Next Article in Journal
The Synergic Role of Emerging and Endemic Swine Virus in the Porcine Respiratory Disease Complex: Pathological and Biomolecular Analysis
Next Article in Special Issue
Bioactive Lipid Compounds as Eco-Friendly Agents in the Diets of Broiler Chicks for Sustainable Production and Health Status
Previous Article in Journal
Postoperative Computed Tomographic Assessment of the Complete Resection of an Infiltrative Lipoma Compressing the Spinal Cord in a Dog
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Impacts of Solid-State Fermented Barley with Fibrolytic Exogenous Enzymes on Feed Utilization, and Antioxidant Status of Broiler Chickens

by
Doaa Ibrahim
1,*,
Hassainen I. El-sayed
1,
Elsabbagh R. Mahmoud
1,
Ghada I. Abd El-Rahman
2,
Shefaa M. Bazeed
3,
Abdelwahab A. Abdelwarith
4,
Aya Elgamal
5,
Samah S. Khalil
6,
Elsayed M. Younis
4,
Asmaa T. Y. Kishawy
1,*,
Simon J. Davies
7 and
Abdallah E. Metwally
1
1
Department of Nutrition and Clinical Nutrition, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44519, Egypt
2
Department of Clinical Pathology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44519, Egypt
3
Department of Biochemistry and Chemistry of Nutrition, Faculty of Veterinary Medicine, Badr University in Cairo (BUC), Cairo P.O. Box 4942301, Egypt
4
Department of Zoology, College of Science, King Saud University, P.O. Box 2455, Riyadh 11451, Saudi Arabia
5
Department of Animal Histology and Anatomy, Faculty of Veterinary Medicine, Badr University in Cairo (BUC), Cairo P.O. Box 4942301, Egypt
6
Department of biochemistry, drug information center, Zagazig University Hospitals, Zagazig University, Zagazig P.O. Box 44511, Egypt
7
Aquaculture Nutrition Research Unit ANRU, Carna Research Station, Ryan Institute, College of Science and Engineering, University of Galway, H91 V8Y1 Galway, Ireland
*
Authors to whom correspondence should be addressed.
Vet. Sci. 2023, 10(10), 594; https://doi.org/10.3390/vetsci10100594
Submission received: 26 July 2023 / Revised: 20 September 2023 / Accepted: 21 September 2023 / Published: 27 September 2023

Abstract

Simple Summary

The efficient feed utilization of raw feed ingredients is one of the main factors associated with superior growth and production in poultry farming. The higher demand for cereal grains as energy sources has encouraged the dietary inclusion of other alternative cereals to achieve the target poultry production. However, alternative cereals such as barley grains may limit poultry growth due to their higher content of anti-nutritional factors, such as non-starch polysaccharides (NSPs). Hence, the application of solid-state fermentation technology with fibrolytic enzymes allows for a higher dietary inclusion of barley comparable to its actual inclusion levels. In this study, including 10% fermented and enzymatically treated barley not only improved feed utilization efficiency, but also modified intestinal barrier functions and antioxidant status and upregulated the expression of nutrient-transport-related genes. Therefore, fermented and enzymatically treated barley can be used as a promising alternative to corn and achieve the target production of broiler chickens.

