The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Histopathology
2.3. DNA/RNA Extraction and Real-Time PCR (RT-PCR)
2.4. Sequencing
2.5. Statistical Analysis
3. Results
3.1. Macroscopical Findings
3.2. Histological Findings
3.2.1. Adult Pigs
3.2.2. Post-Weaning Pigs
3.2.3. Piglets
3.3. Real-Time PCR Results
3.3.1. Adult Pigs
3.3.2. Post-Weaning Pigs
3.3.3. Piglets
3.4. Sequencing
3.5. Statistical Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sarli, G.; D’annunzio, G.; Gobbo, F.; Benazzi, C.; Ostanello, F. The Role of Pathology in the Diagnosis of Swine Respiratory Disease. Vet. Sci. 2021, 8, 256. [Google Scholar] [CrossRef]
- Ruggeri, J.; Salogni, C.; Giovannini, S.; Vitale, N.; Boniotti, M.B.; Corradi, A.; Pozzi, P.; Pasquali, P.; Alborali, G.L. Association Between Infectious Agents and Lesions in Post-Weaned Piglets and Fattening Heavy Pigs with Porcine Respiratory Disease Complex (PRDC). Front. Vet. Sci. 2020, 7, 636. [Google Scholar] [CrossRef]
- Opriessnig, T.; Shen, H.G.; Pal, N.; Ramamoorthy, S.; Huang, Y.W.; Lager, K.M.; Beach, N.M.; Halbur, P.G.; Meng, X.J. A Live-Attenuated Chimeric Porcine Circovirus Type 2 (PCV2) Vaccine Is Transmitted to Contact Pigs but Is Not Upregulated by Concurrent Infection with Porcine Parvovirus (PPV) and Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) and Is Efficacious in a PCV2b-PRRSV-PPV Challenge Model. Clin. Vaccine Immunol. 2011, 18, 1261–1268. [Google Scholar] [CrossRef]
- Brockmeier, S.L.; Halbur, P.G.; Thacker, E.L. Porcine Respiratory Disease Complex. In Polymicrobial Diseases; John Wiley & Sons, Ltd.: Hoboken, NJ, USA, 2002; pp. 231–258. ISBN 978-1-68367-232-6. [Google Scholar]
- Paz-Sánchez, Y.; Herráez, P.; Quesada-Canales; Poveda, C.G.; Díaz-Delgado, J.; Quintana-Montesdeoca, M.d.P.; Stefanova, E.P.; Andrada, M. Assessment of Lung Disease in Finishing Pigs at Slaughter: Pulmonary Lesions and Implications on Productivity Parameters. Animals 2021, 11, 3604. [Google Scholar] [CrossRef]
- Arenales, A.; Santana, C.; Rolim, A.; Pereira, E.; Nascimento, E.; Paixão, T.; Santos, R. Histopathologic Patterns and Etiologic Diagnosis of Porcine Respiratory Disease Complex in Brazil. Arq. Bras. Med. Veterinária Zootec. 2022, 74, 497–508. [Google Scholar] [CrossRef]
- Saade, G.; Deblanc, C.; Bougon, J.; Marois-Créhan, C.; Fablet, C.; Auray, G.; Belloc, C.; Leblanc-Maridor, M.; Gagnon, C.A.; Zhu, J.; et al. Coinfections and Their Molecular Consequences in the Porcine Respiratory. Vet. Res. 2020, 51, 80. [Google Scholar] [CrossRef]
- Kumar, N.; Sharma, S.; Barua, S.; Tripathi, B.N.; Rouse, B.T. Virological and Immunological Outcomes of Coinfections. Clin. Microbiol. Rev. 2018, 31, e00111-17. [Google Scholar] [CrossRef]
- Qin, S.; Ruan, W.; Yue, H.; Tang, C.; Zhou, K.; Zhang, B. Viral Communities Associated with Porcine Respiratory Disease Complex in Intensive Commercial Farms in Sichuan Province, China. Sci. Rep. 2018, 8, 13341. [Google Scholar] [CrossRef]
