Search Results (273)

Background: Aluminum (Al) toxicity severely limits Medicago sativa (alfalfa) production on acidic soils, resulting in major yield losses worldwide. The highly conserved miRNA156 (miR156) functions by downregulating at least 11 SQUAMOSA promoter-binding protein-like (SPL) transcription factors in alfalfa, including SPL13, but its role in Al stress remains unclear. This study aimed to investigate the miR156/SPL regulatory network’s function in alfalfa under Al stress. Methods: Gene expression analyses, histochemical staining, nutrient profiling, phenotypic assays, transcriptome profiling, and ChIP-seq were conducted on alfalfa plants with altered miR156 and SPL13 expression to assess their roles in the Al stress response. Results: Al stress induced SPL13 expression while repressing miR156 in the roots. Elevated miR156 intensified Al accumulation, lipid peroxidation, and plasma membrane damage, accompanied by reduced leaf nitrogen, magnesium, sulfur, and phosphorus content. Phenotypically, increased SPL13 enhanced the root length and Al tolerance, whereas SPL13 silencing reduced tolerance. Transcriptome profiling of SPL13-silenced plants identified differentially expressed genes involved in the Al response, including aluminum-activated malate transporters and various transcription factors (GRAS, Myb-related, bHLH041, NAC, WRKY53, bZIP, and MADS-box). ChIP-seq revealed that SPL13 directly regulates genes encoding a protein kinase, cytochrome P450, and fasciclin-like arabinogalactan proteins. Conclusions: The MsmiR156/MsSPL13 network plays a crucial regulatory role in alfalfa’s response to Al toxicity. These findings provide novel genetic targets and foundational knowledge to advance molecular breeding for enhanced Al tolerance in alfalfa. Full article

Adenovirus is a frequent cause of mild, usually self-limited infections in infants and young children. Severe infections occur in immunocompromised patients but are rarely observed in healthy, immunocompetent adults. However, there have been outbreaks of infections with different adenoviral (Ad) types around the world that have resulted in acute lung injury (ALI) and acute respiratory distress syndrome (ARDS) in some of those infected. Ad14p1 is the predominant circulating strain of Ad14 worldwide that has caused ARDS. An explanation for the severity of illness caused by Ad14p1 infection in immunocompetent patients is unknown. Previously, we have shown that A549 cells infected with Ad14 repress macrophage pro-inflammatory responses, whereas cells infected with Ad14p1 fail to repress macrophages and instead can increase pro-inflammatory responses. Adenoviral infection has been shown to modulate host miRNA expression, and we hypothesized that differences in miRNA expression between Ad14- and Ad14p1-infected cells might explain the differential responses of macrophages to Ad14- and Ad14p1-infected cells. Analysis of host miRNA showed that 98 miRNAs are differentially expressed when infection reaches full cytopathic effect (CPE), the same point at which Ad14 and Ad14p1 CPE corpses induce differential inflammatory responses in macrophages. Only 10 of the miRNAs that were enriched in Ad14 CPE corpses were expressed at levels that are potentially biologically relevant. Pathway enrichment analysis showed that the differentially expressed miRNAs might explain the increased pathogenesis of Ad14p1 through strain-related loss of modulation of cytokine expression when compared with prototype Ad14. Overall, the data suggest a role for viral regulation of host miRNA expression in pathogenesis by regulating host inflammatory responses through the delivery of de-regulated miRNAs by viral CPE corpses to macrophages. Full article

