Protective Effects of Eicosapentaenoic Acid Plus Hydroxytyrosol Supplementation Against White Adipose Tissue Abnormalities in Mice Fed a High-Fat Diet
Abstract
1. Introduction
2. Material and Methods
2.1. Animals, Diets and Experimental Procedures
2.2. Serum Adipokines Profile
2.3. Morphological Parameters
2.4. Fatty Acid Composition of Phospholipids
2.5. Oxidative Stress Indicators and Non-Enzymatic Defenses
2.6. Activities of Antioxidant and Lipogenic Enzymes
2.7. SREBP-1c, PPAR-γ, NF-ΚΒ and Nrf2 DNA-Binding Activity
2.8. Quantitative Real-Time PCR
2.9. Statistical Analysis
3. Results
3.1. HFD-Induced Obesity, Adiposity and WAT Hypertrophy are Decreased by EPA and HT Co-Administration
3.2. HFD-Induced Changes in Fatty Acid Composition in EWAT Phospholipids are Improved by EPA and HT Co-Supplementation
3.3. HFD-Induced EWAT Oxidative Stress Enhancement is Normalized by EPA and HT Co-Administration
3.4. HFD-Induced Upregulation of SREBP-1c System and Downregulation of PPAR-γ Pathway in EWAT are Partially Recovered by the Combined EPA and HT Protocol
3.5. HFD-Induced Activation of Transcription Factor NF-κΒ and Expression of Target Genes Associated with Inflammation in EWAT are Diminished to Values over CD by the EPA Plus HT Protocol
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- World Health Organization. Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 26 August 2020).
- GBD 2015 Obesity Collaborators; Afshin, A.; Forouzanfar, M.H.; Reitsma, M.B.; Sur, P.; Estep, K.; Lee, A.; Marczak, L.; Mokdad, A.H.; Moradi-Lakeh, M.; et al. Health Effects of Overweight and Obesity in 195 Countries over 25 Years. N. Engl. J. Med. 2017, 377, 13–27. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chooi, Y.C.; Ding, C.; Magkos, F. The epidemiology of obesity. Metabolism 2019, 92, 6–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fabbrini, E.; Sullivan, S.; Klein, S. Obesity and Nonalcoholic Fatty Liver Disease: Biochemical, Metabolic and Clinical Implications. Hepatology 2010, 51, 679–689. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rutkowski, J.M.; Stern, J.H.; Scherer, P.E. The cell biology of fat expansion. J. Cell Biol. 2015, 208, 501–512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenzuela, R.; Videla, L.A. The importance of the long-chain polyunsaturated fatty acid n-6/n-3 ratio in development of non-alcoholic fatty liver associated with obesity. Food Funct. 2011, 2, 644–648. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenzuela, R.; Ortiz, M.; Hernandez-Rodas, M.C.; Videla, L.A. Targeting n-3 polyunsaturated fatty acids in non-alcoholic fatty liver disease. Curr. Med. Chem. 2020, 27, 5250–5272. [Google Scholar] [CrossRef] [Scilit]
- Kuda, O.; Rossmeisl, M.; Kopecky, J. Omega-3 fatty acids and adipose tissue biology. Mol. Aspects Med. 2018, 64, 147–160. [Google Scholar] [CrossRef] [Scilit]
- Magrone, T.; Spagnoletta, A.; Salvatore, R.; Magrone, M.; Dentamaro, F.; Russo, M.A.; Difonzo, G.; Summo, C.; Caponio, F.; Jirillo, E. Olive leaf extracts act as modulators of the human immune response. Endocr. Metab. Immune Disord. Drug Targets 2018, 18, 85–93. [Google Scholar] [CrossRef] [Scilit]
- Echeverría, F.; Ortiz, M.; Valenzuela, R.; Videla, L.A. Hydroxytyrosol and cytoprotection: A projection for clinical interventions. Int. J. Mol. Sci. 2017, 18, 930. [Google Scholar] [CrossRef] [Scilit]
