
- Akande, I.; Samuel, T.; Agbazue, U.; Olowolagba, B.L. Comparative proximate analysis of ethanolic and water extracts of Cymbopogon citratus (lemon grass) and four tea brands. Plant Sci. Res. 2011, 3, 29–35. [Google Scholar]
- Ekpenyong, C.E.; Akpan, E.; Nyoh, A. Ethnopharmacology, phytochemistry, and biological activities of Cymbopogon citratus (DC.) Stapf extracts. Chin. J. Nat. Med. 2015, 13, 321–337. [Google Scholar] [CrossRef] [Scilit]
- Sabry, A.; El-Zayat, S.; El-Said, A.; Abdel-Motaal, F.; Magraby, T. Mycoflora associated with Halfa-bar leaves and stems (Cymbopogon schoenanthus L. Sprengel), in vitro the antimicrobial activity of the plant leaves and stems secondary metabolites. Int. J. Curr. Microbiol. Appl. Sci. 2014, 3, 874–882. [Google Scholar]
- Koba, K.; Poutouli, P.; Nenonene, Y.; Songai, M.; Raynaud, C.; Sanda, K. Chemical composition and anti-termite activity of three tropical essential oils against termite species Trinervitermes geminatus (wasmann). J. Sci. Technol. 2007, 5, 39–46. [Google Scholar]
- Al-Ghamdi, S.S.; Al-Ghamdi, A.A.; Shammah, A.A. Inhibition of calcium oxalate nephrotoxicity with Cymbopogon schoenanthus (Al-Ethkher). Drug. Metab. Lett. 2007, 1, 241–244. [Google Scholar] [CrossRef] [Scilit]
- Shah, G.; Shri, R.; Panchal, V.; Sharma, N.; Singh, B.; Mann, A.S. Scientific basis for the therapeutic use of Cymbopogon citratus, stapf (Lemon grass). J. Adv. Pharm. Technol. Res. 2011, 2, 3–8. [Google Scholar] [CrossRef] [Scilit]
- Akhila, A. Chemistry and biogenesis of essential oil from the genus Cymbopogon. In Essential Oil-Bearing Grasses: The Genus Cymbopogon; Akhila, A., Ed.; Taylor & Francis: Cleveland, OH, USA, 2010; pp. 25–106. [Google Scholar]
- Costa, G.; Ferreira, J.P.; Vitorino, C.; Pina, M.E.; Sousa, J.J.; Figueiredo, I.V.; Batista, M.T. Polyphenols from Cymbopogon citratus leaves as topical anti-inflammatory agents. J. Ethnopharmacol. 2016, 178, 222–228. [Google Scholar] [CrossRef] [Scilit]
- Campos, J.; Schmeda-Hirschmann, G.; Leiva, E.; Guzmán, L.; Orrego, R.; Fernández, P.; González, M.; Radojkovic, C.; Zuñiga, F.; Lamperti, L. Lemon grass (Cymbopogon citratus (DC) Stapf) polyphenols protect human umbilical vein endothelial cell (HUVECs) from oxidative damage induced by high glucose, hydrogen peroxide and oxidised low-density lipoprotein. J. Food Chem. 2014, 151, 175–181. [Google Scholar] [CrossRef] [Scilit]
- Avoseh, O.; Oyedeji, O.; Rungqu, P.; Nkeh-Chungag, B.; Oyedeji, A. Cymbopogon species; ethnopharmacology, phytochemistry and the pharmacological importance. Molecules 2015, 20, 7438–7453. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bieski, I.G.; Leonti, M.; Arnason, J.T.; Ferrier, J.; Rapinski, M.; Violante, I.M.; Balogun, S.O.; Pereira, J.F.; Figueiredo Rde, C.; Lopes, C.R.; et al. Ethnobotanical study of medicinal plants by population of Valley of Juruena Region, Legal Amazon, Mato Grosso, Brazil. J. Ethnopharmacol. 2015, 173, 383–423. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ganjewala, D. Cymbopogon essential oils: Chemical compositions and bioactivities. J Int. J. Essent. Oil Ther. 2009, 3, 56–65. [Google Scholar]
