Renieramycin T Inhibits Melanoma B16F10 Cell Metastasis and Invasion via Regulating Nrf2 and STAT3 Signaling Pathways
Abstract
:1. Introduction
2. Results
2.1. RT Had No Effect on Inflammation-Induced B16F10 Cell Proliferation
2.2. RT Inhibits the Supernatant of RAW264.7 Cells-Induced B16F10 Cell Migration and Invasion
2.3. RT Inhibited the Expression of Metastasis-Related Genes in RAW264.7 Cells Supernatant-Induced Tumor Cells
2.4. RT Suppressed the STAT3 and Nrf2 Signaling Pathways in B16F10 Cells
2.5. Proposed Model of RT in Suppressing B16F10 Cell Migration and Invasion
3. Discussion
4. Materials and Methods
4.1. Reagent and Antibody
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Wound Healing Assay
4.5. Transwell Assay
4.6. Quantitative Real Time-PCR (qRT-PCR)
4.7. Western Blot
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Liu, Y.; Li, H.; Liu, F.; Gao, L.B.; Han, R.; Chen, C.; Ding, X.; Li, S.; Lu, K.; Yang, L.; et al. Heterogeneous nuclear ribonucleoprotein A2/B1 is a negative regulator of human breast cancer metastasis by maintaining the balance of multiple genes and pathways. EBioMedicine 2020, 51, 102583. [Google Scholar] [CrossRef] [PubMed]
- Denecker, G.; Vandamme, N.; Akay, O.; Koludrovic, D.; Taminau, J.; Lemeire, K.; Gheldof, A.; De Craene, B.; Van Gele, M.; Brochez, L.; et al. Identification of a ZEB2-MITF-ZEB1 transcriptional network that controls melanogenesis and melanoma progression. Cell Death Differ. 2014, 21, 1250–1261. [Google Scholar] [CrossRef] [PubMed]
- Dang, N.N.; Jiao, J.; Meng, X.; An, Y.; Han, C.; Huang, S. Abnormal overexpression of G9a in melanoma cells promotes cancer progression via upregulation of the Notch1 signaling pathway. Aging (Albany N. Y.) 2020, 12, 2393–2407. [Google Scholar] [CrossRef] [PubMed]
- Han, Y.H.; Mun, J.G.; Jeon, H.D.; Park, J.; Kee, J.Y.; Hong, S.H. Gomisin A ameliorates metastatic melanoma by inhibiting AMPK and ERK/JNK-mediated cell survival and metastatic phenotypes. Phytomedicine 2020, 68, 153147. [Google Scholar] [CrossRef] [PubMed]
- Javelaud, D.; Mohammad, K.S.; McKenna, C.R.; Fournier, P.; Luciani, F.; Niewolna, M.; André, J.; Delmas, V.; Larue, L.; Guise, T.A.; et al. Stable overexpression of Smad7 in human melanoma cells impairs bone metastasis. Cancer Res. 2007, 67, 2317–2324. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Liu, W.; Wang, Z.; Zeng, B.; Peng, G.; Niu, H.; Chen, L.; Liu, C.; Hu, Q.; Zhang, Y.; et al. Mesenchymal stem cells derived from iPSCs expressing interleukin-24 inhibit the growth of melanoma in the tumor-bearing mouse model. Cancer Cell Int. 2020, 20, 33. [Google Scholar] [CrossRef]
- Robinson, B.D.; Jones, J.G. Tumor microenvironment of metastasis (TMEM): A novel tissue-based assay for metastatic risk in breast cancer. Future Oncol. 2009, 5, 919–921. [Google Scholar] [CrossRef]
- Mantovani, A.; Sica, A. Macrophages, innate immunity and cancer: Balance, tolerance, and diversity. Curr. Opin. Immunol. 2010, 22, 231–237. [Google Scholar] [CrossRef]
- Kuo, C.; Yang, T.; Tsai, P.; Yu, C. Role of the Inflammatory Response of RAW 264.7 Cells in the Metastasis of Novel Cancer Stem-Like Cells. Medicina (Kaunas) 2021, 57, 778. [Google Scholar] [CrossRef]
