Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR) in Stenotrophomonas maltophilia
Abstract
1. Introduction
2. Results and Discussion
3. Materials and Methods
3.1. Collection of Effluents
3.2. Bacterial Strains and Cultivation Conditions
3.3. Identification of Selected Bacterial Isolate
3.3.1. Morphological and Biochemical Identification
3.3.2. Molecular Characterization
DNA Extraction
Amplification of 16S rRNA Gene
Analysis Sequence
Phylogenetic Tree Construction
3.3.3. Antibiotic Susceptibility Testing
3.4. Microtiter Plate Assay (Quantitative Assays for Biofilm Formation)
3.5. Minimum Inhibitory Concentration (MIC)
3.6. Growth Tolerance and Chromium (VI) Reduction
3.7. Tolerance to Other Metals
3.8. Extraction and Localization of Chromate Reductase
3.9. Polyacrylamide Gel Electrophoresis
3.10. Amplification of Cr(VI) Reductase Gene
3.11. Statistical Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Dhal, B.; Thatoi, H.N.; Das, N.N.; Pandey, B.D. Chemical and microbial remediation of hexavalent chromium from contaminated soil and mining/metallurgical solid waste: A review. J. Hazard. Mater. 2013, 250, 272–291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gupta, V.K.; Rastogi, A. Biosorption of hexavalent chromium by raw and acid-treated green alga Oedogonium hatei from aqueous solutions. J. Hazard. Mater. 2009, 163, 396–402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chattopadhyay, B.; Utpal, S.R.; Mukhopadhyay, S. Mobility and bioavailability of chromium in the environment: Physico-chemical and microbial oxidation of Cr (III) to Cr (VI). J. Appl. Sci. Environ. Manag. 2010, 14, 97–101. [Google Scholar] [CrossRef] [Scilit]
- Cheung, K.H.; Ji-Dong, G.U. Mechanism of hexavalent chromium detoxification by microorganisms and bioremediation application potential: A review. Int. Biodeterior. Biodegrad. 2007, 59, 8–15. [Google Scholar] [CrossRef] [Scilit]
- Maqbool, Z.; Asghar, H.N.; Shahzad, T.; Hussain, S.; Riaz, M.; Ali, S.; Maqsood, M. Isolating, screening and applying chromium reducing bacteria to promote growth and yield of okra (Hibiscus esculentus L.) in chromium contaminated soils. Ecotoxicol. Environ. Saf. 2015, 114, 343–349. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- De Flora, S.; Wetterhahn, K.E. Mechanisms of chromium metabolism and genotoxicity. Life Chem. Rep. 1989, 7, 169–244. [Google Scholar]
- Mala, J.G.S.; Sujatha, D.; Rose, C. Inducible chromate reductase exhibiting extracellular activity in Bacillus methylotrophicus for chromium bioremediation. Microbiol. Res. 2015, 170, 235–241. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thatoi, H.; Das, S.; Mishra, J.; Rath, B.P.; Das, N. Bacterial chromate reductase, a potential enzyme for bioremediation of hexavalent chromium: A review. J. Environ. Manag. 2014, 146, 383–399. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- National Institute for Occupational Safety and Health (NIOSH). Criteria for a Recommended Standard: Occupational Exposure to Hexavalent Chromium; Department of Health and Human Services, Centers for Disease Control and Prevention, National Institute for Occupational Safety and Health: Cincinnati, OH, USA, 2013; p. 168.