Abstract

The present and future high demand of common cereals as corn and wheat encourage the development of feed processing technology that allows for the dietary inclusion of other cereals of low nutritional value in poultry feeding. Barley grains contain anti-nutritional factors that limit their dietary inclusion in the poultry industry. The treatment of barley with solid-state fermentation and exogenous enzymes (FBEs) provides a good alternative to common cereals. In this study, barley grains were subjected to solid-state microbial fermentation using Lactobacillus plantarum, Bacillus subtilis and exogenous fibrolytic enzymes. This study aimed to assess the impact of FBEs on growth, feed utilization efficiency, immune modulation, antioxidant status and the expression of intestinal barrier and nutrient transporter-related genes. One-day-old broiler chicks (Ross 308, n = 400) comprised four representative groups with ten replicates (10 chicks/replicate) and were fed corn-soybean meal basal diets with inclusions of FBEs at 0, 5, 10 and 15% for 38 days. Solid-state fermentation of barley grains with fibrolytic enzymes increased protein content, lowered crude fiber and reduced sugars compared to non-fermented barley gains. In consequence, the group fed FBEs10% had the superior feed utilization efficiency and body weight gain (increased by 4.7%) with higher levels of nutrient metabolizability, pancreatic digestive enzyme activities and low digesta viscosity. Notably, the group fed FBEs10% showed an increased villi height and a decreased crypt depth with a remarkable hyperactivity of duodenal glands. In addition, higher inclusion levels of FBEs boosted serum immune-related parameters and intestinal and breast muscle antioxidants status. Intestinal nutrient transporters encoding genes (GLUT-1, CAAT-1, LAT1 and PepT-1) and intestinal barriers encoding genes (MUC-2, JAM-2, occludin, claudins-1 and β-defensin 1) were upregulated with higher dietary FBEs levels. In conclusion, feeding on FBEs10% positively enhanced broiler chickens’ performance, feed efficiency and antioxidant status, and boosted intestinal barrier nutrient transporters encoding genes.

1. Introduction

The need for feed ingredients is expected to increase with the growing global demand for poultry meat and eggs. In consequence, the supply of cereal grains as a conventional energy source in poultry feed will not meet the growing demand for the poultry industry [1]. Barley (Hordeum vulgare L.) is considered as one alternative that can substitute common cereal grains in broilers’ feed. The greater nutritional value of barley grains is attributed to their larger endosperms (80% of the cereal grain) that comprise starch granules [2]. On the contrary, endosperm cell walls are consisted mainly of insoluble non-starch polysaccharides (NSPs) with high levels of β-glucans [3]. This higher content of NSPs in barley grains can create a physical barrier by encapsulating the nutrients and ultimately result in their limited feeding in poultry [4]. From this point of view, the search for new processing strategies of barley grains still necessitates close attention in order to overcome their limitations and increase inclusion levels in poultry diets, especially during periods of inadequate energy feed resources. In this context, one strategy to alleviate the anti-nutritive impact of NSPs and improve barley utilization, as well as augment the birds’ endogenous enzymes, is by adding different exogenous enzymes at the time of feeding [5]. Moreover, exogenous carbohydrases can produce fermentable oligosaccharides that are necessary for the better survival of probiotics in the gut [6]. Nevertheless, the optimal proficiency of these enzymes is restricted when added in feed, owing to their inadequate dietary retention in chickens’ guts and their limited activity in crop, gizzard and proventriculus [7].
The other new prospective strategy for boosting the nutritional characteristics of barley grains is via fermentation technology. Fermentation is a dynamic process aiming to break down complex molecules in feed into small simpler ones using microorganisms, substrates and environmental conditions [8]. Furthermore, fermentation can enhance the nutritional properties of feed ingredients [9,10] reducing the toxic elements and various anti-nutritional factors [11]. Fermentation technology using probiotic bacteria can enhance the concentration of probiotics, enzymes, organic acids, bioactive peptides and metabolites and may alter some compounds into more valuable components in fermented ingredients [12]. Additionally, a solid-state fermentation process with the aid of favorable fungi and bacteria can digest plant materials, which act as substrates for NSPs-degrading microorganisms and change them to nutritive feed ingredients [9,13]. Furthermore, microbial fermentation can prospectively strengthen broiler productivity, improve carcass quality and boost beneficial gut microbiota and immune resistance [14].
Lately, the supplementation of exogenous enzymes, particularly in the occurrence of microbial inoculants, have been revealed to augment the nutritional characteristics of fermented barley and wheat [15]. The main advantage from this synergistic effect is to facilitate the solubilization of plant cell wall into simple sugars that can be utilized as fermentable substrates by lactic acid bacteria and consequently improves its nutritional quality.
To the best of our knowledge, the synergistic beneficial impact combining microbial fermentation and the supplementation of exogenous enzymes on the barley’s nutritional value lacks sufficient investigation to this day. Hence, the main goal of this study was to elucidate the favorable effects, which have emerged from microbial fermentation, with the addition of exogenous enzymes to evaluate the effects of barley inclusions on growth performance, nutrients utilization efficiency, immune response, the redox status of intestine and breast muscles and the molecular aspects controlling intestinal barrier function and nutrient transporters of broiler chickens.