- Wang, Q.; Ni, H.; Lan, L.; Wei, X.; Xiang, R.; Wang, Y. Fra-1 protooncogene regulates IL-6 expression in macrophages and promotes the generation of M2d macrophages. Cell Res. 2010, 20, 701–712. [Google Scholar] [CrossRef]
- Yang, J.; Zhang, Z.; Chen, C.; Liu, Y.; Si, Q.; Chuang, T.H.; Li, N.; Gomez-Cabrero, A.; Reisfeld, R.A.; Xiang, R.; et al. MicroRNA-19a-3p inhibits breast cancer progression and metastasis by inducing macrophage polarization through downregulated expression of Fra-1 proto-oncogene. Oncogene 2014, 33, 3014–3023. [Google Scholar] [CrossRef]
- Abdel-Gaber, S.A.; Geddawy, A.; Moussa, R.A. The hepatoprotective effect of sitagliptin against hepatic ischemia reperfusion-induced injury in rats involves Nrf-2/HO-1 pathway. Pharmacol. Rep. 2019, 71, 1044–1049. [Google Scholar] [CrossRef] [PubMed]
- Zuo, J.; Zhao, M.; Fan, Z.; Liu, B.; Wang, Y.; Li, Y.; Lv, P.; Xing, L.; Zhang, X.; Shen, H. MicroRNA-153-3p regulates cell proliferation and cisplatin resistance via Nrf-2 in esophageal squamous cell carcinoma. Thorac. Cancer 2020, 11, 738–747. [Google Scholar] [CrossRef] [PubMed]
- Lu, Y.; Hu, P.; Zhou, H.; Yang, Z.; Sun, Y.; Hoffman, R.M.; Chen, J. Double-negative T Cells Inhibit Proliferation and Invasion of Human Pancreatic Cancer Cells in Co-culture. Anticancer Res. 2019, 39, 5911–5918. [Google Scholar] [CrossRef] [PubMed]
- Kim, Y.R.; Oh, J.E.; Kim, M.S.; Kang, M.R.; Park, S.W.; Han, J.Y.; Eom, H.S.; Yoo, N.J.; Lee, S.H. Oncogenic NRF2 mutations in squamous cell carcinomas of oesophagus and skin. J. Pathol. 2010, 220, 446–451. [Google Scholar] [CrossRef]
- Kitamura, H.; Onodera, Y.; Murakami, S.; Suzuki, T.; Motohashi, H. IL-11 contribution to tumorigenesis in an NRF2 addiction cancer model. Oncogene 2017, 36, 6315–6324. [Google Scholar] [CrossRef]
- Rachakonda, G.; Sekhar, K.R.; Jowhar, D.; Samson, P.C.; Wikswo, J.P.; Beauchamp, R.D.; Datta, P.K.; Freeman, M.L. Increased cell migration and plasticity in Nrf2-deficient cancer cell lines. Oncogene 2010, 29, 3703–3714. [Google Scholar] [CrossRef]
- Lignitto, L.; LeBoeuf, S.E.; Homer, H.; Jiang, S.; Askenazi, M.; Karakousi, T.R.; Pass, H.I.; Bhutkar, A.J.; Tsirigos, A.; Ueberheide, B.; et al. Nrf2 Activation Promotes Lung Cancer Metastasis by Inhibiting the Degradation of Bach1. Cell 2019, 178, 316–329.e18. [Google Scholar] [CrossRef]
- Huang, S. Regulation of metastases by signal transducer and activator of transcription 3 signaling pathway: Clinical implications. Clin. Cancer Res. 2007, 13, 1362–1366. [Google Scholar] [CrossRef]
- Nam, S.; Buettner, R.; Turkson, J.; Kim, D.; Cheng, J.; Muehlbeyer, S.; Hippe, F.; Vatter, S.; Merz, K.H.; Eisenbrand, G.; et al. Indirubin derivatives inhibit Stat3 signaling and induce apoptosis in human cancer cells. Proc. Natl. Acad. Sci. USA 2005, 102, 5998–6003. [Google Scholar] [CrossRef]
- Kang, T.; Wang, W.; Zhong, H.; Dong, Z.; Huang, Q.; Mok, S.; Leung, C.; Wong, V.; Ma, D. An anti-prostate cancer benzofuran-conjugated iridium(III) complex as a dual inhibitor of STAT3 and NF-κB. Cancer Lett. 2017, 396, 76–84. [Google Scholar] [CrossRef] [PubMed]