- Skovbjerg, L.L. Reduction of Hexavalent Chromium by Green Rust Sulphate: Determination of End Product and Reduction Mechanism. Master’s Thesis, University of Copenhagen, Copenhagen, Denmark, 2005. [Google Scholar]
- Ataabadi, M.; Hoodaji, M.; Tahmourespour, A.; Kalbasi, M.; Abdouss, M. Optimization of factors affecting hexavalent chromium removal from simulated electroplating wastewater by synthesized magnetite nanoparticles. Environ. Monit. Assess. 2015, 187, 4165–4176. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ilias, M.; Rafiqullah, I.M.; Debnath, B.C.; Mannan, K.S.B.; Hoq, M.M. Isolation and characterization of chromium (VI)-reducing bacteria from tannery effluents. Indian J. Microbiol. 2011, 51, 76–81. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Allegretti, P.; Furlong, J.; Donati, E. The role of higher polythionates in the reduction of chromium (VI) by Acidithiobacillus and Thiobacillus cultures. J. Biotechnol. 2006, 122, 55–61. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rajendran, P.; Muthukrishnan, J.; Gunasekaran, P. Microbes in heavy metal remediation. Indian J. Exp. Biol. 2003, 41, 935–944. [Google Scholar] [PubMed]
- Pattanapipitpaisal, P.; Brown, N.; Macaskie, L. Chromate reduction and 16S rRNA identification of bacteria isolated from a Cr (VI)-contaminated site. Appl. Microbiol. Biotechnol. 2001, 57, 257–261. [Google Scholar] [PubMed]
- Raspor, P.; Batic, M.; Jamnik, P.; Josic, D.; Milacic, R.; Pas, M.; Skrt, M. The influence of chromium compounds on yeast physiology: (A review). Acta Microbiol. Inmunol. Hung. 2000, 47, 143–173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Deng, S.; Yu, Q.; Huang, J.; Yu, G. Removal of perfluorooctane sulfonate from wastewater by anion exchange resins: Effects of resin properties and solution chemistry. Water Res. 2010, 18, 5188–5195. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.; Zhang, L.; Xia, Z.; Roy, A.; Chang, D.W.; Baek, J.B.; Dai, L. BCN graphene as efficient metal-free electrocatalyst for the oxygen reduction reaction. Angew. Chem. Int. Ed. 2012, 51, 4209–4212. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Camargo, F.A.O.; Bento, F.M.; Okeke, B.C.; Frankenberger, W.T. Chromate reduction by chromium-resistant bacteria isolated from soils contaminated with dichromate. J. Environ. Qual. 2003, 32, 1228–1233. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, M.Z.; Malik, A. Chromate resistance, transport and bioreduction by Exiguobacterium sp. ZM-2 isolated from agricultural soil irrigated with tannery effluent. J. Basic Microbiol. 2008, 48, 416–420. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alam, M.Z.; Ahmad, S. Toxic chromate reduction by resistant and sensitive bacteria isolated from tannery effluent contaminated soil. Ann. Microbiol. 2012, 62, 113–121. [Google Scholar] [CrossRef] [Scilit]
- Gadd, G.M. Metals, minerals and microbes: Geomicrobiology and bioremediation. Microbiology 2010, 156, 609–643. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Silver, S.; Phung, L.T. A bacterial view of the periodic table: Genes and proteins for toxic inorganic ions. J. Ind. Microbiol. Biotechnol. 2005, 32, 587–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kümmerer, K. Resistance in the environment. J. Antimicrob. Chemother. 2004, 54, 311–320. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belay, A.A. Impacts of chromium from tannery effluent and evaluation of alternative treatment options. J. Environ. Prot. 2010, 1, 53–58. [Google Scholar] [CrossRef]
- Gunasundari, D.; Muthukumar, K. Simultaneous Cr (VI) reduction and phenol degradation using Stenotrophomonas sp. isolated from tannery effluent contaminated soil. Environ. Sci. Pollut. Res. 2013, 20, 6563–6573. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oves, M.; Khan, M.S.; Zaidi, A.; Ahmed, A.S.; Ahmed, F.; Ahmad, E.; Azam, A. Antibacterial and cytotoxic efficacy of extracellular silver nanoparticles biofabricated from chromium reducing novel OS4 strain of Stenotrophomonas maltophilia. PLoS ONE 2013, 8, e59140. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Holmes, A.; Vinayak, A.; Benton, C.; Esbenshade, A.; Heinselman, C.; Frankland, D.; Caguiat, J. Comparison of two multimetal resistant bacterial strains: Enterobacter sp. YSU and Stenotrophomonas maltophilia ORO2. Curr. Microbiol. 