- Valenzuela, R.; Illesca, P.; Echeverría, F.; Espinosa, A.; Rincón-Cervera, M.A.; Ortiz, M.; Hernández-Rodas, M.C.; Valenzuela, A.; Videla, L.A. Molecular adaptations underlying the beneficial effects of hydroxytyrosol in the pathogenic alterations induced by a high-fat diet in mouse liver: PPAR-α and Nrf2 activation, and NF-κB down-regulation. Food Funct. 2017, 8, 1526–1537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Illesca, P.; Valenzuela, R.; Espinosa, A.; Echeverría, F.; Soto-Alarcon, S.; Ortiz, M.; Videla, L.A. Hydroxytyrosol supplementation ameliorates the metabolic disturbances in white adipose tissue from mice fed a high-fat diet through recovery of transcription factors Nrf2, SREBP-1c, PPAR-γ and NF-κB. Biomed. Pharmacother. 2019, 109, 2472–2481. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Valenzuela, R.; Videla, L.A. Crosstalk mechanisms in hepatoprotection: Thyroid hormone-docosahexaenoic acid (DHA) and DHA-extra virgin olive oil combined protocols. Pharmacol. Res. 2018, 132, 168–175. [Google Scholar] [CrossRef] [Scilit]
- Valenzuela, R.; Videla, L.A. Impact of the co-administration of n-3 fatty acids and olive oil components in preclinical nonalcoholic fatty liver disease models: A mechanistic view. Nutrients 2020, 12, 499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Talari, H.R.; Najafi, V.; Raygan, F.; Mirhosseini, N.; Ostadmohammadi, V.; Amirani, E.; Taghizadeh, M.; Hajijafari, M.; Shafabakhash, R.; Asemi, Z. Long-term Vitamin D and high-dose n-3 fatty acids’ supplementation improve markers of cardiometabolic risk in type 2 diabetic patients with CHD. Br. J. Nutr. 2019, 122, 423–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Echeverría, F.; Valenzuela, R.; Espinosa, A.; Bustamante, A.; Álvarez, D.; Gonzalez-Mañan, D.; Ortiz, M.; Soto-Alarcon, S.A.; Videla, L.A. Reduction of high-fat diet-induced liver proinflammatory state by eicosapentaenoic acid plus hydroxytyrosol supplementation: Involvement of resolvins RvE1/2 and RvD1/2. J. Nutr. Biochem. 2019, 63, 35–43. [Google Scholar] [CrossRef] [Scilit]
- Echeverría, F.; Valenzuela, R.; Bustamante, A.; Álvarez, D.; Ortiz, M.; Espinosa, A.; Illesca, P.; Gonzalez-Mañan, D.; Videla, L.A. High-fat diet induces mouse liver steatosis with a concomitant decline in energy metabolism: Attenuation by eicosapentaenoic acid (EPA) or hydroxytyrosol (HT) supplementation and the additive effects upon EPA and HT co-administration. Food Funct. 2019, 10, 6170–6183. [Google Scholar] [CrossRef] [Scilit]
- Valenzuela, R.; Barrera, C.; Espinosa, A.; Llanos, P.; Orellana, P.; Videla, L.A. Reduction in the desaturation capacity of the liver in mice subjected to high fat diet: Relation to LCPUFA depletion in liver and extrahepatic tissues. Prostaglandins Leukot. Essent. Fat. Acids 2015, 98, 7–14. [Google Scholar] [CrossRef] [Scilit]
- Echeverría, F.; Valenzuela, R.; Bustamante, A.; Álvarez, D.; Ortiz, M.; Soto-Alarcon, S.A.; Muñoz, P.; Corbari, A.; Videla, L.A. Attenuation of high-fat diet-induced rat liver oxidative stress and steatosis by combined hydroxytyrosol-(HT-) eicosapentaenoic acid supplementation mainly relies on HT. Oxid. Med. Cell. Longev. 2018, 2018. [Google Scholar] [CrossRef] [Scilit]
- Rodbell, M. Metabolism of Isolated Fat Cells:I. Effects on hormones on glucose metabolism and lipolysis. J. Biol. Chem. 1964, 239, 375–380. [Google Scholar] [PubMed]