- Perfumo, C.J.; Pereda, A.; Jongkaewwattana, A.; Chen, Z.; Perez, D.R.; Ma, J. Editorial: Emerging Swine Viruses. Front. Vet. Sci. 2020, 7, 132. [Google Scholar] [CrossRef]
- Meng, X.J. Emerging and Re-Emerging Swine Viruses. Transbound. Emerg. Dis. 2012, 59 (Suppl. S1), 85–102. [Google Scholar] [CrossRef]
- Lunney, J.K.; Fang, Y.; Ladinig, A.; Chen, N.; Li, Y.; Rowland, B.; Renukaradhya, G.J. Porcine Reproductive and Respiratory Syndrome Virus (PRRSV): Pathogenesis and Interaction with the Immune System. Annu. Rev. Anim. Biosci. 2016, 4, 129–154. [Google Scholar] [CrossRef] [PubMed]
- Ouyang, T.; Zhang, X.; Liu, X.; Ren, L. Co-Infection of Swine with Porcine Circovirus Type 2 and Other Swine Viruses. Viruses 2019, 11, 185. [Google Scholar] [CrossRef] [PubMed]
- Trovato, M.; Sartorius, R.; D’apice, L.; Manco, R.; De Berardinis, P. Viral Emerging Diseases: Challenges in Developing Vaccination Strategies. Front. Immunol. 2020, 11, 2130. [Google Scholar] [CrossRef] [PubMed]
- Leary, T.P.; Erker, J.C.; Chalmers, M.L.; Desai, S.M.; Mushahwar, I.K. Improved Detection Systems for TT Virus Reveal High Prevalence in Humans, Non-Human Primates and Farm Animals. J. Gen. Virol. 1999, 80 Pt 8, 2115–2120. [Google Scholar] [CrossRef]
- Okamoto, H.; Takahashi, M.; Nishizawa, T.; Tawara, A.; Fukai, K.; Muramatsu, U.; Naito, Y.; Yoshikawa, A. Genomic Characterization of TT Viruses (TTVs) in Pigs, Cats and Dogs and Their Relatedness with Species-Specific TTVs in Primates and Tupaias. J. Gen. Virol. 2002, 83, 1291–1297. [Google Scholar] [CrossRef]
- Manzin, A.; Mallus, F.; Macera, L.; Maggi, F.; Blois, S. Global Impact of Torque Teno Virus Infection in Wild and Domesticated Animals. J. Infect. Dev. Ctries. 2015, 9, 562–570. [Google Scholar] [CrossRef]
- Kekarainen, T.; Segalés, J. Torque Teno Sus Virus in Pigs: An Emerging Pathogen? Transbound. Emerg. Dis. 2012, 59 (Suppl. S1), 103–108. [Google Scholar] [CrossRef]
- Vargas-Ruiz, A.; Ramírez-Álvarez, H.; Sánchez-Betancourt, J.I.; Quintero-Ramírez, V.; Rangel-Rodríguez, I.C.; Vázquez-Perez, J.A.; García-Camacho, L.A. Retrospective Study of the Relationship of Torque Teno Sus Virus 1a and Torque Teno Sus Virus 1b with Porcine Circovirus Associated Disease. Can. J. Vet. Res. 2017, 81, 178–185. [Google Scholar]
- Kekarainen, T.; López-Soria, S.; Segalés, J. Detection of Swine Torque Teno Virus Genogroups 1 and 2 in Boar Sera and Semen. Theriogenology 2007, 68, 966–971. [Google Scholar] [CrossRef]
- Cortey, M.; Pileri, E.; Segalés, J.; Kekarainen, T. Globalisation and Global Trade Influence Molecular Viral Population Genetics of Torque Teno Sus Viruses 1 and 2 in Pigs. Vet. Microbiol. 2012, 156, 81–87. [Google Scholar] [CrossRef]
- Cadar, D.; Kiss, T.; Ádám, D.; Cságola, A.; Novosel, D.; Tuboly, T. Phylogeny, Spatio-Temporal Phylodynamics and Evolutionary Scenario of Torque Teno Sus Virus 1 (TTSuV1) and 2 (TTSuV2) in Wild Boars: Fast Dispersal and High Genetic Diversity. Vet. Microbiol. 2013, 166, 200–213. [Google Scholar] [CrossRef]
