CRISPR/Cas9-Mediated Genome Editing in Comfrey (Symphytum officinale) Hairy Roots Results in the Complete Eradication of Pyrrolizidine Alkaloids
Abstract
1. Introduction
2. Results
2.1. Restriction Analysis as a Screening Strategy to Identify HR Lines with Modified Genomic Sequence
2.2. Characterization of Mutations within the hss Gene of Transgenic HR Lines by Genotyping
2.3. Chemotyping of Transgenic HR Lines Reveals Effects of CRISPR/Cas9 Editing on Levels of Homospermidine and PAs
2.4. Recovery of PAs in HRs with a Defective hss Gene by Feeding of Homospermidine
3. Discussion
4. Materials and Methods
4.1. Plant Material
4.2. Cloning of sgRNAs and Generation of Binary Vector Constructs for Plant Transformation
4.3. Transformation of A. Rhizogenes and Generation of Transgenic HRs
4.4. Analysis of HR Lines for Mutations within the hss Gene
4.5. Extraction and Quantification of Homospermidine
4.6. Pyrrolizidine Alkaloid Extraction and Purification
4.7. GC-MS Analysis
4.8. Feeding of Homospermidine to HR Lines with Knocked-Out hss Gene
4.9. Statistical Analyses
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
Nr. | 5‘-sequence-3‘ | Purpose |
---|---|---|
P1 | ATATAAGCTTATCATACATGAGAATTAAGGGAGTCAC | Amplification of the hygromycin resistance gene, HindIII restriction site underlined |
P2 | ATATAAGCTTATCAGCTTGCATGCCGGTCGATCTAG | Amplification of the hygromycin resistance gene, HindIII restriction site underlined |
P3 | TACTCGAGATGGGGGAAGTAGCCGCTGCT | Amplification of the complete hss gene, Start ATG underlined. |
P4 | TATGATCATCACTTAGATAAATTATTTGCCTGTTT | Amplification of the complete hss gene, Stop codon underlined. |
P5 | ATTGGTGATGGTTACAACAGCTGG | N20 oligos for motif in exon 3, overhang for ligation underlined |
P6 | AAACCCAGCTGTTGTAACCATCAC | N20 oligos for motif in exon 3, overhang for ligation underlined |
P7 | ATTGACAGGGATAATAATCCTGGG | N20 oligos for motif in exon 7, overhang for ligation underlined |
P8 | AAACCCCAGGATTATTATCCCTGT | N20 oligos for motif in exon 7, overhang for ligation underlined |
P9 | ATTGATGGAAGTGATTCTGGCGCC | N20 oligos for motif in exon 8, overhang for ligation underlined |
P10 | AAACGGCGCCAGAATCACTTCCAT | N20 oligos for motif in exon 8, overhang for ligation underlined |
P11 | GTCTTTCACCTCTCTTTGGTTA | Sequencing of destination vector constructs |
P12 | AAGCTTGCATGCCTGCAGGT | Sequencing of destination vector constructs |
P13 | TTCCGGACTGCGTGAGACAT | Amplification of genomic region exon 2 to 4 to test for mutations |
P14 | CATCTTGTCCAAAATGTT | Amplification of genomic region exon 2 to 4 to test for mutations |
P15 | AGTGCTATGGACAATGAATCAGTGA | Amplification of genomic region exon 7 to 8 to test for mutations |
P16 | CCTAACTTTCTTGGCGTTTTCG | Amplification of genomic region exon 7 to 8 to test for mutations |
P17 | ACGGTGAGTGTGGTTGTAGG | Amplification of rolA gene acc. to [43] |
P18 | GCCACGTGCGTATTAATCCC | Amplification of rolA gene acc. to [43] |
P19 | ATGTCGCAAGGACGTAAGCCCA | Amplification of virD gene acc. to [43] |
P20 | GGAGTCTTTCAGCATGGAGCAA | Amplification of virD gene acc. to [43] |
References