- Di Girolamo, M.; Mendlinger, S.; Fertig, J.W. A simple method to determine fat cell size and number in four mammalian species. Am. J. Physiol. 1971, 221, 850–858. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Folch, J.; Lees, M.; Sloane Stanley, G.H. A simple method for the isolation and purification of total lipides from animal tissuers. J. Biol. Chem. 1957, 226, 497–509. [Google Scholar] [PubMed]
- Valenzuela, R.; Echeverria, F.; Ortiz, M.; Rincón-Cervera, M.A.; Espinosa, A.; Hernández-Rodas, M.C.; Illesca, P.; Valenzuela, A.; Videla, L.A. Hydroxytyrosol prevents reduction in liver activity of Δ-5 and Δ-6 desaturases, oxidative stress, and depletion in long chain polyunsaturated fatty acid content in different tissues of high-fat diet fed mice. Lipids Health Dis. 2017, 16, 64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bligh, E.G.; Dyer, W.J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 1959, 37, 911–917. [Google Scholar] [CrossRef] [Scilit]
- Rahman, I.; Kode, A.; Biswas, S. Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat. Protoc. 2006, 1, 3153–3165. [Google Scholar] [CrossRef] [Scilit]
- Hernández-Rodas, M.C.; Valenzuela, R.; Echeverría, F.; Rincón-Cervera, M.A.; Espinosa, A.; Illesca, P.; Muñoz, P.; Corbari, A.; Romero, N.; Gonzalez-Mañan, D.; et al. Supplementation with Docosahexaenoic Acid and Extra Virgin Olive Oil Prevents Liver Steatosis Induced by a High-Fat Diet in Mice through PPAR-α and Nrf2 Upregulation with Concomitant SREBP-1c and NF-kB Downregulation. Mol. Nutr. Food Res. 2017, 61, 1700479. [Google Scholar] [CrossRef] [Scilit]
- Wise, E.M.; Ball, E.G. Malic Enzyme and Lipogenesis. Proc. Natl. Acad. Sci. USA 1964, 52, 1255–1263. [Google Scholar] [CrossRef] [Scilit]
- Llobera, M.; Montes, A.; Herrera, E. Lipoprotein lipase activity activity in liver of the rat fetus. Biochem. Biophys. Res. Commun. 1979, 91, 272–277. [Google Scholar] [CrossRef] [Scilit]
- Lee, P.Y.; Costumbrado, J.; Hsu, C.Y.; Kim, Y.H. Agarose gel electrophoresis for the separation of DNA fragments. J. Vis. Exp. 2012, e3923. [Google Scholar] [CrossRef] [Scilit]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Nilsson, C.; Raun, K.; Yan, F.F.; Larsen, M.O.; Tang-Christensen, M. Laboratory animals as surrogate models of human obesity. Acta Pharmacol. Sin. 2012, 33, 173–181. [Google Scholar] [CrossRef] [Scilit]
- Wong, S.K.; Chin, K.Y.; Suhaimi, F.H.; Fairus, A.; Ima-Nirwana, S. Animal models of metabolic syndrome: A review. Nutr. Metab. 2016, 13, 1–12. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chu, D.T.; Malinowska, E.; Jura, M.; Kozak, L.P. C57BL/6J mice as a polygenic developmental model of diet-induced obesity. Physiol. Rep. 2017, 5, 1–20. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kuda, O.; Jelenik, T.; Jilkova, Z.; Flachs, P.; Rossmeisl, M.; Hensler, M.; Kazdova, L.; Ogston, N.; Baranowski, M.; Gorski, J.; et al. N-3 Fatty acids and rosiglitazone improve insulin sensitivity through additive stimulatory effects on muscle glycogen synthesis in mice fed a high-fat diet. Diabetologia 2009, 52, 941–951. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saw, C.L.L.; Yang, A.Y.; Guo, Y.; Kong, A.N.T. Astaxanthin and omega-3 fatty acids individually and in combination protect against oxidative stress via the Nrf2-ARE pathway. Food Chem. Toxicol. 2013, 62, 869–875. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ruzickova, J.; Rossmeisl, M.; Prazak, T.; Flachs, P.; Sponarova, J.; Vecka, M.; Tvrzicka, E.; Bryhn, M.; Kopecky, J. Omega-3 PUFA of marine origin limit diet-induced obesity in mice by reducing cellularity of adipose tissue. Lipids 2004, 39, 1177–1185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Im, D.S. FFA4 (GPR120) as a fatty acid sensor involved in appetite control, insulin sensitivity and inflammation regulation. Mol. Aspects Med. 2018, 64, 92–108. [Google Scholar] [CrossRef] [Scilit]