2. Materials and Methods

2.1. Ethical Approval

The management steps, the experimental conditions regarding the housing and care of birds and all related experimental procedures were conducted according to the Ethics Committee “Institutional Animal Care and Use Committee (ZU-IACUC/2/F/321/2022)” of the of Veterinary Medicine Faculty, Zagazig University.

2.2. Two-Stage Solid Fermentation of Barley with Exogenous Enzymatic Treatment

Barley fermentation was carried out using Lactobacillus plantarum (L. plantarum FPS 2520) and Bacillus subtilis var. natto N21 (BS). For microbial stimulation, de Man, Rogosa and Sharpe (MRS) medium was employed for L. plantarum incubation. B. subtilis was incubated in tryptone soya broth at 37 °C in an Erlenmeyer flask (150 rpm). To activate Aspergillus niger (A. niger), Sabouraud dextrose agar (Oxoid Ltd., Basingstoke, UK) was utilized and incubated for 7 days at 24 °C. Fermentation was initiated by soaking barley in distilled water to attain 30% moisture content. Afterward, B. subtilis and A. niger (ATCC 9142) were added at concentrations of 106 CFU/g and 106 spore/g of feed, respectively, and with 10% water for 2 days of aerobic fermentation at 37 °C in the first phase. Then, L. plantarum was added (106 CFU/g feed) for 5 days of anaerobic fermentation at 25 to 35 °C in the second phase. Exogenous enzymes, including beta-glucanase (200,000 IU/kg), beta-xylanase (100,000 IU/kg), pectinase (4,000,000 IU/kg), cellulase (40,000 IU/kg) and phytase (300,000 IU/kg) were commercially obtained (ALLAZYME-X, Huvepharma, Suite 230, Inc. 525 Westpark Drive, Peachtree City, GA, USA) and added at the initial step of fermentation (0.2 g/kg barley). Finally, fermented barley was dried to a moisture content of 9.10% using an oven at 50–60 °C for 72 h and then mixed with the feed ingredients.

2.3. Nutritive Value Evaluation of Fermented Barley

2.3.1. Chemical Analysis and Microbial Assessment

Crude protein (CP) of feed was estimated by analyzing total nitrogen using the Kjeldahl method according to AOAC [16] and the CP content of feed was estimated by multiplying the total N content by 6.25. Crude fiber, neutral detergent fiber (NDF) and acid detergent fiber (ADF) were verified using a FIBERTHERM (C. Gerhardt GmbH & Co. KG, Cäsariusstraße, Germany) following the procedure of Van Soest et al. [17]. The ether extract (EE) was determined by calculating the extracted weight loss of dry matter (DM) by solvent diethyl ether via the Soxhlet extraction apparatus according to AOAC [16]. The calculation of hemicellulose was performed by subtracting ADF from NDF, whereas the difference between ADF and acid detergent lignin accounted for cellulose. A digital pH meter was used for measuring the pH values (PSH-3C, INESA Instrument, Shanghai, China).
For assessing total lactic acid bacterial count, one gram of each fermented and unfermented barley grain samples were separately mixed with sterile water (9 mL). In the next step, the previously prepared samples were diluted with buffered peptone water (10-fold).
For assessing Lactobacilli count, 100 µL of supernatant was added to De Man and Rogosa Sharpe agar (MRS, CM1153, Oxoid) and incubated at 37 °C for 48 h and 13% CO2,and Tryptone Soya Broth medium was used for assessing Bacillus spp. count at 37 °C.

2.3.2. Analysis of Reduced Sugar

Reduced sugar was examined according to Miller [18]. In brief, a glucose standard solution (at a concentration of 10–100 µg/mL), 1 mL of 0.05 M acetate buffer at pH 4.8 and 1 g sample of fermented and unfermented barley were thoroughly blended. Afterward, dinitrosalicylic acid reagent (3 mL) in boiled bath water was added for 5 min at room temperature. The prepared mixture was cooled, and the absorbance was estimated with a UV–visible spectrophotometer at 540 nm.