2009, 59, 526–531. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anzai, Y.; Kim, H.; Park, J.Y.; Wakabayashi, H.; Oyaizu, H. Phylogenetic affiliation of the Pseudomonads based on 16S rRNA sequence. Int. J. Syst. Evol. Microbiol. 2000, 50, 1563–1589. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Palleroni, N.J.; Bradbury, J.F. Stenotrophomonas, a new bacterial genus for Xanthomonas maltophilia (Hugh 1980) Swings et al. 1983. Int. J. Syst. Evol. Microbiol. 1993, 43, 606–609. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brooke, J.S.; Di-Bonaventura, G.; Berg, G.; Martinez, J.L. A multidisciplinary look at Stenotrophomonas maltophilia: An emerging multi-drug-resistant global opportunistic pathogen. Front. Microbiol. 2017, 8, 1511–1513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Esposito, A.; Pompilio, A.; Bettua, C.; Crocetta, V.; Giacobazzi, E.; Fiscarelli, E.; Di-Bonaventura, G. Evolution of Stenotrophomonas maltophilia in cystic fibrosis lung over chronic infection: A genomic and phenotypic population study. Front. Microbiol. 2017, 8, 1590–1605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Waters, V.; Atenafu, E.G.; Lu, A.; Yau, Y.; Tullis, E.; Ratjen, F. Chronic Stenotrophomonas maltophilia infection and mortality or lung transplantation in cystic fibrosis patients. J. Cyst. Fibros. 2013, 12, 482–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sánchez, M.B.; Martínez, J.L. SmQnr contributes to intrinsic resistance to quinolones in Stenotrophomonas maltophilia. Antimicrob. Agents Chemother. 2010, 54, 580–581. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kılıc, N.K.; Donmez, G. Environmental conditions affecting exopolysaccharide production by Pseudomonas aeruginosa, Micrococcus sp., and Ochrobactrum sp. J. Hazard. Mater. 2008, 154, 1019–1024. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nancharaiah, Y.V.; Dodge, C.; Venugopalan, V.P.; Narasimhan, S.V.; Francis, A.J. Immobilization of Cr (VI) and its reduction to Cr (III) phosphate by granular biofilms comprising a mixture of microbes. Appl. Environ. Microbiol. 2010, 76, 2433–2438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lameiras, S.; Quintelas, C.; Tavares, T. Biosorption of Cr (VI) using a bacterial biofilm supported on granular activated carbon and on zeolite. Bioresour. Technol. 2008, 99, 801–806. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Quintelas, C.; Fonseca, B.; Silva, B.; Figueiredo, H.; Tavares, T. Treatment of chromium (VI) solutions in a pilot-scale bioreactor through a biofilm of Arthrobacter viscosus supported on GAC. Bioresour. Technol. 2009, 100, 220–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pan, X.; Liu, Z.; Chen, Z.; Cheng, Y.; Pan, D.; Shao, J.; Guan, X. Investigation of Cr (VI) reduction and Cr (III) immobilization mechanism by planktonic cells and biofilms of Bacillus subtilis ATCC-6633. Water Res. 2014, 55, 21–29. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Basu, M.; Bhattacharya, S.; Paul, A.K. Isolation and characterization of chromium-resistant bacteria from tannery effluents. Bull. Environ. Contam. Toxicol. 1997, 58, 535–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pagès, J.M.; James, C.E.; Winterhalter, M. The porin and the permeating antibiotic: A selective diffusion barrier in Gram-negative bacteria. Nat. Rev. Microbiol. 2008, 6, 893–903. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rocco, F.; De Gregorio, E.; Colonna, B.; Di Nocera, P.P. Stenotrophomonas maltophilia genomes: A start-up comparison. Int. J. Med. Microbiol. 2009, 299, 535–546. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, S.; Ge, S.C. Simultaneous Cr (VI) reduction and Zn (II) biosorption by Stenotrophomonas sp. and constitutive expression of related genes. Biotechnol. Lett. 2016, 38, 877–884. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viti, C.; Pace, A.; Giovannetti, L. Characterization of Cr (VI)-resistant bacteria isolated from chromium-contaminated soil by tannery activity. Curr. Microbiol. 2003, 46, 1–5. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramírez-Díaz, M.I.; Díaz-Pérez, C.; Vargas, E.; Riveros-Rosas, H.; Campos-García, J.; Cervantes, C. Mechanisms of bacterial resistance to chromium compounds. Biometals 2008, 21, 321–332. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chirwa, E.M.; Molokwane, P.E. Biological Cr (VI) reduction: Microbial diversity, kinetics and biotechnological solutions to pollution. In Biodiversity; Sofo, A., Ed.; InTech: Cambridge, UK, 2011. [Google Scholar]