- Song, T.; Yang, Y.; Zhou, Y.; Wei, H.; Pengs, J. GPR120: A critical role in adipogenesis, inflammation, and energy metabolism in adipose tissue. Cell. Mol. Life Sci. 2017, 74, 2723–2733. [Google Scholar] [CrossRef] [Scilit]
- Oh, D.Y.; Talukdar, S.; Bae, E.J.; Imamura, T.; Morinaga, H.; Fan, W.; Li, P.; Lu, W.J.; Watkins, S.M.; Olefsky, J.M. GPR120 is an omega-3 fatty acid receptor mediating potent anti-inflammatory and insulin sensitizing effects. Cell 2010, 142, 687–698. [Google Scholar] [CrossRef] [Scilit]
- Quesada-López, R.; Cereijo, J.V.; Turatsinze, A.; Planavila, M.; Cairó, A.; Gavaldà-Navarro, M.; Peyrou, R.; Moure, R.; Iglesias, M.; Giralt, M.; et al. The lipid sensor GPR120 promotes brown fat activation and FGF21 release from adipocytes. Nat. Comun. 2016, 7, 1–17. [Google Scholar] [CrossRef] [Scilit]
- Pahlavani, M.; Wijayatunga, N.N.; Kalupahana, N.S.; Ramalingam, L.; Gunaratne, P.H.; Coarfa, C.; Rajapakshe, K.; Kottapalli, P.; Moustaid-Moussa, N. Transcriptic and microRNA analyses of gene meteorks regulated by eicosapentaenoic acid in brown adipose tissue of diet-induced obese mice. Biochim. Biophys. Acta Mol. Cell. Biol. Lipids. 2018, 1863, 1523–1531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, N.; Ma, Y.; Liu, Z.; Liu, L.; Yang, K.; Wei, Y.; Liu, Y.; Chen, X.; Sun, X.; Wen, D. Hydroxytyrosol prevents PM2.5-indiced adiposity and onsulin resistance by restraining oxidative stress related ti NF-κΒ pathway and modulation of gut microbiota in a murine model. Free Radic. Biol. Med. 2019, 141, 393–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, K.; Xu, J.; Zou, X.; Li, Y.; Chen, C.; Zheng, A.; Li, H.; Li, H.; Szeto, I.M.Y.; Shi, Y.; et al. Hydroxytyrosol prevents diet-induced metabolic syndrome and attenuates mitochondrial abnormalities in obese mice. Free Radic. Biol. Med. 2014, 67, 396–407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stern, J.H.; Rutkowski, J.M.; Scherer, P.E. Adiponectin, Leptin, and Fatty Acids in the Maintenance of Metabolic Homeostasis through Adipose Tissue Crosstalk. Cell Metab. 2016, 23, 770–784. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Flachs, P.; Mohamed-Ali, V.; Horakova, O.; Rossmeisl, M.; Hosseinzadeh-Attar, M.J.; Hensler, M.; Ruzickova, J.; Kopecky, J. Polyunsaturated fatty acids of marine origin induce adiponectin in mice fed a high-fat diet. Diabetologia 2006, 49, 394–397. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-Matute, P.; Pérez-Echarri, N.; Martínez, J.A.; Marti, A.; Moreno-Aliaga, M.J. Eicosapentaenoic acid actions on adiposity and insulin resistance in control and high-fat-fed rats: Role of apoptosis, adiponectin and tumour necrosis factor-α. Br. J. Nutr. 2007, 97, 389–398. [Google Scholar] [CrossRef] [Scilit]
- Itoh, M.; Suganami, T.; Satoh, N.; Tanimoto-Koyama, K.; Yuan, X.; Tanaka, M.; Kawano, H.; Yano, T.; Aoe, S.; Takeya, M.; et al. Increased adiponectin secretion by highly purified eicosapentaenoic acid in rodent models of obesity and human obese subjects. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 1918–1925. [Google Scholar] [CrossRef] [Scilit]