- Jank, B.; Rath, J. The risk of pyrrolizidine alkaloids in human food and animal feed. Trends Plant. Sci. 2017, 22, 191–193. [Google Scholar] [CrossRef]
- Schrenk, D.; Gao, L.; Lin, G.; Mahony, C.; Mulder, P.P.J.; Peijnenburg, A.; Pfuhler, S.; Rietjens, I.M.C.M.; Rutz, L.; Steinhoff, B.; et al. Pyrrolizidine alkaloids in food and phytomedicine: Occurrence, exposure, toxicity, mechanisms, and risk assessment—A review. Food Chem. Toxicol. 2020, 136, 111107. [Google Scholar] [CrossRef]
- Roeder, E.; Wiedenfeld, H.; Edgar, J.A. Pyrrolizidine alkaloids in medicinal plants from North America. Die Pharm. 2015, 70, 357–367. [Google Scholar]
- Wiedenfeld, H.; Edgar, J. Toxicity of pyrrolizidine alkaloids to humans and ruminants. Phytochem. Rev. 2011, 10, 137–151. [Google Scholar] [CrossRef]
- Allgaier, C.; Franz, S. Risk assessment on the use of herbal medicinal products containing pyrrolizidine alkaloids. Regul. Toxicol. Pharm. 2015, 73, 494–500. [Google Scholar] [CrossRef] [PubMed]
- Lamberecht, K. Pyrrolizidine alkaloids—Impact of the public statements made by EMA and national health authorities on the pharmaceutical industry. Master Thesis, Rheinische Friedrich-Wilhelms-Universität Bonn, Bonn, Germany, 2016. [Google Scholar]
- Knutsen, H.K.; Alexander, J.; Barregard, L.; Bignami, M.; Brüschweiler, B.; Ceccatelli, S.; Cottrill, B.; Dinovi, M.; Edler, L.; Grasl-Kraupp, B.; et al. Risks for human health related to the presence of pyrrolizidine alkaloids in honey, tea, herbal infusions and food supplements. EFSA J. 2017, 15, 4908. [Google Scholar]
- Debrunner, B.; Meier, B. Petasites hybridus: A tool for interdisciplinary research in phytotherapy. Pharm. Acta Helv. 1998, 72, 359–362. [Google Scholar] [CrossRef]
- Kopp, T.; Abdel-Tawab, M.; Mizaikoff, B. Extracting and analyzing pyrrolizidine alkaloids in medicinal plants: A review. Toxins 2020, 12, 320. [Google Scholar] [CrossRef] [PubMed]
- Staiger, C. Comfrey: A clinical overview. Phytother. Res. 2012, 26, 1441–1448. [Google Scholar] [CrossRef] [PubMed]
- Predel, H.G.; Giannetti, B.; Koll, R.; Bulitta, M.; Staiger, C. Efficacy of a comfrey root extract ointment in comparison to a diclofenac gel in the treatment of ankle distortions: Results of an observer-blind, randomized, multicenter study. Phytomedicine 2005, 12, 707–714. [Google Scholar] [CrossRef] [PubMed]
- Seigner, J.; Junker-Samek, M.; Plaza, A.; D’Urso, G.; Masullo, M.; Piacente, S.; Holper-Schichl, Y.M.; de Martin, R. A Symphytum officinale root extract exerts anti-inflammatory properties by affecting two distinct steps of NF-κB signaling. Front. Pharm. 2019, 10, 289. [Google Scholar] [CrossRef] [PubMed]
- Avila, C.; Breakspear, I.; Hawrelak, J.; Salmond, S.; Evans, S. A systematic review and quality assessment of case reports of adverse events for borage (Borago officinalis), coltsfoot (Tussilago farfara) and comfrey (Symphytum officinale). Fitoterapia 2020, 142, 104519. [Google Scholar] [CrossRef]
- Fu, P.P.; Xia, Q.; Lin, G.; Chou, M.W. Pyrrolizidine alkaloids—genotoxicity, metabolism enzymes, metabolic activation, and mechanisms. Drug Metab. Rev. 2004, 36, 1–55. [Google Scholar] [CrossRef]