In the efforts towards germplasm innovation of livestock and poultry, strategies to improve meat quality have faced some increasingly challenging and dynamic concerns. Intramuscular fat (IMF) content and backfat thickness are two important traits contributing to meat quality. MicroRNAs (miRNAs)—a class of endogenous noncoding RNAs maintaining cell homeostasis by inhibiting target gene expression—have been proven as critical regulators of body fat deposition, thus affecting farm animal production. Our previous in vitro and in vivo models of pigs have clarified that miR-130b overexpression can obviously suppress adipogenesis of subcutaneous preadipocytes and lower backfat thickness. However, the way miR-130b regulates proliferation and adipogenesis of primary cultured porcine intramuscular preadipocytes (PIMPA) and the underlying mechanism are still unknown. PIMPA derived from longissimus dorsi muscle were employed to examine the role of miR-130b in proliferation and adipogenesis and to further elucidate its underlying mechanism. Lipid deposition in cytoplasm was evaluated by TG quantification and ORO-staining, and EDU-staining was employed to measure cell proliferation. Adipogenic and proliferation-related gene expression were conducted by qPCR and Western blot. MiR-130b overexpression markedly stimulated proliferation of PIMPA by increasing cell cycle-related gene expression. Furthermore, overexpression of miR-130b significantly inhibited adipogenic differentiation of PIMPA, mainly by inhibiting expression of adipogenic differentiation marker genes PPAR-γ and SREBP1. In addition, we proved that miR-130b significantly inhibited expression of PPAR-γ downstream target genes and ultimately repressed adipogenesis. Ssc-miR-130b accelerated proliferation but inhibited adipogenic differentiation of PIMPA, contributing to an enhanced knowledge of the function of ssc-miR-130b in lipid deposition, and providing potential implications for enhancing pork quality. Full article

Understanding the resistance mechanisms of plants against pests contributes to the sustainable deployment of plant resistance in Integrated Pest Management (IPM) programmes. The Mi-1 gene in tomato is the only one described with the capacity to provide resistance to different types of harmful organisms such as plant parasitic nematodes and pest insects, including the whitefly Bemisia tabaci MED (Mediterranean species). In this work, gene expression in the interaction of B. tabaci with susceptible tomato plants lacking the Mi-1 gene (cv. Moneymaker, compatible interaction), and with resistant plants carrying the Mi-1 gene (cv. Motelle, incompatible interaction) was studied using the oligonucleotide microarray technique. Both interactions were studied 2 and 12 days post infestation (dpi) of plants with adult insects. At 2 dpi, 159 overexpressed and 189 repressed transcripts were detected in the incompatible interaction, while these figures were 32 and 47 in the compatible one. Transcriptional reprogramming was more intense at 12 dpi but, as at 2 dpi, the number of transcripts overexpressed and repressed was higher in the incompatible (595 and 437, respectively) than in the compatible (71 and 52, respectively) interaction. According to the Mapman classification, these transcripts corresponded mainly to genes in the protein and RNA categories, some of which are involved in the defence response (signalling, respiratory burst, regulation of transcription, PRs, HSPs, cell wall or hormone signalling). These results provide a wealth of information about possible genes related to the resistance provided by the Mi-1 gene to B. tabaci, and whose role deserves further investigation. Full article

MicroRNAs (miRNAs) are ~22-nucleotide small non-coding RNAs that play critical roles in gene regulation. The discovery of miRNAs in Caenorhabditis elegans in 1993 by the research groups of Victor Ambros and Gary Ruvkun opened a new era in RNA research. Typically, miRNAs act as negative regulators of gene expression by binding to complementary sequences within the 3′ untranslated regions of their target mRNAs. This interaction results in translational repression and/or target destabilization. The expression levels and activities of miRNAs are fine-tuned by multiple factors, including the miRNA biogenesis pathway, variability in target recognition, super-enhancers, post-transcriptional modifications, and target-directed miRNA degradation. Together, these factors form complex mechanisms that govern gene regulation and underlie several pathological conditions, including Argonaute syndrome, genetic diseases driven by super-enhancer-associated miRNAs, and miRNA-deadenylation-associated bone marrow failure syndromes. In addition, as miRNA genes have evolved rapidly in vertebrates, miRNA regulation in the brain is characterized by several unique features. In this review, we summarize recent insights into the role of miRNAs in human diseases, focusing on miRNA biogenesis; regulatory mechanisms, such as super-enhancers; and the impact of post-transcriptional modifications. By exploring these mechanisms, we highlight the intricate and multifaceted roles of miRNAs in health and disease. Full article