- Polster, S.; Lechmann, J.; Lienhard, J.; Peltzer, D.; Prähauser, B.; Bachofen, C.; Seehusen, F. First Report of TTSuV1 in Domestic Swiss Pigs. Viruses 2022, 14, 870. [Google Scholar] [CrossRef]
- Webb, B.; Rakibuzzaman, A.; Ramamoorthy, S. Torque Teno Viruses in Health and Disease. Virus Res. 2020, 285, 198013. [Google Scholar] [CrossRef]
- Krakowka, S.; Ellis, J.A. Evaluation of the Effects of Porcine Genogroup 1 Torque Teno Virus in Gnotobiotic Swine. Am. J. Vet. Res 2008, 69, 1623–1629. [Google Scholar] [CrossRef]
- Mei, M.; Zhu, L.; Wang, Y.; Xu, Z.; Zhao, L.; Peng, X.; Wu, Y.; Li, S.; Guo, W. Histopathological Investigation in Porcine Infected with Torque Teno Sus Virus Type 2 by Inoculation. Virol. J. 2011, 8, 545. [Google Scholar] [CrossRef]
- Nelsen, A.; Lin, C.-M.; Hause, B.M. Porcine Parvovirus 2 Is Predominantly Associated with Macrophages in Porcine Respiratory Disease Complex. Front. Vet. Sci. 2021, 8, 726884. [Google Scholar] [CrossRef]
- Palinski, R.; Piñeyro, P.; Shang, P.; Yuan, F.; Guo, R.; Fang, Y.; Byers, E.; Hause, B.M. A Novel Porcine Circovirus Distantly Related to Known Circoviruses Is Associated with Porcine Dermatitis and Nephropathy Syndrome and Reproductive Failure. J. Virol. 2017, 91, e01879-16. [Google Scholar] [CrossRef]
- Jiang, H.; Wang, D.; Wang, J.; Zhu, S.; She, R.; Ren, X.; Tian, J.; Quan, R.; Hou, L.; Li, Z.; et al. Induction of Porcine Dermatitis and Nephropathy Syndrome in Piglets by Infection with Porcine Circovirus Type 3. J. Virol. 2019, 93, e02045-18. [Google Scholar] [CrossRef]
- Arruda, B.; Piñeyro, P.; Derscheid, R.; Hause, B.; Byers, E.; Dion, K.; Long, D.; Sievers, C.; Tangen, J.; Williams, T.; et al. PCV3-Associated Disease in the United States Swine Herd. Emerg. Microbes Infect. 2019, 8, 684–698. [Google Scholar] [CrossRef]
- Jiang, H.; Wei, L.; Wang, D.; Wang, J.; Zhu, S.; She, R.; Liu, T.; Tian, J.; Quan, R.; Hou, L.; et al. ITRAQ-Based Quantitative Proteomics Reveals the First Proteome Profiles of Piglets Infected with Porcine Circovirus Type 3. J. Proteom. 2020, 212, 103598. [Google Scholar] [CrossRef]
- Mora-Díaz, J.; Piñeyro, P.; Shen, H.; Schwartz, K.; Vannucci, F.; Li, G.; Arruda, B.; Giménez-Lirola, L. Isolation of PCV3 from Perinatal and Reproductive Cases of PCV3-Associated Disease and In Vivo Characterization of PCV3 Replication in CD/CD Growing Pigs. Viruses 2020, 12, 219. [Google Scholar] [CrossRef]
- Chen, S.; Zhang, L.; Li, X.; Niu, G.; Ren, L. Recent Progress on Epidemiology and Pathobiology of Porcine Circovirus 3. Viruses 2021, 13, 1944. [Google Scholar] [CrossRef]
- Franzo, G.; Delwart, E.; Fux, R.; Hause, B.; Su, S.; Zhou, J.; Segalés, J. Genotyping Porcine Circovirus 3 (PCV-3) Nowadays: Does It Make Sense? Viruses 2020, 12, 265. [Google Scholar] [CrossRef]