- Seremet, O.C.; Barbuceanu, F.; Ionica, F.E.; Margina, D.M.; GuTu, C.M.; Olaru, O.T.; Ilie, M.; Gonciar, V.; Negres, S.; ChiriTa, C. Oral toxicity study of certain plant extracts containing pyrrolizidine alkaloids. Rom. J. Morphol. Embryol. 2016, 57, 1017–1023. [Google Scholar] [PubMed]
- Hartmann, T.; Ober, D. Defense by pyrrolizidine alkaloids: Developed by plants and recruited by insects. In Induced Plant Resistance to Herbivory; Schaller, A., Ed.; Springer Science + Business Media B.V.: Berlin, Germany, 2008; pp. 213–231. [Google Scholar]
- Hartmann, T. Pyrrolizidine alkaloids: The successful adoption of a plant chemical defense. In Tiger Moths and Woolly Bears. Behavior, Ecology, and Evolution of the Arctiidae; Conner, W.E., Ed.; Oxford University Press: New York, NY, USA, 2009; pp. 55–81. [Google Scholar]
- Prakash, A.S.; Pereira, T.N.; Reilly, P.E.B.; Seawright, A.A. Pyrrolizidine alkaloids in human diet. Mutat. Res. 1999, 443, 53–67. [Google Scholar] [CrossRef]
- Kempf, M.; Heil, S.; Hasslauer, I.; Schmidt, L.; von der Ohe, K.; Theuring, C.; Reinhard, A.; Schreier, P.; Beuerle, T. Pyrrolizidine alkaloids in pollen and pollen products. Mol. Nutr. Food Res. 2010, 54, 292–300. [Google Scholar] [CrossRef]
- EFSA. European Food Safety Authority Opinion of the scientific panel of contaminants in the food chain on a request from the european commission realted to pyrrolizidine alkaloids as undesirable substances in animal feed. Efsa J. 2007, 447, 1–51. [Google Scholar]
- Hartmann, T.; Witte, L. Chemistry, biology and chemoecology of the pyrrolizidine alkaloids. In Alkaloids: Chemical and Biological Perspectives; Pelletier, S.W., Ed.; Pergamon Press: Oxford, UK, 1995; pp. 155–233. [Google Scholar]
- Langel, D.; Ober, D.; Pelser, P. The evolution of pyrrolizidine alkaloid biosynthesis and diversity in the Senecioneae. Phytochem. Rev. 2011, 10, 3–74. [Google Scholar] [CrossRef]
- Chen, T.; Mei, N.; Fu, P.P. Genotoxicity of pyrrolizidine alkaloids. J. Appl. Toxicol. 2010, 30, 183–196. [Google Scholar] [CrossRef] [PubMed]
- Fu, P.P.; Xia, Q.; Lin, G.; Chou, M.W. Genotoxic pyrrolizidine alkaloids—Mechanisms leading to DNA adduct formation and tumorigenicity. Int. J. Mol. Sci. 2002, 3, 948–964. [Google Scholar] [CrossRef]
- Ober, D.; Hartmann, T. Homospermidine synthase, the first pathway-specific enzyme of pyrrolizidine alkaloid biosynthesis, evolved from deoxyhypusine synthase. Proc. Natl. Acad. Sci. USA 1999, 96, 14777–14782. [Google Scholar] [CrossRef]
- Ober, D.; Kaltenegger, E. Pyrrolizidine alkaloid biosynthesis, evolution of a pathway in plant secondary metabolism. Phytochemistry 2009, 70, 1687–1695. [Google Scholar] [CrossRef] [PubMed]
- Reimann, A.; Nurhayati, N.; Backenköhler, A.; Ober, D. Repeated evolution of the pyrrolizidine alkaloid-mediated defense system in separate angiosperm lineages. Plant. Cell 2004, 16, 2772–2784. [Google Scholar] [CrossRef]
- Kaltenegger, E.; Eich, E.; Ober, D. Evolution of homospermidine synthase in the Convolvulaceae: A story of gene duplication, gene loss, and periods of various selection pressures. Plant. Cell 2013, 25, 1213–1227. [Google Scholar] [CrossRef] [PubMed]
