Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation
Abstract
1. Introduction
2. Results
2.1. Preparation of RDgel
2.2. RNA Release from RDgel
2.3. Optimization of Preparation Conditions of RDgel
2.4. RNA Release from RDgel under Serum-Containing Conditions
2.5. Cellular Uptake of RDgel by Dendritic Cells
2.6. TNF-α Release after Addition of RDgel to Immune Cells
2.7. Effects of the Conditioned Media of RDgel-Treated RAW264.7 Cells on Colon26 Tumor Cell Proliferation
3. Discussion
4. Materials and Methods
4.1. Chemicals
4.2. Oligonucleotides
4.3. Cell Culture
4.4. Preparation of HexapodRD6 and RDgel
4.5. RNA Release from RDgel
4.6. RNA Release from RDgel in 10% FBS
4.7. Cellular Uptake of RDgel by DC2.4 cells
4.8. Cytokine Release from Immune Cells
4.9. Effects of Immune Cells Activated by RDgel on Tumor Cells
4.10. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
References
- Kadowaki, N.; Ho, S.; Antonenko, S.; De Waal Malefyt, R.; Kastelein, R.A.; Bazan, F.; Liu, Y.J. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J. Exp. Med. 2001, 194, 863–869. [Google Scholar] [CrossRef] [PubMed]
- Jarrossay, D.; Napolitani, G.; Colonna, M.; Sallusto, F.; Lanzavecchia, A. Specialization and complementarity in microbial molecule recognition by human myeloid and plasmacytoid dendritic cells. Eur. J. Immunol. 2001, 31, 3388–3393. [Google Scholar] [CrossRef]
- Hornung, V.; Rothenfusser, S.; Britsch, S.; Krug, A.; Jahrsdörfer, B.; Giese, T.; Endres, S.; Hartmann, G. Quantitative Expression of Toll-Like Receptor 1–10 mRNA in Cellular Subsets of Human Peripheral Blood Mononuclear Cells and Sensitivity to CpG Oligodeoxynucleotides. J. Immunol. 2002, 168, 4531–4537. [Google Scholar] [CrossRef] [PubMed]
- Heil, F.; Hemmi, H.; Hochrein, H.; Ampenberger, F.; Kirschning, C.; Akira, S.; Lipford, G.; Wagner, H.; Bauer, S. Species-Specific Recognition of Single-Stranded RNA via Till-like Receptor 7 and 8. Science (80-. ) 2004, 303, 1526–1529. [Google Scholar] [CrossRef] [PubMed]
- Forsbach, A.; Nemorin, J.-G.; Montino, C.; Müller, C.; Samulowitz, U.; Vicari, A.P.; Jurk, M.; Mutwiri, G.K.; Krieg, A.M.; Lipford, G.B.; et al. Identification of RNA Sequence Motifs Stimulating Sequence-Specific TLR8-Dependent Immune Responses. J. Immunol. 2008, 180, 3729–3738. [Google Scholar] [CrossRef]
- Xue, H.; Guo, P.; Wen, W.-C.; Wong, H. Lipid-Based Nanocarriers for RNA Delivery. Curr. Pharm. Des. 2015, 21, 3140–3147. [Google Scholar] [CrossRef] [PubMed]
- Sayour, E.J.; De Leon, G.; Pham, C.; Grippin, A.; Kemeny, H.; Chua, J.; Huang, J.; Sampson, J.H.; Sanchez-Perez, L.; Flores, C.; et al. Systemic activation of antigen-presenting cells via RNA-loaded nanoparticles. Oncoimmunology 2017, 6, e1256527. [Google Scholar] [CrossRef]
- Guan, C.; Chernyak, N.; Dominguez, D.; Cole, L.; Zhang, B.; Mirkin, C.A. RNA-Based Immunostimulatory Liposomal Spherical Nucleic Acids as Potent TLR7/8 Modulators. Small 2018, 14, 1803284. [Google Scholar] [CrossRef]
- Joshi, M.D.; Müller, R.H. Lipid nanoparticles for parenteral delivery of actives. Eur. J. Pharm. Biopharm. 2009, 71, 161–172. [Google Scholar] [CrossRef]
- Segovia, N.; Pont, M.; Oliva, N.; Ramos, V.; Borrós, S.; Artzi, N. Hydrogel doped with nanoparticles for local sustained release of siRNA in breast cancer. Adv. Healthc. Mater. 2015, 4, 271–280. [Google Scholar] [CrossRef]
- Tanaka, T.; Mangala, L.S.; Vivas-Mejia, P.E.; Nieves-Alicea, R.; Mann, A.P.; Mora, E.; Han, H.D.; Shahzad, M.M.K.; Liu, X.; Bhavane, R.; et al. Sustained small interfering RNA delivery by mesoporous silicon particles. Cancer Res. 2010, 70, 3687–3696. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.L.; Burdick, J.A. Engineered Hydrogels for Local and Sustained Delivery of RNA-Interference Therapies. Adv. Healthc. Mater. 2017, 6, 1601041. [Google Scholar] [CrossRef] [PubMed]
- Komura, F.; Takahashi, Y.; Inoue, T.; Takakura, Y.; Nishikawa, M. Development of a Nanostructured RNA/DNA Assembly as an Adjuvant Targeting Toll-Like Receptor 7/8. Nucleic Acid Ther. 2019, 29, 335–342. [Google Scholar] [CrossRef] [PubMed]