- De Conti, E.R.; Resende, T.P.; Marshall-Lund, L.; Rovira, A.; Vannucci, F.A. Histological Lesions and Replication Sites of PCV3 in Naturally Infected Pigs. Animals 2021, 11, 1520. [Google Scholar] [CrossRef]
- Wen, S.; Song, Y.; Lv, X.; Meng, X.; Liu, K.; Yang, J.; Diao, F.; He, J.; Huo, X.; Chen, Z.; et al. Detection and Molecular Characterization of Porcine Parvovirus 7 in Eastern Inner Mongolia Autonomous Region, China. Front. Vet. Sci. 2022, 9, 930123. [Google Scholar] [CrossRef]
- Xie, C.; Tao, Y.; Zhang, Y.; Zhang, P.; Zhu, X.; Ha, Z.; Zhang, H.; Xie, Y.; Xia, X.; Jin, N.; et al. Codon Usage for Genetic Diversity, and Evolutionary Dynamics of Novel Porcine Parvoviruses 2 through 7 (PPV2-PPV7). Viruses 2022, 14, 170. [Google Scholar] [CrossRef]
- Lagan Tregaskis, P.; Staines, A.; Gordon, A.; Sheridan, P.; McMenamy, M.; Duffy, C.; Collins, P.J.; Mooney, M.H.; Lemon, K. Co-Infection Status of Novel Parvovirus’s (PPV2 to 4) with Porcine Circovirus 2 in Porcine Respiratory Disease Complex and Porcine Circovirus-Associated Disease from 1997 to 2012. Transbound Emerg. Dis. 2021, 68, 1979–1994. [Google Scholar] [CrossRef]
- Blomström, A.-L.; Belák, S.; Fossum, C.; McKillen, J.; Allan, G.; Wallgren, P.; Berg, M. Detection of a Novel Porcine Boca-like Virus in the Background of Porcine Circovirus Type 2 Induced Postweaning Multisystemic Wasting Syndrome. Virus Res. 2009, 146, 125–129. [Google Scholar] [CrossRef]
- Gunn, L.; Collins, P.J.; Fanning, S.; McKillen, J.; Morgan, J.; Staines, A.; O’Shea, H. Detection and Characterisation of Novel Bocavirus (Genus Bocaparvovirus) and Gastroenteritis Viruses from Asymptomatic Pigs in Ireland. Infect. Ecol. Epidemiol. 2015, 5, 27270. [Google Scholar] [CrossRef][Green Version]
- Dei Giudici, S.; Franzoni, G.; Bonelli, P.; Angioi, P.P.; Zinellu, S.; Deriu, V.; Carta, T.; Sechi, A.M.; Salis, F.; Balzano, F.; et al. Genetic Characterization of Porcine Circovirus 3 Strains Circulating in Sardinian Pigs and Wild Boars. Pathogens 2020, 9, 344. [Google Scholar] [CrossRef]
- Opriessnig, T.; Yu, S.; Gallup, J.M.; Evans, R.B.; Fenaux, M.; Pallares, F.; Thacker, E.L.; Brockus, C.W.; Ackermann, M.R.; Thomas, P.; et al. Effect of Vaccination with Selective Bacterins on Conventional Pigs Infected with Type 2 Porcine Circovirus. Vet. Pathol. 2003, 40, 521–529. [Google Scholar] [CrossRef]
- Franzo, G.; Legnardi, M.; Centelleghe, C.; Tucciarone, C.M.; Cecchinato, M.; Cortey, M.; Segalés, J.; Drigo, M. Development and Validation of Direct PCR and Quantitative PCR Assays for the Rapid, Sensitive, and Economical Detection of Porcine Circovirus 3. J. Vet. Diagn. Investig. 2018, 30, 538–544. [Google Scholar] [CrossRef] [PubMed]
- Brassard, J.; Gagné, M.-J.; Houde, A.; Poitras, E.; Ward, P. Development of a Real-Time TaqMan PCR Assay for the Detection of Porcine and Bovine Torque Teno Virus. J. Appl. Microbiol. 2010, 108, 2191–2198. [Google Scholar] [CrossRef]