- Pimentel, B.E.; Moreno-Sánchez, R.; Cervantes, C. Efflux of chromate by Pseudomonas aeruginosa cells expressing the ChrA protein. FEMS Microbiol. Lett. 2002, 212, 249–254. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Juhnke, S.; Peitzsch, N.; Hübener, N.; Große, C.; Nies, D.H. New genes involved in chromate resistance in Ralstonia metallidurans strain CH34. Arch. Microbiol. 2002, 179, 15–25. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cervantes, C.; Campos-García, J.; Devars, S.; Gutiérrez-Corona, F.; Loza-Tavera, H.; Torres-Guzmán, J.C.; Moreno-Sánchez, R. Interactions of chromium with microorganisms and plants. FEMS Microbiol. Rev. 2001, 25, 335–347. [Google Scholar] [CrossRef] [PubMed]
- Park, C.H.; Keyhan, M.; Wielinga, B.; Fendorf, S.; Matin, A. Purification to homogeneity and characterization of a novel Pseudomonas putida chromate reductase. Appl. Environ. Microbiol. 2000, 66, 1788–1795. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tebo, B.M.; Obraztsova, A.Y. Sulfate-reducing bacterium grows with Cr (VI), U (VI), Mn (IV), and Fe (III) as electron acceptors. FEMS Microbiol. Lett. 1998, 162, 193–198. [Google Scholar] [CrossRef]
- Myers, C.R.; Carstens, B.P.; Antholine, W.E.; Myers, J.M. Chromium (VI) reductase activity is associated with the cytoplasmic membrane of anaerobically grown Shewanella putrefaciens MR-1. J. Appl. Microbiol. 2000, 88, 98–106. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Morel, M.A.; Ubalde, M.C.; Olivera-Bravo, S.; Callejas, C.; Gill, P.R.; Castro-Sowinski, S. Cellular and biochemical response to Cr (VI) in Stenotrophomonas sp. FEMS Microbiol. Lett. 2009, 291, 162–168. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Thacker, U.; Madamwar, D. Reduction of toxic chromium and partial localization of chromium reductase activity in bacterial isolate DM1. World J. Microbiol. Biotechnol. 2005, 21, 891–899. [Google Scholar] [CrossRef] [Scilit]
- Blake, R.C.; Choate, D.M.; Bardhan, S.; Revis, N.; Barton, L.L.; Zocco, T.G. Chemical transformation of toxic metals by a Pseudomonas strain from a toxic waste site. Environ. Toxicol. Chem. 1993, 12, 1365–1376. [Google Scholar] [CrossRef] [Scilit]
- Zahoor, A.; Rehman, A. Isolation of Cr (VI) reducing bacteria from industrial effluents and their potential use in bioremediation of chromium containing wastewater. J. Environ. Sci. 2009, 21, 814–820. [Google Scholar] [CrossRef] [Scilit]
- Xia, X.; Wu, S.; Li, N.; Wang, D.; Zheng, S.; Wang, G. Novel bacterial selenite reductase CsrF responsible for Se (IV) and Cr (VI) reduction that produces nanoparticles in Alishewanella sp. WH16-1. J. Hazard. Mater. 2018, 342, 499–509. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Aguilar-Barajas, E.; Paluscio, E.; Cervantes, C.; Rensing, C. Expression of chromate resistance genes from Shewanella sp. strain ANA-3 in Escherichia coli. FEMS Microbiol. Lett. 2008, 285, 97–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nickens, K.P.; Patierno, S.R.; Ceryak, S. Chromium genotoxicity: A double-edged sword. Chem. Biol. Interact. 2010, 188, 276–288. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ackerley, D.F.; Barak, Y.; Lynch, S.V.; Curtin, J.; Matin, A. Effect of chromate stress on Escherichia coli K-12. J. Bacteriol. 2006, 188, 3371–3381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Patra, R.C.; Malik, S.; Beer, M.; Megharaj, M.; Naidu, R. Molecular characterization of chromium (VI) reducing potential in Gram positive bacteria isolated from contaminated sites. Soil Biol. Biochem. 2010, 42, 1857–1863. [Google Scholar] [CrossRef] [Scilit]