2.3.3. Phosphorus Analysis

Total phosphorus analysis was performed according to Kirkpatrick and Bishop [19] with a spectrophotometer. The ash of dried samples was dissolved in acids (perchloric and nitric) at standard method concentrations. After that, sample filtrates were used to measure the color absorption at 400 nm. Additionally, phytate phosphorus was measured using the Wade reagent/colorimetric method as defined by Gao et al. [20]. Briefly, phytate phosphorus was extracted in acid and reacted with Wade reagent before measuring the color reaction absorbance at 500 nm with a spectrophotometer (Spectronic Helios Gamma UV–Vis Spectrophotometer; Thermo Scientific, Waltham, MA, USA). The available phosphorus was calculated by subtracting the phytate phosphorus from the total phosphorus.

2.3.4. Analysis of Phytase Enzyme Activity

The phytase activity was assessed by measuring the inorganic phosphorus released from sodium phytate, consistent with the standard steps of phytase analysis in animal feedstuffs (ISO/DIS 30024) standard [21]. The extraction of barley samples was performed using 0.2 M citrate buffer at room temperature for 30 min at pH 5.3. Samples were then filtrated, and the oily layer was eliminated. Pure filtrate was used to evaluate the phytase activity. The phytase activity unit was expressed as the amount of phytase required for 1 μg of inorganic phosphorus liberation in 1 min at pH 5.3 and 37 °C (FTU/kg).

2.4. Animals and Experimental Design

Four hundred one-day-old male broiler chicks (Ross 308) were weighed and allocated to four dietary treatments, each containing ten replicates with ten chicks/pen. The dietary groups comprised a control (on corn–soybean-based diet) and three other groups in which fermented barley with enzymatic treatment (FBEs) was included at levels of 5, 10 and 15%. The experimental diets were administered in a three-phase feeding program and included a starter (day 1–10), grower (day 11–20) and finisher phase (day 21–38). The Aviagen Ross 308 management catalog Aviagen [22] guidelines were integrated to control the lighting, temperature and relative humidity in the experimental environment. Dry feed and water were provided ad libitum to each pen. Experimental diets were formulated as per the Ross broiler nutrition specifications (Table 1, Table 2 and Table 3). The proximate analysis of the feedstuff ingredients was performed following the standard approach of the AOAC [16]. The analyzed CP contents in soybean meal, corn and corn gluten were 47.9, 9.8 and 59.6, respectively. Meanwhile, the crude fiber contents in soybean meal, corn and corn gluten were 3.70, 2.30 and 1.8, respectively. Birds were fed crumble diets in the starter (1.5–2.4 mm) and pelleted diets in grower and finisher phases (3.5 mm) using a steam pelleting machine (Koppers Junior C40, Inc., Pittsburgh, PA, USA). The conditioning time was approximately 10 s at 75 °C and under a pressure of 1.5 kg/cm2 form as defined by the nutrition specifications in the Aviagen Ross broiler handbook, Aviagen [22].

2.5. Growth Performance and Nutrient Metabolizability Trial Monitoring

Average body weight (BW) of representative birds and feed intake were assessed throughout the starter, grower and finisher periods. Body weight gain (BWG) and feed conversion ratio (FCR) were assessed for each feeding phase and for the entire rearing period over 38 days.
The estimation of metabolizability of nutrients was performed according to Souza et al. and Zhang et al. [24,25]: titanium oxide (TiO2) was used as an indigestible marker, where three grams was mixed with each kg of experimental diet (finisher). The total excreta were collected from chickens for seven days with exclusion of any contaminants and then dried for 72 h at 65 °C and kept at −20 °C. The content of TiO2 in diets and excreta was determined after acid digestion. The total tract metabolizability calculations were performed according to AOAC [16] for DM, CF, excreta metabolizability of CP and phosphorus availability. Nutrient metabolizability% = 100 − [100 × (dietary indicator quantity (g)/fecal indicator quantity (g) × nutrient quantity in excreta (g)/nutrient quantity in feed (g)].