- Faruq, M. TLC technique in the component characterization and quality determination of Bangladeshi lemongrass oil (Cymbopogon citratus (DC) Stapf.). J. Bangladesh J. Sci. Ind. Res. 1994, 29, 27–38. [Google Scholar]
- Negrelle, R.; Gomes, E. Cymbopogon citratus (DC.) Stapf: Chemical composition and biological activities. J. Rev. Bras. Plant. Med. 2007, 9, 80–92. [Google Scholar]
- Hanaa, A.M.; Sallam, Y.; El-Leithy, A.; Aly, S.E. Lemongrass (Cymbopogon citratus) essential oil as affected by drying methods. J. Ann. Agric. Sci. 2012, 57, 113–116. [Google Scholar] [CrossRef] [Scilit]
- Chisowa, E.H.; Hall, D.R.; Farman, D. Volatile constituents of the essential oil of Cymbopogon citratus Stapf grown in Zambia. Flavour Fragr. J. 1998, 13, 29–30. [Google Scholar] [CrossRef]
- Viktorova, J.; Stupak, M.; Rehorova, K.; Dobiasova, S.; Hoang, L.; Hajslova, J.; Thanh, T.V.; Tri, L.V.; Tuan, N.V.; Ruml, T. Lemon Grass Essential Oil Does not Modulate Cancer Cells Multidrug Resistance by Citral-Its Dominant and Strongly Antimicrobial Compound. Foods 2020, 9, 585. [Google Scholar] [CrossRef] [Scilit]
- Dewi, G.; Nair, D.V.T.; Peichel, C.; Johnson, T.J.; Noll, S.; Kollanoor Johny, A. Effect of lemongrass essential oil against multidrug-resistant Salmonella Heidelberg and its attachment to chicken skin and meat. Poult Sci. 2021, 100, 101116. [Google Scholar] [CrossRef] [Scilit]
- Bučková, M.; Puškárová, A.; Kalászová, V.; Kisová, Z.; Pangallo, D. Essential oils against multidrug resistant gram-negative bacteria. J. Biologia 2018, 73, 803–808. [Google Scholar] [CrossRef] [Scilit]
- Manosroi, J.; Dhumtanom, P.; Manosroi, A. Anti-proliferative activity of essential oil extracted from Thai medicinal plants on KB and P388 cell lines. Cancer Lett. 2006, 235, 114–120. [Google Scholar] [CrossRef] [Scilit]
- Najar, B.; Shortrede, J.E.; Pistelli, L.; Buhagiar, J. Chemical Composition and in Vitro Cytotoxic Screening of Sixteen Commercial Essential Oils on Five Cancer Cell Lines. Chem. Biodivers. 2020, 17, e1900478. [Google Scholar] [CrossRef] [Scilit]
- Mukarram, M.; Choudhary, S.; Khan, M.A.; Poltronieri, P.; Khan, M.M.A.; Ali, J.; Kurjak, D.; Shahid, M. Lemongrass Essential Oil Components with Antimicrobial and Anticancer Activities. Antioxidants 2022, 11, 20. [Google Scholar] [CrossRef] [Scilit]
- Maruoka, T.; Kitanaka, A.; Kubota, Y.; Yamaoka, G.; Kameda, T.; Imataki, O.; Dobashi, H.; Bandoh, S.; Kadowaki, N.; Tanaka, T. Lemongrass essential oil and citral inhibit Src/Stat3 activity and suppress the proliferation/survival of small-cell lung cancer cells, alone or in combination with chemotherapeutic agents. Int. J. Oncol. 2018, 52, 1738–1748. [Google Scholar] [CrossRef] [Scilit]
- Zulfa, Z.; Chia, C.; Rukayadi, Y. In vitro antimicrobial activity of Cymbopogon citratus (lemongrass) extracts against selected foodborne pathogens. J. Int. Food Res. J. 2016, 23, 1262. [Google Scholar]