- Irmer, S.; Podzun, N.; Langel, D.; Heidemann, F.; Kaltenegger, E.; Schemmerling, B.; Geilfus, C.-M.; Zorb, C.; Ober, D. New aspect of plant-rhizobia interaction: Alkaloid biosynthesis in Crotalaria depends on nodulation. Proc. Natl. Acad. Sci. USA 2015, 112, 4164–4169. [Google Scholar] [CrossRef] [PubMed]
- Ober, D.; Hartmann, T. Deoxyhypusine synthase from tobacco. cDNA isolation, characterization, and bacterial expression of an enzyme with extended substrate specificity. J. Biol. Chem. 1999, 274, 32040–32047. [Google Scholar] [CrossRef]
- Ober, D.; Hartmann, T. Phylogenetic origin of a secondary pathway: The case of pyrrolizidine alkaloids. Plant. Mol. Biol. 2000, 44, 445–450. [Google Scholar] [CrossRef] [PubMed]
- Böttcher, F.; Adolph, R.D.; Hartmann, T. Homospermidine synthase, the first pathway-specific enzyme in pyrrolizidine alkaloid biosynthesis. Phytochemistry 1993, 32, 679–689. [Google Scholar] [CrossRef]
- Moll, S.; Anke, S.; Kahmann, U.; Hänsch, R.; Hartmann, T.; Ober, D. Cell-specific expression of homospermidine synthase, the entry enzyme of the pyrrolizidine alkaloid pathway in Senecio vernalis, in comparison with its ancestor, deoxyhypusine synthase. Plant Physiol. 2002, 130, 47–57. [Google Scholar] [CrossRef] [PubMed]
- Anke, S.; Niemüller, D.; Moll, S.; Hänsch, R.; Ober, D. Polyphyletic origin of pyrrolizidine alkaloids within the Asteraceae. Evidence from differential tissue expression of homospermidine synthase. Plant Physiol. 2004, 136, 4037–4047. [Google Scholar] [CrossRef] [PubMed]
- Anke, S.; Gonde, D.; Kaltenegger, E.; Hansch, R.; Theuring, C.; Ober, D. Pyrrolizidine alkaloid biosynthesis in Phalaenopsis orchids: Developmental expression of alkaloid-specific homospermidine synthase in root tips and young flower buds. Plant Physiol. 2008, 148, 751–760. [Google Scholar] [CrossRef]
- Niemüller, D.; Reimann, A.; Ober, D. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the Boraginales. Plant Physiol. 2012, 159, 920–929. [Google Scholar] [CrossRef] [PubMed]
- Kruse, L.H.; Stegemann, T.; Sievert, C.; Ober, D. Identification of a second site of pyrrolizidine alkaloid biosynthesis in Comfrey to boost plant defense in floral stage. Plant Physiol. 2017, 174, 47–55. [Google Scholar] [CrossRef]
- DeBoer, K.D.; Dalton, H.L.; Edward, F.J.; Hamill, J.D. RNAi-mediated downregulation of ornithine decarboxylase (ODC) leads to reduced nicotine and increased anatabine levels in transgenic Nicotiana tabacum L. Phytochemistry 2011, 72, 344–355. [Google Scholar] [CrossRef]
- Glenn, W.S.; Runguphan, W.; O’Connor, S.E. Recent progress in the metabolic engineering of alkaloids in plant systems. Curr. Opin. Biotechnol. 2013, 24, 354–365. [Google Scholar] [CrossRef] [PubMed]
- Runguphan, W.; Maresh, J.J.; O’Connor, S.E. Silencing of tryptamine biosynthesis for production of nonnatural alkaloids in plant culture. Proc. Natl. Acad. Sci. USA 2009, 106, 13673–13678. [Google Scholar] [CrossRef]
- Yuan, L.; Grotewold, E. Metabolic engineering to enhance the value of plants as green factories. Metab. Eng. 2015, 27, 83–91. [Google Scholar] [CrossRef] [PubMed]