- Barak, Y.; Ackerley, D.F.; Dodge, C.J.; Banwari, L.; Alex, C.; Francis, A.J.; Matin, A. Analysis of novel soluble chromate and uranyl reductases and generation of an improved enzyme by directed evolution. Appl. Environ. Microbiol. 2006, 72, 7074–7082. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Antonioli, P.; Lampis, S.; Chesini, I.; Vallini, G.; Rinalducci, S.; Zolla, L.; Righetti, P.G. Stenotrophomonas maltophilia SeITE02, a new bacterial strain suitable for bioremediation of selenite-contaminated environmental matrices. Appl. Environ. Microbiol. 2007, 73, 6854–6863. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ryan, R.P.; Monchy, S.; Cardinale, M.; Taghavi, S.; Crossman, L.; Avison, M.B.; Dow, J.M. The versatility and adaptation of bacteria from the genus Stenotrophomonas. Nat. Microbiol. Rev. 2009, 7, 514–525. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Harrison, J.J.; Ceri, H.; Turner, R.J. Multimetal resistance and tolerance in microbial biofilms. Nat. Rev. Microbiol. 2007, 5, 928–938. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahemad, M. Enhancing phytoremediation of chromium-stressed soils through plant-growth-promoting bacteria. J. Genet. Eng. Biotechnol. 2015, 13, 51–58. [Google Scholar] [CrossRef] [Scilit]
- American Public Health Association; American Water Works Association; Water Pollution Control Federation, & Water Environment Federation. Standard Methods for the Examination of Water and Wastewater, 20th ed.; American Public Health Association: Washington, DC, USA, 1989; p. 541. [Google Scholar]
- Huang, J.; Cao, Y.; Shao, Q.; Peng, X.; Guo, Z. Magnetic nanocarbon adsorbents with enhanced hexavalent chromium removal: Morphology dependence of fibrillar vs. particulate structures. Ind. Eng. Chem. Res. 2017, 56, 10689–10701. [Google Scholar] [CrossRef] [Scilit]
- Ge, H.; Ma, Z. Microwave preparation of triethylenetetramine modified graphene oxide/chitosan composite for adsorption of Cr (VI). Carbohydr. Polym. 2015, 131, 280–287. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Barrow, G.I.; Feltham, R.K.A. Manual for the Identification of Medical Bacteria, 3rd ed.; Cambridge University Press: Cambridge, UK, 1993; p. 331. [Google Scholar]
- Lane, D.J. 16S/23S rRNA Sequencing. In Nucleic Acid Techniques in Bacterial Systematic; Stackebrandt, E., Goodfellow, M., Eds.; John Wiley and Sons: New York, NY, USA, 1991; pp. 115–175. [Google Scholar]
- Bernardet, J.F.; Bowman, J.P. The genus Flavobacterium. In The Prokaryotes. The Genus Flavobacterium; Springer: New York, NY, USA, 2006. [Google Scholar]
- Sambrook, J.; Fritsch, E.F.; Maniatis, T. Molecular Cloning: A Laboratory Manual, 2nd ed.; Cold Spring Harbor Laboratory Press: Austin, TX, USA, 1989; p. 1546. [Google Scholar]
- Sanders, R.; Huggett, J.F.; Bushell, C.A.; Cowen, S.; Scott, D.J.; Foy, C.A. Evaluation of digital PCR for absolute DNA quantification. Anal. Chem. 2011, 83, 6474–6484. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, S.; Tamura, K.; Nei, M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 2004, 5, 150–163. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rosselló-Mora, R.; Amann, R. The species concept for prokaryotes. FEMS Microbiol. Rev. 2001, 25, 39–67. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Weinstein, M.P. Clinical and laboratory standards institute. In Performance Standards for Antimicrobial Susceptibility Testing, 27th ed.; Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2017; p. 296. [Google Scholar]
- Magiorakos, A.P.; Srinivasan, A.; Carey, R.B.; Carmeli, Y.; Falagas, M.E.; Giske, C.G.; Paterson, D.L. Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: An international expert proposal for interim standard definitions for acquired resistance. Clin. Microbiol. Infect. 2012, 18, 268–281. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- O’toole, G.A.; Kolter, R. Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: A genetic analysis. Mol. Microbiol. 1998, 28, 449–461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stepanović, S.; Vuković, D.; Hola, V.; Bonaventura, G.D.; Djukić, S.; Ćirković, I.; Ruzicka, F. Quantification of biofilm in microtiter plates: Overview of testing conditions and practical recommendations for assessment of biofilm production by staphylococci. APMIS 2007, 115, 891–899. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luli, G.W.; Talnagi, J.W.; Strohl, W.R.; Pfister, R.M. Hexavalent chromium-resistant bacteria isolated from river sediments. Appl. Environ. Microbiol. 1983, 4, 846–854. [Google Scholar]