- Farooqi, A.A.; Fuentes-Mattei, E.; Fayyaz, S.; Raj, P.; Goblirsch, M.; Poltronieri, P.; Calin, G.A. Interplay between Epigenetic Abnormalities and Deregulated Expression of microRNAs in Cancer Seminars in Cancer Biology; Elsevier: Amsterdam, The Netherlands, 2019; pp. 47–55. [Google Scholar]
- Boukhatem, M.N.; Kameli, A.; Ferhat, M.A.; Saidi, F.; Tayebi, K. The food preservative potential of essential oils: Is lemongrass the answer? J. J. Verbrauch. Lebensm. 2014, 9, 13–21. [Google Scholar] [CrossRef] [Scilit]
- Ruvinov, I.; Nguyen, C.; Scaria, B.; Vegh, C.; Zaitoon, O.; Baskaran, K.; Mehaidli, A.; Nunes, M.; Pandey, S. Lemongrass Extract Possesses Potent Anticancer Activity Against Human Colon Cancers, Inhibits Tumorigenesis, Enhances Efficacy of FOLFOX, and Reduces Its Adverse Effects. Integr. Cancer Ther. 2019, 18, 1534735419889150. [Google Scholar] [CrossRef] [Scilit]
- Petzinger, E.; Geyer, J. Drug transporters in pharmacokinetics. Naunyn Schmiedebergs Arch Pharmacol. 2006, 372, 465–475. [Google Scholar] [CrossRef] [Scilit]
- Sobeh, M.; Braun, M.S.; Krstin, S.; Youssef, F.S.; Ashour, M.L.; Wink, M. Chemical profiling of the essential oils of Syzygium aqueum, Syzygium samarangense and Eugenia uniflora and their discrimination using chemometric analysis. J. Chem. Biodivers. 2016, 13, 1537–1550. [Google Scholar] [CrossRef] [Scilit]
- Sobeh, M.; Mamadalieva, N.Z.; Mohamed, T.; Krstin, S.; Youssef, F.S.; Ashour, M.L.; Azimova, S.S.; Wink, M. Chemical profiling of Phlomis thapsoides (Lamiaceae) and in vitro testing of its biological activities. J. Med. Chem. Res. 2016, 25, 2304–2315. [Google Scholar] [CrossRef] [Scilit]
- Youssef, F.S.; Hamoud, R.; Ashour, M.L.; Singab, A.N.; Wink, M. Volatile oils from the aerial parts of Eremophila maculata and their antimicrobial activity. J. Chem. Biodivers. 2014, 11, 831–841. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Carmichael, J.; DeGraff, W.G.; Gazdar, A.F.; Minna, J.D.; Mitchell, J.B. Evaluation of a tetrazolium-based semiautomated colorimetric assay: Assessment of chemosensitivity testing. Cancer Res. 1987, 47, 936–942. [Google Scholar] [PubMed]
- Neyfakh, A.A. Use of fluorescent dyes as molecular probes for the study of multidrug resistance. Exp. Cell Res. 1988, 174, 168–176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Albermann, N.; Schmitz-Winnenthal, F.H.; Z’Graggen, K.; Volk, C.; Hoffmann, M.M.; Haefeli, W.E.; Weiss, J. Expression of the drug transporters MDR1/ABCB1, MRP1/ABCC1, MRP2/ABCC2, BCRP/ABCG2, and PXR in peripheral blood mononuclear cells and their relationship with the expression in intestine and liver. Biochem. Pharmacol. 2005, 70, 949–958. [Google Scholar] [CrossRef] [Scilit]
- Gutmann, H.; Fricker, G.; Torok, M.; Michael, S.; Beglinger, C.; Drewe, J. Evidence for different ABC-transporters in Caco-2 cells modulating drug uptake. Pharm. Res. 1999, 16, 402–407. [Google Scholar] [CrossRef] [Scilit]
- Sauerbrey, A.; Sell, W.; Steinbach, D.; Voigt, A.; Zintl, F. Expression of the BCRP gene (ABCG2/MXR/ABCP) in childhood acute lymphoblastic leukaemia. Br. J. Haematol. 2002, 118, 147–150. [Google Scholar] [CrossRef] [Scilit]