- Pandey, P.; Senthil-Kumar, M.; Mysore, K.S. Advances in Plant Gene Silencing Methods. In Plant Gene Silencing; Senthil-Kumar, M., Mysore, K.S., Eds.; Springer: New York, NY, USA, 2015; pp. 3–23. [Google Scholar]
- Kruse, L.H.; Stegemann, T.; Jensen-Kroll, J.; Engelhardt, A.; Wesseling, A.M.; Lippert, A.; Ludwig-Müller, J.; Ober, D. Reduction of pyrrolizidine alkaloid levels in comfrey (Symphytum officinale) hairy roots by RNAi silencing of homospermidine synthase. Planta Med. 2019, 85, 1177–1186. [Google Scholar] [CrossRef]
- Agrawal, N.; Dasaradhi, P.V.; Mohmmed, A.; Malhotra, P.; Bhatnagar, R.K.; Mukherjee, S.K. RNA interference: Biology, mechanism, and applications. Microbiol. Mol. Biol. Rev. 2003, 67, 657–685. [Google Scholar] [CrossRef]
- Lu, R.; Martin-Hernandez, A.M.; Peart, J.R.; Malcuit, I.; Baulcombe, D.C. Virus-induced gene silencing in plants. Methods 2003, 30, 296–303. [Google Scholar] [CrossRef]
- Osakabe, Y.; Osakabe, K. Genome editing with engineered nucleases in plants. Plant Cell Physiol. 2015, 56, 389–400. [Google Scholar] [CrossRef] [PubMed]
- Razzaq, A.; Saleem, F.; Kanwal, M.; Mustafa, G.; Yousaf, S.; Imran Arshad, H.M.; Hameed, M.K.; Khan, M.S.; Joyia, F.A. Modern trends in plant genome editing: An inclusive review of the CRISPR/Cas9 toolbox. Int. J. Mol. Sci. 2019, 20, 4045. [Google Scholar] [CrossRef]
- Travis, J. Making the cut. Science 2015, 350, 1456–1457. [Google Scholar] [CrossRef] [PubMed]
- Ledford, H.; Callaway, E. Pioneers of CRISPR gene editing win chemistry Nobel Prize. Nature 2020, 586, 346–347. [Google Scholar] [CrossRef]
- Bortesi, L.; Fischer, R. The CRISPR/Cas9 system for plant genome editing and beyond. Biotech. Adv. 2015, 33, 41–52. [Google Scholar] [CrossRef]
- Puchta, H. Using CRISPR/Cas in three dimensions: Towards synthetic plant genomes, transcriptomes and epigenomes. Plant J. Cell Mol. Biol. 2016, 87, 5–15. [Google Scholar] [CrossRef]
- Puchta, H. Applying CRISPR/Cas for genome engineering in plants: The best is yet to come. Curr. Opin. Plant Biol. 2017, 36, 1–8. [Google Scholar] [CrossRef]
- Schiml, S.; Puchta, H. Revolutionizing plant biology: Multiple ways of genome engineering by CRISPR/Cas. Plant Methods 2016, 12, 8. [Google Scholar] [CrossRef]
- Bewg, W.P.; Ci, D.; Tsai, C.-J. Genome editing in trees: From multiple repair pathways to long-term stability. Front. Plant Sci. 2018, 9, 1732. [Google Scholar] [CrossRef] [PubMed]
- Schiml, S.; Fauser, F.; Puchta, H. CRISPR/Cas-Mediated Site-Specific Mutagenesis in Arabidopsis thaliana Using Cas9 Nucleases and Paired Nickases. Methods Mol. Biol. 2016, 1469, 111–122. [Google Scholar] [PubMed]
- Stegemann, T.; Kruse, L.H.; Brütt, M.; Ober, D. Specific distribution of pyrrolizidine alkaloids in floral parts of comfrey (Symphytum officinale) and its implications for flower ecology. J. Chem. Ecol. 2018, 45, 128–135. [Google Scholar] [CrossRef]
- Hartmann, T. The lost origin of chemical ecology in the late 19th century. Proc. Natl. Acad. Sci. USA 2008, 105, 4541–4546. [Google Scholar] [CrossRef] [PubMed]
- Roeder, E. Medicinal plants in Europe containing pyrrolizidine alkaloids. Pharmazie 1995, 50, 83–98. [Google Scholar] [PubMed]