- Batool, R.; Yrjala, K.; Hasnain, S. Hexavalent chromium reduction by bacteria from tannery effluent. J. Microbiol. Biotechnol. 2012, 22, 547–554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chai, L.; Huang, S.; Yang, Z.; Peng, B.; Huang, Y.; Chen, Y. Cr (VI) remediation by indigenous bacteria in soils contaminated by chromium-containing slag. J. Hazard. Mater. 2009, 167, 516–522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Molokwane, P.E.; Meli, K.C.; Nkhalambayausi-Chirwa, E.M. Chromium (VI) reduction in activated sludge bacteria exposed to high chromium loading: Brits culture (South Africa). Water Res. 2008, 42, 4538–4548. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- American Public Health Association; American Water Works Association; Water Pollution Control Federation, & Water Environment Federation. Standard Methods for the Examination of Water and Wastewater, 22th ed.; American Public Health Association: Washington, DC, USA, 2012; p. 1496. [Google Scholar]
- Urone, P.F. Stability of colorimetric reagent for chromium, s-diphenylcarbazide, in various solvents. Anal. Chem. 1955, 27, 1354–1355. [Google Scholar] [CrossRef] [Scilit]
- Kumari, V.; Yadav, A.; Haq, I.; Kumar, S.; Bharagava, R.N.; Singh, S.K.; Raj, A. Genotoxicity evaluation of tannery effluent treated with newly isolated hexavalent chromium reducing Bacillus cereus. J. Environ. Manag. 2016, 183, 204–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laemmli, U.K. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 1970, 227, 680–685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Sample Availability: Samples of the compounds are not available from the authors. |







| Strains Stenotrophomonas maltophilia | ||||||
|---|---|---|---|---|---|---|
| Features | Specifications | * NA2 | DGM3 a | T7D7 b | OS4 c | ZA6 d |
| Appeareance | Phenotypic Characteristics | * Pale Yellow, Glistening, Circular Colonies with Entire Smooth Margin. Lavender Green Colonies on Blood Agar. Straight or Curved Rods, 0.5 by 1.5 μm. | ||||
| Staining | Gram Reaction | − | − | − | − | − |
| Biochemical reactions | Motility | + | + | + | + | + |
| Methyl Red | − | v | − | − | − | |
| Citrate | + | + | + | − | − | |
| Nitrate | + | v | v | v | v | |
| Indole | − | − | − | − | − | |
| Catalase | + | + | + | + | + | |
| Voges Proskauer | − | − | − | − | − | |
| Oxidase | − | − | − | − | − | |
| Urease | − | v | v | + | − | |
| Dnase | + | v | v | + | + | |
| Hydrolysis | Starch | + | v | − | v | v |
| Gelatin | + | v | + | v | + | |
| Esculin | + | v | v | v | v | |
| Carbohydrates utilization | Sucrose | + | v | + | + | + |
| Glucose | + | v | v | v | + | |
| Mannitol | − | v | − | − | − | |
| Sorbitol | − | v | − | − | − | |
| Lactose | + | v | − | − | + | |
| Florescence (UV) | + | − | v | v | v | |
| H2S Production | − | v | v | v | v | |
| Gene | Sequence Primers/Probe | Genome | Size Fragment | References |
|---|---|---|---|---|
| ChrR1F | 5′ AGCAACAGTTACAACCGGC 3′ | Chromate reductase | 458 bp | Designed in this study |
| ChrR1R | 5′ CGAAATCTTCCGCGTCATCG 3′ | |||
| ChRF | 5′ TCACGCCGGAATATAACTAC 3′ | Chromate reductase | 268 bp | [61] |
| ChR | 5′ CGTACCCTGATCAATCACTT 3′ |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Baldiris, R.; Acosta-Tapia, N.; Montes, A.; Hernández, J.; Vivas-Reyes, R. Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR) in Stenotrophomonas maltophilia. Molecules 2018, 23, 406. https://doi.org/10.3390/molecules23020406
Baldiris R, Acosta-Tapia N, Montes A, Hernández J, Vivas-Reyes R. Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR) in Stenotrophomonas maltophilia. Molecules. 2018; 23(2):406. https://doi.org/10.3390/molecules23020406
Chicago/Turabian StyleBaldiris, Rosa, Natali Acosta-Tapia, Alfredo Montes, Jennifer Hernández, and Ricardo Vivas-Reyes. 2018. "Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR) in Stenotrophomonas maltophilia" Molecules 23, no. 2: 406. https://doi.org/10.3390/molecules23020406
APA StyleBaldiris, R., Acosta-Tapia, N., Montes, A., Hernández, J., & Vivas-Reyes, R. (2018). Reduction of Hexavalent Chromium and Detection of Chromate Reductase (ChrR) in Stenotrophomonas maltophilia. Molecules, 23(2), 406. https://doi.org/10.3390/molecules23020406