In plants, microRNAs (miRNAs) and their target genes have been demonstrated to form an essential component of the molecular response to salt stress. In Arabidopsis thaliana (Arabidopsis), DOUBLE-STRANDED RNA BINDING1 (DRB1) and DRB2 are required to produce specific miRNA populations throughout normal development and in response to abiotic stress. The phenotypic and physiological assessment of 15-day-old wild-type Arabidopsis seedlings, and of the drb1 and drb2 mutants following a 7-day period of salt stress, revealed the drb2 mutant to be more sensitive to salt stress than the drb1 mutant. However, the assessment of miRNA abundance and miRNA target gene expression showed that the ability of both drb mutants to mount an appropriate miRNA-mediated molecular response to salt stress is defective. Furthermore, molecular profiling also showed that DRB1 and DRB2 are both required for miRNA production during salt stress, and that both a target transcript cleavage mode and a translational repression mode of RNA silencing are required to appropriately regulate miRNA target gene expression as part of the molecular response of Arabidopsis to salt stress. Taken together, the phenotypic, physiological, and molecular analyses performed here clearly show that all components of the miRNA pathway must be fully functional for Arabidopsis to mount an appropriate miRNA-mediated molecular response to salt stress. Full article

Garden dahlias (Dahlia pinnata) are popular for their rich flower color variations that have produced many typical bicolor cultivars. Previous studies on the anthocyanin biosynthetic pathway (ABP) observed that the miR156-SPL9 module contributes to the formation of white tips on dahlia petals by repressing the MYB-bHLH-WDR complex. In this study, we further detected the potential post-transcriptional regulation involved in the bicolor petal formation by the small RNA sequencing of red bases and white tips. Compared with red bases, 89 differentially expressed miRNAs and 6349 target genes were identified. And 78 up-regulated miRNAs with their 249 down-regulated target genes were involved in the formation process of white petal tips. The target genes of differentially expressed miRNAs significantly enriched in the ABPs and miRNAs of six conserved families (MIR 156, 164, 167, 169, 482 and 6114) targeted to four transcription factor families (ARF, HD-ZIP, SBP and NAC) were involved in the post-transcriptional gene silencing (PTGS) of the ABP. Transcription sequencing and quantitative reverse transcription PCR analysis demonstrated that the MIR167-ARF8 module and the MIR6114-ANL2 module were the candidate regulators of the inactive ABP in the white tips by depressing the transcription of multiple structure genes. The findings gave new insights into the post-transcriptional regulation of the ABP and would be valuable for further studies of the PTGS mechanisms of bicolor petal formation. Full article

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1. Full article

Background/Objectives: CSCs are critical drivers of the tumor and stem cell phenotypes of glioblastoma (GBM) cells. Chromatin modifications play a fundamental role in driving a GBM CSC phenotype. The goal of this study is to further our understanding of how stem cell-driving events control changes in chromatin architecture that contribute to the tumor-propagating phenotype of GBM. Methods: We utilized computational analyses to identify a subset of clinically relevant genes that were predicted to be repressed in a Polycomb repressive complex 2 (PRC2)-dependent manner in GBM upon induction of stem cell-driving events. These associations were validated in patient-derived GBM neurosphere models using state-of-the-art molecular techniques to express, silence, and measure microRNA (miRNA) and gene expression changes. Advanced Poly(β-amino ester) nanoparticle formulations (PBAEs) were used to deliver miRNAs in vivo to orthotopic human GBM tumor models. Results: We show that glioma stem cell (GSC) formation and tumor propagation involve the crosstalk between multiple epigenetic mechanisms, resulting in the repression of the miRNAs that regulate PRC2 function and histone H3 lysine 27 tri-methylation (H3K27me3). We also identified miR-217-5p as an EZH2 regulator repressed in GSCs and showed that miR-217-5p reconstitution using advanced nanoparticle formulations re-activates the PRC2-repressed genes, inhibits GSC formation, impairs tumor growth, and enhances the effects of ionizing radiation in an orthotopic model of GBM. Conclusions: These findings suggest that inhibiting PRC2 function by targeting EZH2 with miR-217-5p advanced nanoparticle formulations could have a therapeutic benefit in GBM. Full article