- Kalupahana, N.S.; Claycombe, K.; Newman, S.J.; Stewart, T.; Siriwardhana, N.; Matthan, N.; Lichtenstein, A.H.; Moustaid-Moussa, N. Eicosapentaenoic Acid Prevents and Reverses Insulin Resistance in High-Fat Diet-Induced Obese Mice via Modulation of Adipose Tissue Inflammation. J. Nutr. 2010, 140, 1915–1922. [Google Scholar] [CrossRef] [Scilit]
- Lorente-Cebrian, S.; Bustos, M.; Marti, A.; Martinez, J.A.; Moreno-Aliaga, M.J. Eicosapentaenoic acid stimulates AMP-activated protein kinase and increases visfatin secretion in cultured murine adipocytes. Clin. Sci. 2009, 117, 243–249. [Google Scholar] [CrossRef] [Scilit]
- González-Périz, A.; Horrillo, R.; Ferré, N.; Gronert, K.; Dong, B.; Morán-Salvador, E.; Titos, E.; Martínez-Clemente, M.; López-Parra, M.; Arroyo, V.; et al. Obesity-induced insulin resistance and hepatic steatosis are alleviated by ω-3 fatty acids: A role for resolvins and protectins. FASEB J. 2009, 23, 1946–1957. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopecky, J.; Rossmeisl, M.; Flachs, P.; Kuda, O.; Brauner, P.; Jilkova, Z.; Stankova, B.; Tvrzicka, E.; Bryhn, M. n-3 PUFA: Bioavailability and modulation of adipose tissue function. Proc. Nutr. Soc. 2009, 68, 361–369. [Google Scholar] [CrossRef] [Scilit]
- Moreno-Aliaga, M.J.; Lorente-Cebrián, S.; Martínez, J.A. Regulation of adipokine secretion by n-3 fatty acids. Proc. Nutr. Soc. 2010, 69, 324–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gray, B.; Steyn, F.; Davies, P.S.W.; Vitetta, L. Omega-3 fatty acids: A review of the effects on adiponectin and leptin and potential implications for obesity management. Eur. J. Clin. Nutr. 2013, 67, 1234–1242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giordano, E.; Dávalos, A.; Visioli, F. Chronic hydroxytyrosol feeding modulates glutathione-mediated oxido-reduction pathways in adipose tissue: A nutrigenomic study. Nutr. Metab. Cardiovasc. Dis. 2014, 24, 1144–1150. [Google Scholar] [CrossRef] [Scilit]
- Anderson, C.M.; Stahl, A. SLC27 fatty acid transport proteins. Mol. Aspects Med. 2013, 34, 516–528. [Google Scholar] [CrossRef] [Scilit]
- Rossi, A.S.; Lombardo, Y.B.; Chicco, A.G. Lipogenic enzyme activities and glucose uptake in fat tissue of dyslipemic, insulin-resistant rats: Effects of fish oil. Nutrition 2010, 26, 209–217. [Google Scholar] [CrossRef] [Scilit]
- LeMieux, M.J.; Kalupahana, N.S.; Scoggin, S.; Moustaid-Moussa, N. Eicosapentaenoic Acid Reduces Adipocyte Hypertrophy and Inflammation in Diet-Induced Obese Mice in an Adiposity-Independent Manner. J. Nutr. 2015, 145, 411–417. [Google Scholar] [CrossRef] [Scilit]
- Rong, J.X.; Qiu, Y.; Hansen, M.K.; Zhu, L.; Zhang, V.; Xie, M.; Okamoto, Y.; Mattie, M.D.; Higashiyama, H.; Asano, S.; et al. Adipose Mitochondrial Biogenesis Is Suppressed in db/db and High-Fat Diet–Fed Mice and Improved by Rosiglitazone. Diabetes 2007, 56, 1751–1760. [Google Scholar] [CrossRef] [Scilit]
- de Ferranti, S.; Mozaffarian, D. The perfect storm: Obesity, adipocyte dysfunction, and metabolic consequences. Clin. Chem. 2008, 54, 945–955. [Google Scholar] [CrossRef] [Scilit]