- Novosel, D.; Cadar, D.; Tuboly, T.; Jungic, A.; Stadejek, T.; Ait-Ali, T.; Cságola, A. Investigating Porcine Parvoviruses Genogroup 2 Infection Using in Situ Polymerase Chain Reaction. BMC Vet. Res. 2018, 14, 163. [Google Scholar] [CrossRef]
- Xiao, C.T.; Gerber, P.F.; Giménez-Lirola, L.G.; Halbur, P.G.; Opriessnig, T. Characterization of Porcine Parvovirus Type 2 (PPV2) Which Is Highly Prevalent in the USA. Vet. Microbiol. 2013, 161, 325–330. [Google Scholar] [CrossRef]
- Blois, S.; Mallus, F.; Liciardi, M.; Pilo, C.; Camboni, T.; Macera, L.; Maggi, F.; Manzin, A. High Prevalence of Co-Infection with Multiple Torque Teno Sus Virus Species in Italian Pig Herds. PLoS ONE 2014, 9, e113720. [Google Scholar] [CrossRef]
- Oleksiewicz, M.B.; Botner, A.; Madsen, K.G.; Storgaard, T. Sensitive detection and typing of porcine reproductive and respiratory syndrome virus by RT-PCR amplification of whole viral genes. Vet. Microbiol. 1998, 64, 7–22. [Google Scholar] [CrossRef]
- Hawko, S.; Burrai, G.P.; Polinas, M.; Angioi, P.P.; Dei Giudici, S.; Oggiano, A.; Alberti, A.; Hosri, C.; Antuofermo, E. A Review on Pathological and Diagnostic Aspects of Emerging Viruses-Senecavirus A, Torque Teno Sus Virus and Linda Virus-In Swine. Vet. Sci. 2022, 9, 495. [Google Scholar] [CrossRef]
- Woźniak, A.; Miłek, D.; Matyba, P.; Stadejek, T. Real-Time PCR Detection Patterns of Porcine Circovirus Type 2 (PCV2) in Polish Farms with Different Statuses of Vaccination against PCV2. Viruses 2019, 11, 1135. [Google Scholar] [CrossRef]
- Guo, L.; Fu, Y.; Wang, Y.; Lu, Y.; Wei, Y.; Tang, Q.; Fan, P.; Liu, J.; Zhang, L.; Zhang, F.; et al. A Porcine Circovirus Type 2 (PCV2) Mutant with 234 Amino Acids in Capsid Protein Showed More Virulence in Vivo, Compared with Classical PCV2a/b Strain. PLoS ONE 2012, 7, e41463. [Google Scholar] [CrossRef]
- Eddicks, M.; Fux, R.; Szikora, F.; Eddicks, L.; Majzoub-Altweck, M.; Hermanns, W.; Sutter, G.; Palzer, A.; Banholzer, E.; Ritzmann, M. Detection of a New Cluster of Porcine Circovirus Type 2b Strains in Domestic Pigs in Germany. Vet. Microbiol. 2015, 176, 337–343. [Google Scholar] [CrossRef] [PubMed]
- Seo, H.W.; Park, C.; Kang, I.; Choi, K.; Jeong, J.; Park, S.-J.; Chae, C. Genetic and Antigenic Characterization of a Newly Emerging Porcine Circovirus Type 2b Mutant First Isolated in Cases of Vaccine Failure in Korea. Arch. Virol 2014, 159, 3107–3111. [Google Scholar] [CrossRef] [PubMed]
- Xiao, C.T.; Halbur, P.G.; Opriessnig, T. Complete genome sequence of a novel porcine circovirus type 2b variant present in cases of vaccine failures in the United States. J. Virol. 2012, 86, 12469–12473. [Google Scholar] [CrossRef] [PubMed]
- Segalés, J. Porcine Circovirus Type 2 (PCV2) Infections: Clinical Signs, Pathology and Laboratory Diagnosis. Virus Res. 2012, 164, 10–19. [Google Scholar] [CrossRef] [PubMed]
- Klaumann, F.; Correa-Fiz, F.; Sibila, M.; Núñez, J.I.; Segalés, J. Infection Dynamics of Porcine Circovirus Type 3 in Longitudinally Sampled Pigs from Four Spanish Farms. Vet. Rec. 2019, 184, 619. [Google Scholar] [CrossRef] [PubMed]