- Nijhof, A.M.; Balk, J.A.; Postigo, M.; Jongejan, F. Selection of reference genes for quantitative RT-PCR studies in Rhipicephalus (Boophilus) microplus and Rhipicephalus appendiculatus ticks and determination of the expression profile of Bm86. BMC Mol. Biol. 2009, 10, 112. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.; Tang, Y.; Wang, M.T.; Zeng, S.; Nie, D. Human pregnane X receptor and resistance to chemotherapy in prostate cancer. Cancer Res. 2007, 67, 10361–10367. [Google Scholar] [CrossRef] [Scilit]
- Oselin, K.; Nowakowski-Gashaw, I.; Mrozikiewicz, P.M.; Wolbergs, D.; Pahkla, R.; Roots, I. Quantitative determination of MDR1 mRNA expression in peripheral blood lymphocytes: A possible role of genetic polymorphisms in the MDR1 gene. Eur. J. Clin. Investig. 2003, 33, 261–267. [Google Scholar] [CrossRef] [Scilit]
- Chou, T.C. Theoretical basis, experimental design, and computerized simulation of synergism and antagonism in drug combination studies. Pharmacol. Rev. 2006, 58, 621–681. [Google Scholar] [CrossRef] [Scilit]
- Chou, T.C. Drug combination studies and their synergy quantification using the Chou-Talalay method. Cancer Res. 2010, 70, 440–446. [Google Scholar] [CrossRef] [Scilit]






| No. | Compounds | RI | Relative Abundance (%) |
|---|---|---|---|
| 1 | β-Myrcene | 987 | 0.6 |
| 2 | β-Linalool | 1103 | 0.87 |
| 3 | β-Citral | 1248 | 10.15 |
| 4 | Geraniol | 1260 | 1.21 |
| 5 | α-Citral | 1279 | 18.50 |
| 6 | Anethole | 1287 | 1.39 |
| 7 | γ-Terpinen-7-al | 1292 | 0.86 |
| 8 | Carvacrol | 1307 | 0.94 |
| 9 | p-Mentha-1,4-dien-7-ol | 1332 | 0.6 |
| 10 | Nerolic acid | 1338 | 1.87 |
| 11 | δ-Elemene | 1346 | 5.38 |
| 12 | Eugenol | 1370 | 4.77 |
| 13 | Ylangene | 1375 | 5.70 |
| 14 | Geranyl acetate | 1382 | 9.65 |
| 15 | trans-α-Bergamotene | 1415 | 2.43 |
| 16 | β-Caryophyllene | 1432 | 0.6 |
| 17 | trans-α-Ionone | 1436 | 1.1 |
| 18 | cis-β-Copaene | 1441 | 2.3 |
| 19 | τ-Gurjunene | 1476 | 2.02 |
| 20 | Germacrene D | 1496 | 1.82 |
| 21 | δ-Guaiene | 1514 | 0.96 |
| 22 | Guaiacylacetone | 1545 | 2.88 |
| 23 | α-Calacorene | 1552 | 0.94 |
| 24 | Caryophylene oxide | 1596 | 1.51 |
| 25 | Humulane-1,6-dien-3-ol | 1610 | 0.76 |
| 26 | δ-Cadinol | 1630 | 3.09 |
| 27 | τ-Cadinol | 1656 | 1.19 |
| 28 | τ-Muurolol | 1669 | 2.43 |
| 29 | Eudesm-7(11)-en-4-ol | 1676 | 1.17 |
| 30 | Farnesal | 1737 | 1.22 |
| 31 | Myristic acid | 1780 | 0.63 |
| 32 | Hexahydrofarnesyl acetate | 1841 | 1.48 |
| 33 | Oleic acid | 2161 | 2.68 |
| 34 | 1-Docosene | 2196 | 0.81 |
| 35 | (Z)-Methyl communate | 2235 | 0.78 |
| Monoterpene hydrocarbons | 0.6 | ||
| Oxygen-containing monoterpenes | 53.69 | ||
| Sesquiterpene hydrocarbons | 19.19 | ||
| Oxygen-containing sesquiterpenes | 13.09 | ||
| Others | 8.72 | ||
| Total identified | 95.29 | ||
| Cells | LG | Citral | DOX |
|---|---|---|---|
| HepG-2 | 129.7 ± 11.4 | 242.9 ± 22.1 | 1.21 ± 0.11 |
| HepG-2/ADR | 281.8 ± 16.1 *** | 323.3 ± 31.2 ** | 9.6 ± 0.75 *** |
| RR | 2.17 | 1.33 | 7.93 |
| MCF-7 | 126.8 ± 10.9 | 210.2 ± 17.1 | 1.29 ± 0.12 |
| MCF-7/ADR | 211.5 ± 17.3 *** | 245.8 ± 15.9 * | 15.1 ± 1.3 *** |