- Masschelin, P.M.; Cox, A.R.; Chernis, N.; Hartig, S.M. The Impact of Oxidative Stress on Adipose Tissue Energy Balance. Front. Physiol. 2020, 10, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kusunoki, C.; Yang, L.; Yoshizaki, T.; Nakagawa, F.; Ishikado, A.; Kondo, M.; Morino, K.; Sekine, O.; Ugi, S.; Nishio, Y.; et al. Omega-3 polyunsaturated fatty acid has an anti-oxidant effect via the Nrf-2/HO-1 pathway in 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun. 2013, 430, 225–230. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tatsumi, Y.; Kato, A.; Sango, K.; Himeno, T.; Kondo, M.; Kato, Y.; Kamiya, H.; Nakamura, J.; Kato, K. Omega-3 polyunsaturated fatty acids exert anti-oxidant effects through the nuclear factor (erythroid-derived 2)-related factor 2 pathway in immortalized mouse Schwann cells. J. Diabetes Investig. 2019, 10, 602–612. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Meital, L.T.; Windsor, M.T.; Perissiou, M.; Schulze, K.; Magee, R.; Kuballa, A.; Golledge, J.; Bailey, T.G.; Askew, C.D.; Russell, F.D. Omega-3 fatty acids decrease oxidative stress and inflammation in macrophages from patients with small abdominal aortic aneurysm. Sci. Rep. 2019, 9, 1–11. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Calder, P.C. Omega-3 fatty acids and inflammatory processes: From molecules to man. Biochem. Soc. Trans. 2017, 45, 1105–1115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yamada, H.; Umemoto, T.; Kakei, M.; Momomura, S.; Kawakami, M.; Ishikawa, S.; Hara, K. Eicosapentaenoic acid shows anti-inflammatory effect via GPR120 in 3T3-L1 adipocytes and attenuates adipose tissue inflammation in diet-induced obese mice. Nutr. Metab. 2017, 14, 1–11. [Google Scholar] [CrossRef] [Scilit]
- Kruglikov, I.L.; Scherer, P.E. The Role of Adipocytes and Adipocyte-Like Cells in the Severity of COVID-19 Infections. Obesity 2020, 28, 1187–1190. [Google Scholar] [CrossRef] [Scilit]
- Kokeny, G.; Calvier, L.; Legchenko, E.; Chouvarine, P.; Mozes, M.M.; Hansmann, G. PPAR-gama is a gatekeeper for extracellular matrix and vascular cell homeostasis: Beneficial role is n pulmonary hypertension and renal/cardiac/pulmonary fibrosis. Curr. Opin. Nephol. Hypertens. 2020, 29, 171–179. [Google Scholar] [CrossRef] [Scilit]
Sample Availability: Samples of the compounds are not available from the authors. |





| mRNA | Forward Primer | Reverse Primer | Melting To | Product Length | Gen Bank Code |
|---|---|---|---|---|---|
| Nrf2 | AAGCTTTCAACCCGAAGCAC | TTTCCGAGTCACTGAACCCA | 58 °C | 156 | NM_0317899.2 |
| GST | TGCAGACCAAAGCCATTCTC | ACGGTTCCTGGTTTGTTCCT | 56 °C | 197 | NM_017013.4 |
| GCL | ATGTGGACACCCGATGCAGTATT | TGTCTTGCTTGTAGTCAGGATGGTTT | 62 °C | 129 | NM_012815.2 |
| SREBP-1c | CTGGAGACATCGCAAACAAGC | ATGGTAGACAACAGCCGCATC | 58 °C | 277 | NM_001358315.1 |
| FAS | ATCCTGGAACGAGAACACGATCA | AGAGACGTGTCACTCCTGGACTT | 59 °C | 140 | NM_017332.1 |
| ACC | ACCAGGGCAAATGCATCAGT | TCGGAAAAGCATCGGGAAGT | 57 °C | 185 | NM_022193.1 |
| PPAR-γ | CCAGAGCATGGTGCCTTCGCT | CAGCAACCATTGGGTCAGCTC | 58 °C | 241 | NM_011146.3 |
| FATP1 | TCCGTCTGGTCAAGGTCAAT | GAAAACGCTGTGGGCAATCT | 56 °C | 188 | NM_011977.4 |
| LPL | AGCCAGGATGCAACATTGGA | TTGCACCTGTATGCCTTGCT | 57 °C | 157 | NM_008509.2 |
| NF-κΒ | GAGGTCTCTGGGGGTACCAT | AAGGCTGCCTGGATCACTTC | 58 °C | 89 | NM_008689.2 |
| TNF-α | ATGGCCTCCCTCTCATCAGT | TTTGCTACGACGTGGGCTAC | 58 °C | 97 | NM_013693.3 |
| IL-6 | TCCATCCAGTTGCCTTCTTG | TTCCACGATTTCCCAGAGAAC | 56 °C | 167 | NM_031168.2 |
| β-actin | ACTGCCGCATCCTCTTCCTC | CTCCTGCTTGCTGATCCACATC | 58 °C | 399 | NM_031144.3 |
| Groups | ||||||||
|---|---|---|---|---|---|---|---|---|
| Control Diet (CD) | High-Fat Diet (HFD) | |||||||
| Saline (a) | EPA (b) | HT (c) | EPA + HT (d) | Saline (e) | EPA (f) | HT (g) | EPA + HT (h) | |
| A. General parameters | ||||||||
| Initial body weight (g) | 14.2 ± 1.1 | 13.9 ± 1.4 | 14.0 ± 1.5 | 14.3 ± 1.1 | 14.2 ± 1.3 | 13.8 ± 1.3 | 14.3 ± 1.5 | 13.9 ± 1.3 |