- Onimoe, G.; Liu, A.; Lin, L.; Wei, C.; Schwartz, E.; Bhasin, D.; Li, C.; Fuchs, J.; Li, P.; Houghton, P.; et al. Small molecules, LLL12 and FLLL32, inhibit STAT3 and exhibit potent growth suppressive activity in osteosarcoma cells and tumor growth in mice. Investig. New Drugs 2012, 30, 916–926. [Google Scholar] [CrossRef] [PubMed]
- Ma, D.; Liu, L.; Leung, K.; Chen, Y.; Zhong, H.; Chan, D.; Wang, H.; Leung, C. Antagonizing STAT3 dimerization with a rhodium(III) complex. Angew. Chem. Int. Ed. 2014, 53, 9178–9182. [Google Scholar] [CrossRef] [PubMed]
- Niu, G.; Heller, R.; Catlett-Falcone, R.; Coppola, D.; Jaroszeski, M.; Dalton, W.; Jove, R.; Yu, H. Gene therapy with dominant-negative Stat3 suppresses growth of the murine melanoma B16 tumor in vivo. Cancer Res. 1999, 59, 5059–5063. [Google Scholar] [PubMed]
- Zhang, X.; Zhang, Y.; He, Z.; Yin, K.; Li, B.; Zhang, L.; Xu, Z. Chronic stress promotes gastric cancer progression and metastasis: An essential role for ADRB2. Cell Death Dis. 2019, 10, 788. [Google Scholar] [CrossRef] [PubMed]
- Zheng, M.; Cao, M.; Luo, X.; Li, L.; Wang, K.; Wang, S.; Wang, H.; Tang, Y.; Tang, Y.; Liang, X. EZH2 promotes invasion and tumour glycolysis by regulating STAT3 and FoxO1 signalling in human OSCC cells. J. Cell Mol. Med. 2019, 23, 6942–6954. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Wang, H.; Guan, L.; Lai, C.; Yu, W.; Lai, M. LL1, a novel and highly selective STAT3 inhibitor, displays anti-colorectal cancer activities in vitro and in vivo. Br. J. Pharmacol. 2020, 177, 298–313. [Google Scholar] [CrossRef]
- Wang, F.; Ma, X.; Mao, G.; Zhang, X.; Kong, Z. STAT3 enhances radiation-induced tumor migration, invasion and stem-like properties of bladder cancer. Mol. Med. Rep. 2021, 23, 87. [Google Scholar] [CrossRef]
- Liang, J.; Nagahashi, M.; Kim, E.Y.; Harikumar, K.B.; Yamada, A.; Huang, W.C.; Hait, N.C.; Allegood, J.C.; Price, M.M.; Avni, D.; et al. Sphingosine-1-phosphate links persistent STAT3 activation, chronic intestinal inflammation, and development of colitis-associated cancer. Cancer Cell 2013, 23, 107–120. [Google Scholar] [CrossRef]
- Scott, J.D.; Williams, R.M. Chemistry and biology of the tetrahydroisoquinoline antitumor antibiotics. Chem. Rev. 2002, 102, 1669–1730. [Google Scholar] [CrossRef]
- Cuevas, C.; Francesch, A. Development of Yondelis (trabectedin, ET-743). A semisynthetic process solves the supply problem. Nat. Prod. Rep. 2009, 26, 322–337. [Google Scholar] [CrossRef] [PubMed]
- Jia, J.; Chen, R.; Liu, H.; Li, X.; Jia, Y.; Chen, X. Asymmetric synthesis of (-)-renieramycin T. Org. Biomol. Chem. 2016, 14, 7334–7344. [Google Scholar] [CrossRef] [PubMed]
- Petsri, K.; Chamni, S.; Suwanborirux, K.; Saito, N.; Chanvorachote, P. Renieramycin T Induces Lung Cancer Cell Apoptosis by Targeting Mcl-1 Degradation: A New Insight in the Mechanism of Action. Mar. Drugs 2019, 17, 301. [Google Scholar] [CrossRef] [PubMed]
- Chantarawong, W.; Chamni, S.; Suwanborirux, K.; Saito, N.; Chanvorachote, P. 5-O-Acetyl-Renieramycin T from Blue Sponge Xestospongia sp. Induces Lung Cancer Stem Cell Apoptosis. Mar. Drugs 2019, 17, 109. [Google Scholar] [CrossRef] [PubMed]
- Petsri, K.; Yokoya, M.; Tungsukruthai, S.; Rungrotmongkol, T.; Nutho, B.; Vinayanuwattikun, C.; Saito, N.; Takehiro, M.; Sato, R.; Chanvorachote, P. Structure-Activity Relationships and Molecular Docking Analysis of Mcl-1 Targeting Renieramycin T Analogues in Patient-derived Lung Cancer Cells. Cancers 2020, 12, 875. [Google Scholar] [CrossRef]