Spinal cord injury (SCI) results in a cascade of primary and secondary damage, with apoptosis being a prominent cause of neuronal cell death. The X-linked inhibitor of apoptosis (XIAP) plays a critical role in inhibiting apoptosis, but its expression is reduced following SCI, contributing to increased neuronal vulnerability. This study investigates the regulatory role of miR-199a-5p on XIAP expression in the context of SCI. Using bioinformatic tools, luciferase reporter assays, and in vitro and in vivo models of SCI, we identified miR-199a-5p as a post-transcriptional regulator of XIAP. Overexpression of miR-199a-5p significantly reduced XIAP protein levels, although no changes were observed at the mRNA level, suggesting translational repression. In vivo, miR-199a-5p expression was upregulated at 3 and 7 days post-injury, while XIAP expression inversely decreased in both neurons and oligodendrocytes, being particularly significant in the latter at 7 dpi. These findings suggest that miR-199a-5p contributes to the downregulation of XIAP and may exacerbate neuronal apoptosis after SCI. Targeting miR-199a-5p could offer a potential therapeutic strategy to modulate XIAP levels and reduce apoptotic cell death in SCI. Full article

Background: Long non-coding RNAs (lncRNAs) are pivotal mediators during the development of carcinomas; however, it remains to be investigated whether lncRNAs are implicated in oral squamous cell carcinoma (OSCC). Methods: In this study, quantitative real-time PCR was conducted for detecting the expression of LINC01614 in OSCC cell lines. The biological functions of LINC01614 were assessed by loss- and gain-of-function experiments conducted both in vivo and in vitro. Cellular proliferation, migration, and invasion were investigated herein, and dual luciferase reporter assays were additionally performed to explore the relationships among LINC01614, miR-138-5p, and Forkhead box C1 (FOXC1). Results: The research presented herein revealed that OSCC cells express high levels of LINC01614. Functional experiments employing cellular and animal models demonstrated that LINC01614 knockdown repressed the malignant phenotypes of OSCC cells, including their growth, invasiveness, and migration. Further investigation revealed that LINC01614 absorbs miR-138-5p miRNA by functioning as a competing endogenous RNA to downregulate the abundance of FOXC1. Conclusions: The findings revealed that LINC01614 contributes to the progression of OSCC by targeting the FOXC1 signaling pathway. The study provides insights into a novel mechanistic process to regulate the development of OSCC, and established a possible target for the therapeutic management of OSCC. Full article

Bamboo plants have erratic flowering habits with a long vegetative growth and an uncertain flowering cycle. The process of floral transition has always been one of the hot and intriguing topics in bamboo developmental biology. As master modulators of gene expression at the post-transcriptional level, miRNAs play a crucial role in regulating reproductive growth, especially in floral transition of flowering plants. Pleioblastus pygmaeus is a kind of excellent ground cover ornamental bamboo species. In this study, we performed miRNA expression profiling of the shoot buds and flower buds from the bamboo species, to investigate flowering-related miRNAs in bamboo plants. A total of 179 mature miRNAs were identified from P. pygmaeus, including 120 known miRNAs and 59 novel miRNAs, of which 96 (61 known miRNAs and 35 novel miRNAs) were differentially expressed in the shoots at different growth stages. Based on target gene (TG) prediction, a total of 2099 transcription factors (TFs) were annotated to be TGs of the 96 differentially expressed miRNAs (DEMs), corresponding to 839 recordings of DEM-TF pairs. In addition, we identified 23 known DEMs involved in flowering and six known miRNAs related to floral organ development based on previous reports. Among these, there were 11 significantly differentially expressed miRNAs, with 124 TF targets corresponding to 132 DEM-TF pairs in P. pygmaeus. In particular, we focused on the identification of miR156a-SPL (SQUAMOSA Promoter-Binding protein-Like) modules in the age pathway, which are well-known to regulate the vegetative-to-reproductive phase transition in flowering plants. A total of 36 TF targets of miR156a were identified, among which there were 11 SPLs. The Dual-Luciferase transient expression assay indicated miR156a mediated the repression of the PpSPL targets in P. pygmaeus. The integrated analysis of miRNAs and TGs at genome scale in this study provides insight into the essential roles of individual miRNAs in modulating flowering transition through regulating TF targets in bamboo plants. Full article