| Final body weight (g) | 37.2 ± 3.1 e,f,g,h | 36.9 ± 3.2 e,f,g,h | 39.6 ± 3.5 e,f,g,h | 37.4 ± 3.4 e,f,g,h | 53.2 ± 4.4 a,b,c,d,f,h | 45.9 ± 4.2 a,b,c,d,e | 47.1 ± 4.0 a,b,c,d | 44.3 ± 3.6 a,b,c,d,e |
| B. White Adipose Tissue (WAT) | ||||||||
| Subcutaneous WAT (g) | 0.27 ± 0.09 e,f,g,h | 0.26 ± 0.10 e,f,g,h | 0.28 ± 0.11 e,f,g,h | 0.26 ± 0.08 e,f,g,h | 0.88 ± 0.17 a,b,c,d,f,g,h | 0.51 ± 0.15 a,b,c,d,e | 0.57 ± 0.13 a,b,c,d,e | 0.49 ± 0.17 a,b,c,d,e |
| Perirenal WAT (g) | 0.25 ± 0.11 e,f,g,h | 0.23 ± 0.09 e,f,h,g | 0.27 ± 0.12 e,f,g,h | 0.22 ± 0.07 e,f,g,h | 0.67 ± 0.19 a,b,c,d | 0.49 ± 0.16 a,b,c,d | 0.59 ± 0.16 a,b,c,d | 0.44 ± 0.13 a,b,c,d, e |
| Epididymal WAT (g) | 0.53 ± 0.15 e,f,g,h | 0.51 ± 0.11 e,f,g,h | 0.55 ± 0.13 e,f,g,h | 0.50 ± 0.11 e,f,g,h | 1.74 ± 0.25 a,b,c,d,f,g,h | 1.15 ± 0.22 a,b,c,d,e | 1.21 ± 0.19 a,b,c,d,e | 1.17 ± 0.16 a,b,c,d,e |
| Total weigth WAT (g) | 1.12 ± 0.12 e,f,g,h | 1.09 ± 0.14 e,f,g,h | 1.15 ± 0.14 e,f,g,h | 1.06 ± 0.12 e,f,g,h | 3.34 ± 0.31 a,b,c,d,f,g,h | 2.21 ± 0.20 a,b,c,d,e | 2.40 ± 0.25 a,b,c,d,e | 2.26 ± 0.22 a,b,c,d,e |
| C. Specific parameter of Epididymal WAT | ||||||||
| Relative weight (g/100 g body weight) | 1.67 ± 0.16 e,f,g,h | 1.65 ± 0.13 e,f,g,h | 1.63 ± 0.16 e,f,g,h | 1.62 ± 0.14 e,f,g,h | 3.11 ± 0.34 a,b,c,d,f,g,h | 2.09 ± 0.20 a,b,c,d,e | 2.15 ± 0.23 a,b,c,d,e | 2.05 ± 0.21 a,b,c,d,e |
| Cell volumen (pL) | 259.4 ± 22.0 e,f,g,h | 240.4 ± 20.1 e,f,g,h | 248.5 ± 23.3 e,f,g,h | 239.4 ± 24.2 e,f,g,h | 498 ± 40.2 a,b,c,d,f,g,h | 348.4 ± 30.3 a,b,c,d,e | 351.1 ± 40.6 a,b,c,d,e | 342.1 ± 27.7 a,b,c,d,e |
| Cell number (×106/g tissue) | 4.15 ± 0.37 e,f,g,h | 4.11 ± 0.29 e,f,g,h | 4.17 ± 0.32 e,f,g,h | 4.09 ± 0.25 e,f,g,h | 2.91 ± 0.21 a,b,c,d,f,g,h | 3.32 ± 0.28 a,b,c,d,e | 3.26 ± 0.21 a,b,c,d,e | 3.40 ± 0.33 a,b,c,d,e |
| Triacylglicerols (nmol/cell) | 0.37 ± 0.09 e,f,g,h | 0.35 ± 0.10 e,f,g,h | 0.34 ± 0.11 e,f,g,h | 0.31 ± 0.08 e,f,g,h | 0.68 ± 0.18 a,b,c,d,f,g,h | 0.45 ± 0.10 a,b,c,d,e | 0.49 ± 0.13 a,b,c,d,e | 0.40 ± 0.07 a,b,c,d,e |
| D. Serum parameters | ||||||||
| Adiponectin (mg/L) | 3.55 ± 0.21 e,f,g,h | 3.59 ± 0.22 e,f,g,h | 3.48 ± 0.24 e,f,g,h | 3.50 ± 0.24 e,f,g,h | 2.15 ± 0.14 a,b,c,d,f,g,h | 3.02 ± 0.14 a,b,c,d,e | 3.06 ± 0.17 a,b,c,d,e | 3.12 ± 0.15 a,b,c,d,e |
| Leptin (mg/mL) | 1.14 ± 0.08 e,f,g,h | 1.09 ± 0.10 e,f,g,h | 1.15 ± 0.11 e,f,g,h | 1.10 ± 0.08 e,f,g.h | 2.69 ± 0.29 a,b,c,d,f,g,h | 1.83 ± 0.20 a,b,c,d,e | 1.91 ± 0.26 a,b,c,d,e | 1.78 ± 0.17 a,b,c,d,e |
| Fatty Acid Composition (g/100 g FAME) | ||||||||
|---|---|---|---|---|---|---|---|---|
| Control Diet (CD) | High-Fat Diet (HFD) | |||||||
| Fatty Acid | Saline (a) | EPA (b) | HT (c) | EPA + HT (d) | Saline (e) | EPA (f) | HT (g) | EPA + HT (h) |
| C16:0 | 36.5 ± 3.9 e,f,g | 33.7 ± 4.5 e,f,g,h | 34.9 ± 3.7 e,f,g,h | 34.8 ± 3.2 e,f,g,h | 48.7 ± 4.9 a,b,c,d,f,g,h | 40.8 ± 4.1 a,b,c,d,e | 41.5 ± 4.6 a,b,c,d,e | 39.8 ± 3.5 b,c,d,e |
| C18:0 | 8.04 ± 1.2 | 8.12 ± 1.4 | 8.19 ± 1.5 | 8.16 ± 1.2 | 8.05 ± 1.8 | 8.11 ± 1.5 | 8.54 ± 1.3 | 8.14 ± 1.4 |
| C18:1n-9 | 27.2 ± 2.8 | 26.4 ± 3.0 | 27.1 ± 3.1 | 27.4 ± 2.5 | 25.2 ± 3.2 | 27.1 ± 2.1 | 23.5 ± 2.4 | 25.9 ± 2.8 |
| C18:2n-6 (LA) | 8.12 ± 1.3 | 8.22 ± 1.2 | 8.01 ± 1.2 | 8.04 ± 1.5 | 7.87 ± 1.2 | 7.24 ± 1.6 | 7.91 ± 1.2 | 7.78 ± 1.3 |
| C18:3n-3 (ALA) | 2.10 ± 0.5 e,f | 2.21 ± 0.5 e,f | 1.98 ± 0.4 e | 1.94 ± 0.5 e | 0.52 ± 0.2 a,b,c,d,f,g,h | 1.22 ± 0.3 a,b,e | 1.79 ± 0.2 e | 1.42 ± 0.3 e |