- Suksamai, D.; Racha, S.; Sriratanasak, N.; Chaotham, C.; Aphicho, K.; Lin, A.C.K.; Chansriniyom, C.; Suwanborirux, K.; Chamni, S.; Chanvorachote, P. 5-O-(N-Boc-l-Alanine)-Renieramycin T Induces Cancer Stem Cell Apoptosis via Targeting Akt Signaling. Mar. Drugs 2022, 20, 235. [Google Scholar] [CrossRef]
- Mallard, A.R.; Spathis, J.G.; Coombes, J.S. Nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and exercise. Free. Radic. Biol. Med. 2020, 160, 471–479. [Google Scholar] [CrossRef]
- Ferrándiz, M.L.; Nacher-Juan, J.; Alcaraz, M.J. Nrf2 as a therapeutic target for rheumatic diseases. Biochem. Pharm. 2018, 152, 338–346. [Google Scholar] [CrossRef]
- Kim, S.J.; Saeidi, S.; Cho, N.C.; Kim, S.H.; Lee, H.B.; Han, W.; Noh, D.Y.; Surh, Y.J. Interaction of Nrf2 with dimeric STAT3 induces IL-23 expression: Implications for breast cancer progression. Cancer Lett. 2021, 500, 147–160. [Google Scholar] [CrossRef]
- Hou, T.; Yang, M.; Yan, K.; Fan, X.; Ci, X.; Peng, L. Amentoflavone Ameliorates Carrageenan-Induced Pleurisy and Lung Injury by Inhibiting the NF-κB/STAT3 Pathways via Nrf2 Activation. Front. Pharmacol. 2022, 13, 763608. [Google Scholar] [CrossRef]
- Li, C.; Wang, R.; Zhang, Y.; Hu, C.; Ma, Q. PIAS3 suppresses damage in an Alzheimer’s disease cell model by inducing the STAT3-associated STAT3/Nestin/Nrf2/HO-1 pathway. Mol. Med. 2021, 27, 150. [Google Scholar] [CrossRef] [PubMed]
Genes | Primer | Sequence (5′-3′) |
---|---|---|
GAPDH | Forward Reverse | GCACCGTCAAGGCTGAGAAC TGGTGAAGACGCCAGTGGA |
Twist | Forward Reverse | GTCCGCAGTCTTACGAGGAG GCTTGAGGGTCTGAATCTTGCT |
Snail | Forward Reverse | TCGGAAGCCTAACTACAGCGA AGATGAGCATTGGCAGCGAG |
Vimentin | Forward Reverse | GACGCCATCAACACCGAGTT CTTTGTCGTTGGTTAGCTGGT |
N-cadherin | Forward Reverse | TCAGGCGTCTGTAGAGGCTT ATGCACATCCTTCGATAAGACTG |
STAT3 | Forward Reverse | CAGCAGCTTGACACACGGTA AAACACCAAAGTGGCATGTGA |
Nrf2 | Forward Reverse | TCAGCGACGGAAAGAGTATGA CCACTGGTTTCTGACTGGATGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, B.; Liang, J.; Li, X.; Liu, L.; Yao, J.; Chen, X.; Chen, R. Renieramycin T Inhibits Melanoma B16F10 Cell Metastasis and Invasion via Regulating Nrf2 and STAT3 Signaling Pathways. Molecules 2022, 27, 5337. https://doi.org/10.3390/molecules27165337
Yu B, Liang J, Li X, Liu L, Yao J, Chen X, Chen R. Renieramycin T Inhibits Melanoma B16F10 Cell Metastasis and Invasion via Regulating Nrf2 and STAT3 Signaling Pathways. Molecules. 2022; 27(16):5337. https://doi.org/10.3390/molecules27165337
Chicago/Turabian StyleYu, Baohua, Jing Liang, Xiufang Li, Li Liu, Jing Yao, Xiaochuan Chen, and Ruijiao Chen. 2022. "Renieramycin T Inhibits Melanoma B16F10 Cell Metastasis and Invasion via Regulating Nrf2 and STAT3 Signaling Pathways" Molecules 27, no. 16: 5337. https://doi.org/10.3390/molecules27165337
APA StyleYu, B., Liang, J., Li, X., Liu, L., Yao, J., Chen, X., & Chen, R. (2022). Renieramycin T Inhibits Melanoma B16F10 Cell Metastasis and Invasion via Regulating Nrf2 and STAT3 Signaling Pathways. Molecules, 27(16), 5337. https://doi.org/10.3390/molecules27165337