2.6. Sampling

At 38 days of age, the experimental birds (n = 5/group) were randomly picked and euthanized via cervical dislocation to collect blood samples and separate the sera via centrifugation for 15 min at 3000 rpm. The separated serum samples were stored at −20 °C until further analysis of immune and lipid-related parameters. Afterward, the eviscerations of the euthanized birds were performed for collection of various tissue samples. Homogenization of collected jejunal and breast muscle tissues were performed in ice-cold phosphate buffer saline (PFS; pH 7.4) and 20 mL of glycerol, followed by centrifugation at 3000 rpm for 15 min. Eppendorf tubes were used to collect the supernatants, which were used for the analysis of antioxidant capacity. For the digestive enzymes’ examination, pancreatic tissues were immediately collected after euthanasia (n = 5), minced in ice-cold PFS and centrifuged at 3000 rpm for 15 min, and the supernatants were used for analysis. Duodenal tissues (n = 5/replicate) were flushed with PFS and kept at −80 °C in Eppendorf cap-lock tubes to extract RNA. Samples of intestinal contents were immediately collected to estimate digesta viscosity and pH.

2.7. Digesta Viscosity and Duodenal pH

The jejunal digesta viscosity was measured as described by Perera et al. [26]. Briefly, collected digesta samples were centrifuged at 3000 rpm at 20 °C for 10 min. Viscosity was assessed in the supernatant (0.5 mL) with a viscometer (Brookfield digital viscometer, Stoughton, MA, USA) supplied with a CP-40 spindle with 5 to 500/s shear rates. The pH of the duodenal content was evaluated with a digital pH meter (PSH-3C, Shanghai, China).

2.8. Digestive Enzymes Estimation

The supernatants obtained from pancreatic samples were employed to measure the digestive enzyme activities using commercial diagnostic kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) as per the manufacturer’s instructions.

2.9. Serum Biochemical Investigations

To estimate the lysozyme and nitric oxide (NO) activities, commercial kits (Jiancheng Biotechnology Institute, Nanjing, China) were used. Serum immunoglobulin IgG and IgM measurements were performed using enzyme-linked immunosorbent assay kits (Enzyme-linked Biotechnology Co., Ltd., Shanghai, China) following the provided guidelines. Creatinine, uric acid, cholesterol, triglycerides, low-density lipoprotein (LDL), high-density lipoprotein (HDL), alanine transaminase (ALT) and aspartate transaminase (AST) values were measured using standard commercial kits (Span Diagnostic Ltd., Sachin, India).

2.10. Measurement of Redox State in Jejunum and Breast Muscle

Serum superoxide dismutase (SOD, 19160), catalase (CAT, 219265) and glutathione peroxidase (GSH-Px, CS0260) activities were estimated using Sigma assay kits following the company’s guidance. Lipid peroxidation (MDA) was evaluated using the NO, MAK085 assay kit from Sigma-Aldrich. Muscle hydrogen peroxide (H2O2) amounts were determined as per Fernández-Puente et al. [27], and the obtained values were estimated as μmoL/g of tissue. To assess the (reactive oxygen species) ROS content in meat, the oxidation technique of Pranczk et al. [28] was utilized. The total antioxidant capacity (T-AOC) was established using a commercial kit (Sigma-Aldrich, MAK187, St. Louis, MO, USA).