- Klaumann, F.; Correa-Fiz, F.; Franzo, G.; Sibila, M.; Núñez, J.I.; Segalés, J. Current Knowledge on Porcine Circovirus 3 (PCV-3): A Novel Virus with a Yet Unknown Impact on the Swine Industry. Front. Vet. Sci. 2018, 5, 315. [Google Scholar] [CrossRef] [PubMed]
- Sirisereewan, C.; Thanawongnuwech, R.; Kedkovid, R. Current Understanding of the Pathogenesis of Porcine Circovirus 3. Pathogens 2022, 11, 64. [Google Scholar] [CrossRef]
- Aramouni, M.; Segalés, J.; Sibila, M.; Martin-Valls, G.E.; Nieto, D.; Kekarainen, T. Torque Teno Sus Virus 1 and 2 Viral Loads in Postweaning Multisystemic Wasting Syndrome (PMWS) and Porcine Dermatitis and Nephropathy Syndrome (PDNS) Affected Pigs. Vet. Microbiol. 2011, 153, 377–381. [Google Scholar] [CrossRef]
- Sibila, M.; Martínez-Guinó, L.; Huerta, E.; Mora, M.; Grau-Roma, L.; Kekarainen, T.; Segalés, J. Torque Teno Virus (TTV) Infection in Sows and Suckling Piglets. Vet. Microbiol. 2009, 137, 354–358. [Google Scholar] [CrossRef]
- Li, G.; Zhang, W.; Wang, R.; Xing, G.; Wang, S.; Ji, X.; Wang, N.; Su, S.; Zhou, J. Genetic Analysis and Evolutionary Changes of the Torque Teno Sus Virus. Int. J. Mol. Sci. 2019, 20, 2881. [Google Scholar] [CrossRef]
- Li, G.R.; Wang, R.Y.; Cai, Y.C.; Zhang, J.Y.; Zhao, W.; Gao, Q.; Franzo, G.; Su, S. Epidemiology and evolutionary analysis of Torque teno sus virus. Vet. Microbiol. 2020, 244, 108668. [Google Scholar] [CrossRef] [PubMed]
- Mei, M.; Zhu, L.; Xu, Z.; Zhao, L.; Zhou, Y.; Wu, Y.; Li, S.; Wei, H.; Guo, W. Molecular Investigation of Torque Teno Sus Virus in Geographically Distinct Porcine Breeding Herds of Sichuan, China. Virol. J. 2013, 10, 161. [Google Scholar] [CrossRef] [PubMed]
- Blomström, A.-L.; Belák, S.; Fossum, C.; Fuxler, L.; Wallgren, P.; Berg, M. Studies of Porcine Circovirus Type 2, Porcine Boca-like Virus and Torque Teno Virus Indicate the Presence of Multiple Viral Infections in Postweaning Multisystemic Wasting Syndrome Pigs. Virus Res. 2010, 152, 59–64. [Google Scholar] [CrossRef] [PubMed]
- Kekarainen, T.; Sibila, M.; Segalés, J. Prevalence of Swine Torque Teno Virus in Post-Weaning Multisystemic Wasting Syndrome (PMWS)-Affected and Non-PMWS-Affected Pigs in Spain. J. Gen. Virol. 2006, 87, 833–837. [Google Scholar] [CrossRef]
- Kim, S.-C.; Kim, J.-H.; Kim, J.-Y.; Park, G.-S.; Jeong, C.-G.; Kim, W.-I. Prevalence of Porcine Parvovirus 1 through 7 (PPV1-PPV7) and Co-Factor Association with PCV2 and PRRSV in Korea. BMC Vet. Res. 2022, 18, 133. [Google Scholar] [CrossRef]
- Miłek, D.; Woźniak, A.; Guzowska, M.; Stadejek, T. Detection Patterns of Porcine Parvovirus (PPV) and Novel Porcine Parvoviruses 2 through 6 (PPV2-PPV6) in Polish Swine Farms. Viruses 2019, 11, 474. [Google Scholar] [CrossRef]
Virus | Primers and Probes | Sequence | Reference |
---|---|---|---|