| RR | 1.67 | 1.16 | 11.71 |
| SOVK-3 | 131.8 ± 9.5 | 208.4 ± | 1.17 ± 0.11 |
| SOVK-3/ADR | 219.7 ± 19.7 *** | 252.3 ± 23.2 * | 11.8 ± 1.2 *** |
| RR | 1.67 | 1.2 | 10.1 |
| Cells | Combination | IC50 | FR | CI | r | IB |
|---|---|---|---|---|---|---|
| HepG-2/ADR | DOX | 9.6 ± 0.75 | ||||
| DOX + LG | 3.11 ± 0.29 *** | 3.1 | 0.39 | 0.99 | Synergism | |
| DOX + Citral | 3.94 ± 0.32 *** | 2.4 | 0.47 | 0.98 | Synergism | |
| MCF-7/ADR | DOX | 15.1 ± 1.3 | ||||
| DOX + LG | 3.71 ± 0.24 *** | 4.1 | 0.43 | 0.98 | Synergism | |
| DOX + Citral | 6.86 ± 0.49 *** | 2.2 | 0.54 | 0.99 | Synergism | |
| SOVK-3/ADR | DOX | 11.8 ± 1.2 | ||||
| DOX + LG | 3.81 ± 0.27 *** | 4.0 | 0.41 | 0.99 | Synergism | |
| DOX + Citral | 7.8 ± 0.54 *** | 1.5 | 0.74 | 0.99 | Synergism |
| Gene | Accession | Forward Primer 5′–3′ | Reverse Primer 5′–3′ | Design |
|---|---|---|---|---|
| P-gp/ABCB1/MDR1 | NM_001348946.1 GI: 1149123048 | CCCATCATTGCAATAGCAGG | TGTTCAAACTTCTGCTCCTGA | [48] |
| MRP1/ABCC1 | NM_004996.3 GI: 134142336 | ATGTCACGTGGAATACCAGC | GAAGACTGAACTCCCTTCCT | [49] |
| BCRP/ABCG2 | NM_004827.2 GI: 62526032 | AGATGGGTTTCCAAGCGTTCAT | CCAGTCCCAGTACGACTGTGACA | [50] |
| GST | M99422.1 GI: 183662 | TACCTGGGCAAGAAGCACGG | AGAGCCCAGAGCAGGTCGTTG | [51] |
| CYP3A4 | NM_017460.5 GI: 322960990 | CTAGCACATCATTTGGACTG | ACAGAGCTTTGTGGGACT | [52] |
| hPXR | NM_003889.3 GI: 148536875 | TGTCATGACATGTGAAGGATG | TTGAAATGGGAGAAGGTAGTG | [52] |
| β2mg | X07621.1 GI: 29298 | CCAGCAGAGAATGGAAAGTC | CATGTCTCGATCCCACTTAAC | [53] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mukhtar, M.H.; El-Readi, M.Z.; Elzubier, M.E.; Fatani, S.H.; Refaat, B.; Shaheen, U.; Adam Khidir, E.B.; Taha, H.H.; Eid, S.Y. Cymbopogon citratus and Citral Overcome Doxorubicin Resistance in Cancer Cells via Modulating the Drug’s Metabolism, Toxicity, and Multidrug Transporters. Molecules 2023, 28, 3415. https://doi.org/10.3390/molecules28083415
Mukhtar MH, El-Readi MZ, Elzubier ME, Fatani SH, Refaat B, Shaheen U, Adam Khidir EB, Taha HH, Eid SY. Cymbopogon citratus and Citral Overcome Doxorubicin Resistance in Cancer Cells via Modulating the Drug’s Metabolism, Toxicity, and Multidrug Transporters. Molecules. 2023; 28(8):3415. https://doi.org/10.3390/molecules28083415
Chicago/Turabian StyleMukhtar, Mohammed Hasan, Mahmoud Zaki El-Readi, Mohamed E. Elzubier, Sameer H. Fatani, Bassem Refaat, Usama Shaheen, Elshiekh Babiker Adam Khidir, Hesham Hamada Taha, and Safaa Yehia Eid. 2023. "Cymbopogon citratus and Citral Overcome Doxorubicin Resistance in Cancer Cells via Modulating the Drug’s Metabolism, Toxicity, and Multidrug Transporters" Molecules 28, no. 8: 3415. https://doi.org/10.3390/molecules28083415
APA StyleMukhtar, M. H., El-Readi, M. Z., Elzubier, M. E., Fatani, S. H., Refaat, B., Shaheen, U., Adam Khidir, E. B., Taha, H. H., & Eid, S. Y. (2023). Cymbopogon citratus and Citral Overcome Doxorubicin Resistance in Cancer Cells via Modulating the Drug’s Metabolism, Toxicity, and Multidrug Transporters. Molecules, 28(8), 3415. https://doi.org/10.3390/molecules28083415