| C20:4n-6 (AA) | 7.41 ± 0.5 b,d,e,f | 6.04 ± 0.3 a,c,e,f | 7.84 ± 0.5 b,d,e,f | 6.14 ± 0.3 a,c,e,f | 4.05 ± 0.2 a,b,c,d,f,g,h | 5.76 ± 0.4 a,c,e,g,h | 6.98 ± 0.4 b,d,e,f | 7.01 ± 0.5 b,d,e,f |
| C20:5n-3 (EPA) | 1.10 ± 0.2 b,d,e,g | 3.15 ± 0.5 a,c,e,f,g,h | 1.31 ± 0.3 b,d,e,g | 3.32 ± 0.4 a,c,e,f,g,h | 0.21 ± 0.01 a,b,c,d,f,g,h | 0.94 ± 0.2 b,d,e,g,h | 0.58 ± 0.1 a,b,c,d,e,f,h | 1.50 ± 0.3 b,d,e,f,g |
| C22:6n-3 (DHA) | 2.58 ± 0.3 b,d,e,g | 3.76 ± 0.5 a,c,e,f,g,h | 2.81 ± 0.4 b,d,e,g | 3.88 ± 0.4 a,c,e,f,g,h | 0.72 ± 0.05 a,b,c,d,f,g,h | 2.14 ± 0.2 b,d,e | 1.95 ± 0.2 a,b,c,d,e,h | 2.64 ± 0.3 b,d,e,g |
| Total SFAs | 47.0 ± 4.3 e | 43.7 ± 4.6 e | 45.1 ± 4.9 e | 44.9 ± 4.7 e | 58.9 ± 5.8 a,b,c,d | 51.8 ± 5.4 | 52.9 ± 5.0 | 50.1 ± 4.4 e |
| Total MUFAs | 29.3 ± 2.9 | 30.4 ± 3.1 | 31.4 ± 3.2 | 30.8 ± 2.7 | 27.1 ± 3.1 | 29.3 ± 2.5 | 24.7 ± 3.1 | 27.6 ± 3.3 |
| Total PUFAs | 23.7 ± 2.5 e,f | 25.9 ± 2.7 e,f | 23.5 ± 2.4 e,f | 24.3 ± 2.1 e,f | 14.0 ± 1.4 a,b,c,d,f,g,h | 18.9 ± 1.8 a,b,c,d,e | 22.4 ± 2.4 e | 22.3 ± 2.2 e |
| Total LCPUFAs | 12.9 ± 0.4 e,f,g,h | 13.7 ± 0.5 e,f,g,h | 13.1 ± 0.3 e,f,g,h | 14.0 ± 0.4 e,f,g,h | 5.82 ± 0.2 a,b,c,d,f,g,h | 9.76 ± 0.4 a,b,c,d,e,h | 10.4 ± 0.4 a,b,c,d,e,h | 11.7 ± 0.3 a,b,c,d,e,f,g |
| Total n-6 LCPUFAs | 8.78 ± 0.3 b,d,e,f,g,h | 6.14 ± 0.2 a,c,e,g,h | 9.04 ± 0.4 b,d,e,f,g,h | 6.46 ± 0.2 a,c,e,g,h | 4.42 ± 0.2 a,b,c,d,f,g,h | 6.27 ± 0.4 a,c,e | 7.72 ± 0.5 a,c,e | 7.22 ± 0.5 a,c,e |
| Total n-3 LCPUFAs | 4.12 ± 0.2 b,d,e,f,g | 7.56 ± 0.3 a,c,e,f,g,h | 4.06 ± 0.2 b,d,e,f,g | 7.54 ± 0.4 a,c,e,f,g,h | 1.40 ± 0.04 a,b,c,d,f,g,h | 3.49 ± 0.2 a,b,c,d,e,g,h | 2.68 ± 0.1 a,b,c,d,e,f,h | 4.48 ± 0.04 b,d,e,f,g |
| n-6/n-3 LCPUFAs ratio | 2.13 ± 0.1 b,d,e,f,g,h | 0.81 ± 0.0 a,c,e,f,g,h | 2.22 ± 0.1 b,d,e,f,g,h | 0.86 ± 0.03 a,c,e,f,g,h | 3.15 ± 0.2 a,b,c,d,f,g,h | 1.80 ± 0.03 a,b,c,d,e,g | 2.88 ± 0.2 a,b,c,d,e,f,h | 1.61 ± 0.1 a,b,c,d,e,g |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Illesca, P.; Valenzuela, R.; Espinosa, A.; Echeverría, F.; Soto-Alarcon, S.; Campos, C.; Rodriguez, A.; Vargas, R.; Magrone, T.; Videla, L.A. Protective Effects of Eicosapentaenoic Acid Plus Hydroxytyrosol Supplementation Against White Adipose Tissue Abnormalities in Mice Fed a High-Fat Diet. Molecules 2020, 25, 4433. https://doi.org/10.3390/molecules25194433
Illesca P, Valenzuela R, Espinosa A, Echeverría F, Soto-Alarcon S, Campos C, Rodriguez A, Vargas R, Magrone T, Videla LA. Protective Effects of Eicosapentaenoic Acid Plus Hydroxytyrosol Supplementation Against White Adipose Tissue Abnormalities in Mice Fed a High-Fat Diet. Molecules. 2020; 25(19):4433. https://doi.org/10.3390/molecules25194433
Chicago/Turabian StyleIllesca, Paola, Rodrigo Valenzuela, Alejandra Espinosa, Francisca Echeverría, Sandra Soto-Alarcon, Cristian Campos, Alicia Rodriguez, Romina Vargas, Thea Magrone, and Luis A. Videla. 2020. "Protective Effects of Eicosapentaenoic Acid Plus Hydroxytyrosol Supplementation Against White Adipose Tissue Abnormalities in Mice Fed a High-Fat Diet" Molecules 25, no. 19: 4433. https://doi.org/10.3390/molecules25194433
APA StyleIllesca, P., Valenzuela, R., Espinosa, A., Echeverría, F., Soto-Alarcon, S., Campos, C., Rodriguez, A., Vargas, R., Magrone, T., & Videla, L. A. (2020). Protective Effects of Eicosapentaenoic Acid Plus Hydroxytyrosol Supplementation Against White Adipose Tissue Abnormalities in Mice Fed a High-Fat Diet. Molecules, 25(19), 4433. https://doi.org/10.3390/molecules25194433