- Ikram, N.; Simonsen, H.T. A review of biotechnological artemisinin production in plants. Front. Plant Sci. 2017, 8, 1966. [Google Scholar] [CrossRef]
- Wurtzel, E.T.; Vickers, C.E.; Hanson, A.D.; Millar, A.H.; Cooper, M.; Voss-Fels, K.P.; Nikel, P.I.; Erb, T.J. Revolutionizing agriculture with synthetic biology. Nat. Plants 2019, 5, 1207–1210. [Google Scholar] [CrossRef]
- Rischer, H.; Szilvay, G.R.; Oksman-Caldentey, K.M. Cellular agriculture—industrial biotechnology for food and materials. Curr. Opin. Biotechnol. 2020, 61, 128–134. [Google Scholar] [CrossRef]
- Sun, H.; Liu, Z.; Zhao, H.; Ang, E.L. Recent advances in combinatorial biosynthesis for drug discovery. Drug Des. Devel 2015, 9, 823–833. [Google Scholar]
- Cravens, A.; Payne, J.; Smolke, C.D. Synthetic biology strategies for microbial biosynthesis of plant natural products. Nat. Commun. 2019, 10, 2142. [Google Scholar] [CrossRef] [PubMed]
- McGinnis, K.M. RNAi for functional genomics in plants. Brief. Funct. Genom. 2010, 9, 111–117. [Google Scholar] [CrossRef] [PubMed]
- Gutierrez-Valdes, N.; Hakkinen, S.T.; Lemasson, C.; Guillet, M.; Oksman-Caldentey, K.M.; Ritala, A.; Cardon, F. Hairy root cultures—A versatile tool with multiple applications. Front. Plant Sci. 2020, 11, 33. [Google Scholar] [CrossRef]
- Doench, J.G.; Hartenian, E.; Graham, D.B.; Tothova, Z.; Hegde, M.; Smith, I.; Sullender, M.; Ebert, B.L.; Xavier, R.J.; Root, D.E. Rational design of highly active sgRNAs for CRISPR-Cas9-mediated gene inactivation. Nat. Biotechnol. 2014, 32, 1262–1267. [Google Scholar] [CrossRef] [PubMed]
- Ober, D.; Gibas, L.; Witte, L.; Hartmann, T. Evidence for general occurrence of homospermidine in plants and its supposed origin as by-product of deoxyhypusine synthase. Phytochemistry 2003, 62, 339–344. [Google Scholar] [CrossRef]
- Abdelhady, M.I.S.; Beuerle, T.; Ober, D. Homospermidine in transgenic tobacco results in considerably reduced spermidine levels but is not converted to pyrrolizidine alkaloid precursors. Plant Mol. Biol. 2009, 71, 145–155. [Google Scholar] [CrossRef]
- Beaudoin, G.A.; Facchini, P.J. Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta 2014, 240, 19–32. [Google Scholar] [CrossRef] [PubMed]
- Payne, R.M.; Xu, D.; Foureau, E.; Teto Carqueijeiro, M.I.; Oudin, A.; Bernonville, T.D.; Novak, V.; Burow, M.; Olsen, C.E.; Jones, D.M.; et al. An NPF transporter exports a central monoterpene indole alkaloid intermediate from the vacuole. Nat. Plants 2017, 3, 16208. [Google Scholar] [CrossRef]
- Dewey, R.E.; Xie, J. Molecular genetics of alkaloid biosynthesis in Nicotiana tabacum. Phytochemistry 2013, 94, 10–27. [Google Scholar] [CrossRef]
- Dobritzsch, M.; Lübken, T.; Eschen-Lippold, L.; Gorzolka, K.; Blum, E.; Matern, A.; Marillonnet, S.; Böttcher, C.; Dräger, B.; Rosahl, S. MATE transporter-dependent export of hydroxycinnamic acid amides. Plant Cell 2016, 28, 583–596. [Google Scholar] [CrossRef]
- Adebesin, F.; Widhalm, J.R.; Boachon, B.; Lefevre, F.; Pierman, B.; Lynch, J.H.; Alam, I.; Junqueira, B.; Benke, R.; Ray, S.; et al. Emission of volatile organic compounds from petunia flowers is facilitated by an ABC transporter. Science 2017, 356, 1386–1388. [Google Scholar] [CrossRef]