PCV2 | P1570F | 5′-TGGCCCGCAGTATTCTGATT-3′ | Opriessnig et al., 2003 [42] |
P1642R | 5′-CAGCTGGGACAGCAGTTGAG-3′ | ||
P1591 probe | 5′-CCAGCAATCAGACCCCGTTGGAATG-3′ | ||
PCV3 | PCV3 _353F | 5′-TGACGGAGACGTCGGGAAAT-3′ | Franzo et al., 2018 [43] |
PCV3_465R | 5′-CGGTTTACCCAACCCCATCA-3′ | ||
PCV3_418probe | 5′-GGGCGGGGTTTGCGTGATTT-3′ | ||
TTSuV | QCOMF | 5′-CGAATGGYWGAGTTTWYGCCGC-3′ | Brassard et al., 2009 [44] |
QCOMR | 5′-GCCCGAATTGCCCCTWGACTKCG-3′ | ||
QCOM probe | 5′-CTCCGGCACCCGCCCAG-3′ | ||
PPV2 | PPV2DF | 5′-TACTGAGCCCTAAGACTGACTACAAGC-3′ | Xiao et al., 2013 [46] |
PPV2DR | 5′-GTTTGTCTCGTTGTTCGTCTGATG-3′ | ||
PPV2D probe | 5′-AACTGCTACATGAACCACTTTACCCCSTC-3′ |
Virus | Primer Sequence | Reference |
---|---|---|
PPV2 | PPV2-F6 GCTTTCTAGTCGGACCGGAAGT PPV2-R871 GCTCGGCCTTTCACGGTGGGC | Qin et al., 2018 [9] |
TTSuV | TTSuV1_F CGGGTTCAGGAGGCTCAAT TTSuV1_R GCCATTCGGAACTGCACTTACT TTSuV2_F TCATGACAGGGTTCACCGGA TTSuV2_R CGTCTGCGCACTTACTTATATACTCTA | Blois et al., 2014 [47] |
PRRSV | ORF7f 5′-GCCCCTGCCCAICACG-3′ ORF7r 5′-TCGCCCTAATTGAATAGGTGA-3′ | Oleksiewicz et al., 1998 [48] |
Virus | ||||||
---|---|---|---|---|---|---|
PCV3 | PPV2 | TTSuV | PRRSV | PCV2 | ||
Categories | ||||||
A | 1/10 | 10/10 | 10/10 | 2/10 | 10/10 | |
Mean Ct (±SD) range | 19.91 | 27.29 ± 1.12 24.7–28.64 | 25.38 ± 3.10 21.55–31.35 | 36.59 ± 0.41 36.3–36.89 | 27.22 ± 4.43 21.91–37.04 | |
PW | 2/10 | 5/0 | 10/10 | 2/10 | 3/10 | |
Mean Ct (±SD) range | 29.07 ± 12.15 20.48–37.66 | 21.21 ± 5.47 12.29–27.22 | 29.39 ± 2.98 25.89–35.33 | 34.30 ± 4.35 31.22–37.38 | 24.05 ± 9.7 17.49–35.19 | |
P | 4/9 | 8/9 | 9/9 | 3/9 | 2/9 | |
Mean Ct (±SD) range | 35.59 ± 4.88 28.47–39.18 | 23.06 ± 4.83 16.94–30.89 | 30.13 ± 5.32 24.58–40.18 | 37.38 ± 2.13 35.53–39.71 | 29.67 ± 8.84 23.41–35.92 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Burrai, G.P.; Hawko, S.; Dei Giudici, S.; Polinas, M.; Angioi, P.P.; Mura, L.; Alberti, A.; Hosri, C.; Hassoun, G.; Oggiano, A.; et al. The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis. Vet. Sci. 2023, 10, 595. https://doi.org/10.3390/vetsci10100595
Burrai GP, Hawko S, Dei Giudici S, Polinas M, Angioi PP, Mura L, Alberti A, Hosri C, Hassoun G, Oggiano A, et al. The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis. Veterinary Sciences. 2023; 10(10):595. https://doi.org/10.3390/vetsci10100595
Chicago/Turabian StyleBurrai, Giovanni Pietro, Salwa Hawko, Silvia Dei Giudici, Marta Polinas, Pier Paolo Angioi, Lorena Mura, Alberto Alberti, Chadi Hosri, Georges Hassoun, Annalisa Oggiano, and et al. 2023. "The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis" Veterinary Sciences 10, no. 10: 595. https://doi.org/10.3390/vetsci10100595
APA StyleBurrai, G. P., Hawko, S., Dei Giudici, S., Polinas, M., Angioi, P. P., Mura, L., Alberti, A., Hosri, C., Hassoun, G., Oggiano, A., & Antuofermo, E. (2023). The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis. Veterinary Sciences, 10(10), 595. https://doi.org/10.3390/vetsci10100595