- Nishikawa, M.; Ogawa, K.; Umeki, Y.; Mohri, K.; Kawasaki, Y.; Watanabe, H.; Takahashi, N.; Kusuki, E.; Takahashi, R.; Takahashi, Y.; et al. Injectable, self-gelling, biodegradable, and immunomodulatory DNA hydrogel for antigen delivery. J. Control. Release 2014, 180, 25–32. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuki, S.; Takahashi, Y.; Inoue, T.; Takakura, Y.; Nishikawa, M. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene. Sci. Rep. 2017, 7, 13661. [Google Scholar] [CrossRef]
- Kodama, T.; Freeman, M.; Rohrer, L.; Zabrecky, J.; Matsudaira, P.; Krieger, M. Type I macrophage scavenger receptor contains α-helical and collagen-like coiled coils. Nature 1990, 343, 531–535. [Google Scholar] [CrossRef]
- Hackstein, H.; Knoche, A.; Nockher, A.; Poeling, J.; Kubin, T.; Jurk, M.; Vollmer, J.; Bein, G. The TLR7/8 ligand resiquimod targets monocyte-derived dendritic cell differentiation via TLR8 and augments functional dendritic cell generation. Cell. Immunol. 2011, 271, 401–412. [Google Scholar] [CrossRef]
- Levy, O.; Suter, E.E.; Miller, R.L.; Wessels, M.R. Unique efficacy of Toll-like receptor 8 agonists in activating human neonatal antigen-presenting cells. Blood 2006, 108, 1284–1290. [Google Scholar] [CrossRef]
- Rodell, C.B.; Arlauckas, S.P.; Cuccarese, M.F.; Garris, C.S.; Li, R.; Ahmed, M.S.; Kohler, R.H.; Pittet, M.J.; Weissleder, R. TLR7/8-agonist-loaded nanoparticles promote the polarization of tumour-associated macrophages to enhance cancer immunotherapy. Nat. Biomed. Eng. 2018, 2, 578–588. [Google Scholar] [CrossRef]
- Zhou, Z.; Yu, X.; Zhang, J.; Tian, Z.; Zhang, C. TLR7/8 agonists promote NK-DC cross-talk to enhance NK cell anti-tumor effects in hepatocellular carcinoma. Cancer Lett. 2015, 369, 298–306. [Google Scholar] [CrossRef]
- Hamm, S.; Rath, S.; Michel, S.; Baumgartner, R. Cancer immunotherapeutic potential of novel small molecule TLR7 and TLR8 agonists. J. Immunotoxicol. 2009, 6, 257–265. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Umeki, Y.; Mohri, K.; Kawasaki, Y.; Watanabe, H.; Takahashi, R.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Induction of Potent Antitumor Immunity by Sustained Release of Cationic Antigen from a DNA-Based Hydrogel with Adjuvant Activity. Adv. Funct. Mater. 2015, 25, 5758–5767. [Google Scholar] [CrossRef]
- Umeki, Y.; Saito, M.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Retardation of Antigen Release from DNA Hydrogel Using Cholesterol-Modified DNA for Increased Antigen-Specific Immune Response. Adv. Healthc. Mater. 2017, 6, 1700355. [Google Scholar] [CrossRef] [PubMed]
Sequence (5′→3′) | |
---|---|
ORN-1 | GCCCGUCUGUUGUGUGACUC |
FAM-ORN-1 | GCCCGUCUGUUGUGUGACUC* |
ODN-1 | gagtcacacaacagatgggc tctagactctgtcaggacatcatagtgcaa |
ODN-2 | tcctgatg ttgcactatgatgtccagcagatgtctata |
ODN-3 | gagtcacacaacagatgggc tatagacatctgcttgatgctcagctgcaa |
ODN-4 | tcctgatg ttgcagctgagcatcagatgctgatctaga |
ODN-5 | gagtcacacaacagatgggc tctagatcagcatcctcacattgactacaa |
ODN-6 | tcctgatg ttgtagtcaatgtgagtgacagagtctaga |
ODN-7 | gagtcacacaacagatgggcttgaatccatgatgcagtatgactgcaatg |
ODN-8 | catcagga cattgcagtcatactgtcttgatgctctga |
ODN-9 | gagtcacacaacagatgggctcagagcatcaagatgttcatcagtatatg |
ODN-10 | catcagga catatactgatgaacaaagtgacttctcaa |
ODN-11 | gagtcacacaacagatgggcttgagaagtcacttatcaacatctgagaca |
ODN-12 | catcagga tgtctcagatgttgatcatcatggattcaa |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Komura, F.; Okuzumi, K.; Takahashi, Y.; Takakura, Y.; Nishikawa, M. Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation. Molecules 2020, 25, 728. https://doi.org/10.3390/molecules25030728
Komura F, Okuzumi K, Takahashi Y, Takakura Y, Nishikawa M. Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation. Molecules. 2020; 25(3):728. https://doi.org/10.3390/molecules25030728
Chicago/Turabian StyleKomura, Fusae, Kana Okuzumi, Yuki Takahashi, Yoshinobu Takakura, and Makiya Nishikawa. 2020. "Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation" Molecules 25, no. 3: 728. https://doi.org/10.3390/molecules25030728
APA StyleKomura, F., Okuzumi, K., Takahashi, Y., Takakura, Y., & Nishikawa, M. (2020). Development of RNA/DNA Hydrogel Targeting Toll-Like Receptor 7/8 for Sustained RNA Release and Potent Immune Activation. Molecules, 25(3), 728. https://doi.org/10.3390/molecules25030728