- Grotewold, E. Transcription factors for predictive plant metabolic engineering: Are we there yet? Curr. Opin. Biotechnol. 2008, 19, 138–144. [Google Scholar] [CrossRef]
- Zhai, R.; Wang, Z.; Zhang, S.; Meng, G.; Song, L.; Wang, Z.; Li, P.; Ma, F.; Xu, L. Two MYB transcription factors regulate flavonoid biosynthesis in pear fruit (Pyrus bretschneideri Rehd.). J. Exp. Bot. 2015, 67, 1275–1284. [Google Scholar] [CrossRef]
- Yamada, Y.; Sato, F. Transcription factors in alkaloid biosynthesis. Int. Rev. Cell Mol. Biol. 2013, 305, 339–832. [Google Scholar]
- Srivastava, S.; Srivastava, A.K. Hairy root culture for mass-production of high-value secondary metabolites. Crit. Rev. Biotechnol. 2007, 27, 29–43. [Google Scholar] [CrossRef]
- Frölich, C.; Hartmann, T.; Ober, D. Tissue distribution and biosynthesis of 1,2-saturated pyrrolizidine alkaloids in Phalaenopsis hybrides (Orchidaceae). Phytochemistry 2006, 67, 1493–1502. [Google Scholar] [CrossRef]
- Frölich, C.; Ober, D.; Hartmann, T. Tissue distribution, core biosynthesis and diversification of pyrrolizidine alkaloids of the lycopsamine type in three Boraginaceae species. Phytochemistry 2007, 68, 1026–1037. [Google Scholar] [CrossRef] [PubMed]
- Sievert, C.; Beuerle, T.; Hollmann, J.; Ober, D. Single cell subtractive transcriptomics for identification of cell-specifically expressed candidate genes of pyrrolizidine alkaloid biosynthesis. Phytochemistry 2015, 117, 17–24. [Google Scholar] [CrossRef]
- Li, X.; Jiang, D.-H.; Yong, K.; Zhang, D.-B. Varied transcriptional efficiencies of multiple Arabidopsis U6 small nuclear RNA genes. J. Integr. Plant Biol. 2007, 49, 222–229. [Google Scholar] [CrossRef]
- Waibel, F.; Filipowicz, W. RNA-polymerase specificity of transcription of Arabidopsis U snRNA genes determined by promoter element spacing. Nature 1990, 346, 199–202. [Google Scholar] [CrossRef]
- Karimi, M.; Depicker, A.; Hilson, P. Recombinational cloning with plant gateway vectors. Plant Physiol. 2007, 145, 1144–1154. [Google Scholar] [CrossRef]
- Kuzma, J.; Nemecek-Marshall, M.; Pollock, W.H.; Fall, R. Bacteria produce the volatile hydrocarbon isoprene. Curr. Microbiol 1995, 30, 97–103. [Google Scholar] [CrossRef]
- Wise, A.A.; Liu, Z.; Binns, A.N. Three methods for the introduction of foreign DNA into Agrobacterium. Methods Mol. Biol. 2006, 343, 43–53. [Google Scholar]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bio assays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Minocha, R.; Shortle, W.C.; Long, S.L.; Minocha, S.C. A rapid and reliable procedure for extraction of cellular polyamines and inorganic ions from plant tissues. J. Plant Growth Regul. 1994, 13, 187. [Google Scholar] [CrossRef]
- Kaltenegger, E.; Prakashrao, A.S.; Çiçek, S.S.; Ober, D. Development of an activity assay for characterizing deoxyhypusine synthase and its diverse reaction products. Febs Open Bio 2021, 11, 10–25. [Google Scholar] [CrossRef]