MicroRNAs (miRNAs) are small, non-coding RNAs that control gene expression by degrading or repressing mRNA translation into proteins. Research recently suggested that food-derived miRNAs are bioavailable and may be absorbed in the gastrointestinal tract (GIT). Since these small RNAs may reach the circulation and organs, possible interactions with host genes will lead to epigenetic effects that alter metabolism. Therefore, from a precision nutrition standpoint, exogenous miRNAs may be essential in modulating health status. This review summarizes the process of miRNA biogenesis, the post-translational mechanisms of gene regulation, and their bioavailability in animal- and plant-derived foods. Full article

Angiogenesis, the formation of new blood vessels from pre-existing ones, is a crucial process in the progression and metastasis of melanoma. Recent research has highlighted the significant role of epigenetic modifications in regulating angiogenesis. This review comprehensively examines the current understanding of how epigenetic mechanisms, including DNA methylation, histone modifications, and non-coding RNAs, influence angiogenic pathways in melanoma. DNA methylation, a key epigenetic modification, can silence angiogenesis inhibitors such as thrombospondin-1 and TIMP3 while promoting pro-angiogenic factors like vascular endothelial growth factor (VEGF). Histone modifications, including methylation and acetylation, also play a pivotal role in regulating the expression of angiogenesis-related genes. For instance, the acetylation of histones H3 and H4 is associated with the upregulation of pro-angiogenic genes, whereas histone methylation patterns can either enhance or repress angiogenic signals, depending on the specific histone mark and context. Non-coding RNAs, particularly microRNAs (miRNAs) further modulate angiogenesis. miRNAs, such as miR-210, have been identified as key regulators, with miR-9 promoting angiogenesis by targeting E-cadherin and enhancing the expression of VEGF. This review also discusses the therapeutic potential of targeting epigenetic modifications to inhibit angiogenesis in melanoma. Epigenetic drugs, such as DNA methyltransferase inhibitors (e.g., 5-azacytidine) and histone deacetylase inhibitors (e.g., Vorinostat), have shown promise in preclinical models by reactivating angiogenesis inhibitors and downregulating pro-angiogenic factors. Moreover, the modulation of miRNAs and lncRNAs presents a novel approach for anti-angiogenic therapy. Full article

Parkinson’s disease (PD) is a common neurodegenerative disorder characterized by symptoms such as bradykinesia, resting tremor, and rigidity, primarily driven by the degradation of dopaminergic (DA) neurons in the substantia nigra. A significant contributor to familial autosomal dominant PD cases is mutations in the LRRK2 gene, making it a primary therapeutic target. This study explores the role of microRNAs (miRNAs) in regulating the proteomic stress responses associated with neurodegeneration in PD using C. elegans models. Our focus is on miR-71, a miRNA known to affect stress resistance and act as a pro-longevity factor in C. elegans. We investigated miR-71’s function in C. elegans models of PD, where mutant LRRK2 expression correlates with dopaminergic neuronal death. Our findings reveal that miR-71 overexpression rescues motility defects and slows dopaminergic neurodegeneration in these models, suggesting its critical role in mitigating the proteotoxic effects of mutant LRRK2. Conversely, miR-71 knockout exacerbates neuronal death caused by mutant LRRK2. Additionally, our data indicate that miR-71’s neuroprotective effect involves downregulating the toll receptor domain protein tir-1, implicating miR-71 repression of tir-1 as vital in the response to LRRK2-induced proteotoxicity. These insights into miR-71’s role in C. elegans models of PD not only enhance our understanding of molecular mechanisms in neurodegeneration but also pave the way for potential research into human neurodegenerative diseases, leveraging the conservation of miRNAs and their targets across species. Full article