- Kempf, M.; Beuerle, T.; Buhringer, M.; Denner, M.; Trost, D.; von der Ohe, K.; Bhavanam, V.B.; Schreier, P. Pyrrolizidine alkaloids in honey: Risk analysis by gas chromatography-mass spectrometry. Mol. Nutr. Food Res. 2008, 52, 1193–1200. [Google Scholar] [CrossRef]
- Graser, G.; Witte, L.; Robins, D.J.; Hartmann, T. Incorporation of chirally deuterated putrescines into pyrrolizidine alkaloids: A reinvestigation. Phytochemistry 1998, 47, 1017–1024. [Google Scholar] [CrossRef]
Construct | Sequence of Protospacer Motif Including PAM | Size of Del./Ins. | Allelic Differences of Mutations | Expected Effect on hss | PA Screen | Established Effect |
---|---|---|---|---|---|---|
A (exon 3) | ||||||
HR-CT1 | GTGATGGTTACAACAGC▲TGGTGG | 0 | WT | NE | + | NE |
HR-A1 | GTGATGGTTACAA----▲TGGTGG | −4 | Homozygous | KO | − | n.a. |
HR-A3 | GTGATGGTTACAACAGC▲TGGTGG | 0 | WT | NE | + | n.a. |
HR-A4 | GTGATGGTTACAA----▲TGGTGG | −4 | Homozygous | KO | − | KO |
HR-A5 | -----------------▲—----- GTGATGG----------▲—----- | −52 −78 | Biallelicprotospacer completely lost because of a large deletion in one of the alleles | KO | − | KO |
HR-A6 | GTGATGGTTACAACA--▲TGGTGG | −2 | Homozygous | KO | − | KO |
HR-A14 | GTGATGGTT--------▲-GGTGG | −9 | Homozygous | NE, KD, KO | − | KO |
HR-A16 | GTG--------------▲--GTGG | −16 | Homozygous | KO | − | KO |
HR-A17 | GTGATGGTTACAAC---▲TGGTGG | −3 | Monoallelic | NE, KD | + | n.a. |
HR-A18 | GTGATGGTTACAAC---▲TGGTGG | −3 | Monoallelic | NE, KD | + | n.a. |
B (exon 7) | ||||||
HR-CT1 | ACAGGGATAATAATCCT▲GGGTGG | 0 | WT | NE | + | NE |
HR-B2 | ACAGGGATAA-------▲GGGTGG | −7 | Monoallelic | KD | + | KD |
HR-B4 | ACAGGGATAATAATCCTT▲GGGTGG | +1 | Monoallelic | KD | + | n.a. |
HR-B5 | ACAGGGATAATAAT-CT▲GGGTGG | −1 | Monoallelic | KD | + | KD |
HR-B6 | ACAGGGATA--------▲GGGTGG | −8 | Monoallelic | KD | + | KD |
HR-B7 | ACAGGGATAATAATCCTT▲GGGTGG | +1 | Monoallelic | KD | + | KD |
HR-B8 | ACAGGGA---------T▲GGGTGG | −9 | Monoallelic | NE, KD | + | n.a. |
HR-B9 | ACAGGGATAATAATCCTT▲GGGTGG | +1 | Monoallelic | KD | + | KD |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zakaria, M.M.; Schemmerling, B.; Ober, D. CRISPR/Cas9-Mediated Genome Editing in Comfrey (Symphytum officinale) Hairy Roots Results in the Complete Eradication of Pyrrolizidine Alkaloids. Molecules 2021, 26, 1498. https://doi.org/10.3390/molecules26061498
Zakaria MM, Schemmerling B, Ober D. CRISPR/Cas9-Mediated Genome Editing in Comfrey (Symphytum officinale) Hairy Roots Results in the Complete Eradication of Pyrrolizidine Alkaloids. Molecules. 2021; 26(6):1498. https://doi.org/10.3390/molecules26061498
Chicago/Turabian StyleZakaria, Mahmoud M., Brigitte Schemmerling, and Dietrich Ober. 2021. "CRISPR/Cas9-Mediated Genome Editing in Comfrey (Symphytum officinale) Hairy Roots Results in the Complete Eradication of Pyrrolizidine Alkaloids" Molecules 26, no. 6: 1498. https://doi.org/10.3390/molecules26061498
APA StyleZakaria, M. M., Schemmerling, B., & Ober, D. (2021). CRISPR/Cas9-Mediated Genome Editing in Comfrey (Symphytum officinale) Hairy Roots Results in the Complete Eradication of Pyrrolizidine Alkaloids. Molecules, 26(6), 1498. https://doi.org/10.3390/molecules26061498