2.11. Quantification of Intestinal Barrier Function and Nutrient Transporter-Associated Genes via RT-qPCR

Intestinal tissues were used for assessing the mRNA expression levels of genes’ encoding barrier functions (junctional adhesion molecule-2 (JAM-2), mucin-2 (MUC-2), occludin, claudins-1 (CLDN-1) and β-defensin 1) and nutrient transporters’ encoding genes (glucose transporter-1 (GLUT-1), cationic amino acid transporter-1 (CAT-1), peptide transporter-1 (PepT1)). RNA extraction was carried out using QIAamp RNeasy Mini kit (Qiagen, Hilden, Germany) as described by the manufacturers’ directions. The RNA quantification was assessed at 260 nm and the clarity of extracted RNA was spectrophotometrically determined by computing the absorbance wavelength ratio at 260–280 nm. After that, one-step RT-qPCR assay was completed using a QuantiTect SYBR Green RT-PCR Kit (Qiagen, Hilden, Germany) on the Strata-gene MX3005P real-time PCR recognition system. The precision of all PCR amplifications was established via the exploration of melting curve. The transcript expression level was standardized to the expression of those corresponding to TATA-binding protein (TBP), with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as endogenous controls. The sequences of gene-targeted primer employed in RT-qPCR assay are stated in Table 4. The relative mRNA expression results of explored genes were assessed via the 2−∆∆Ct according to the method of Livak and Schmittgen [29].

2.12. Histopathological Examination of Intestine

Five birds per treatment were euthanized and duodenum samples were immediately collected (segments of approximately 3 cm from the mid-section of the duodenum). The specimens were immersed in 10% neutral buffer formalin, then processed using the usual histopathological technique to be immersed in paraffin wax [30]. Specimens were sectioned at 5–7 µm in thickness, stained by H&E stains, and then slides of tissue micro-sections were examined using a light microscope. Crypt depth was determined from the base upward to the region located between the crypt and villus [31]. Villus height was measured from the top of the villus to the top of lamina propria [32]. These images were analyzed utilizing Image J (version 1.50i) software.

2.13. Statistical Analysis

In the current study, homogeneity was verified with Levene’s test, and normality was tested using the Shapiro–Wilk test with the model Yik = μ + Li + eik, where Yik is the estimation, μ is the total mean, Li is the impact of the experimental treatments and eik is the random error. All statistics-related data were explored using the GLM procedure of SPSS version 22. Deviations in the data were defined as standard error of the mean (SEM), and significance was denoted at p ≤ 0.05. Tukey’s test was employed to evaluate the significant variations in the mean values. All graphs were created using GraphPad Prism software (version 8).

3. Results

3.1. Chemical Analysis of Unfermented Barley Grains and Fermented and Enzymatically Treated Barley Grains

As presented in Table 5, the crude protein and reduced sugar contents were significantly increased after the fermentation of barley grains; nevertheless, crude fiber, lignin, cellulose, NDF and ADF (p < 0.003) reduced after fermentation. Notably, phytase activity (p < 0.001) and non-phytate phosphorus (p < 0.007) in FBEs decreased when compared with unfermented barley grains. Regarding the microbial population, the total lactic acid bacteria and Bacillus spp. count significantly increased in FBEs.

3.2. Growth Performance

The impact of the dietary inclusion of various levels of FBEs on the growth performance of broiler chicks throughout the experimental period is depicted in Table 6. At the end of the stater period, BWG and FCR improved (p < 0.004) in the group fed with FBEs at the level of 10%, with no significant differences found among other experimental groups. The dietary inclusion of FBEs did not influence the feed intake of broilers during days 0 to 10. Moreover, the BWG and FCR in the grower period enhanced (p < 0.040) in the groups fed with 10 and 15% FBEs in contrast to the control group. The feed intake in the grower period decreased (p < 0.040) in the group fed with 10% FBEs unlike the control group. At the end of the finisher period, a higher BWG and superior FCR were found in the group fed with 10% FBEs followed by the groups fed with 5 and 15% FBEs in comparison with the control group. Regarding the overall growing period, the dietary inclusion of FBEs boosted the overall growth performance parameters of broiler chickens when compared to the control group. Moreover, broilers fed with 10% FBEs displayed the most prominent improvement (p < 0.030) in BWG and FCR (p < 0.001).

3.3. Estimating Nutrient Metabolizability and Activities of Pancreatic Digestive Enzymes

The dietary inclusion effect of FBEs on nutrient metabolizability percent (%) and digestive enzyme activities are presented in Table 7. A significant increase in DM (p < 0.001), CP (p < 0.020) and crude fiber (p < 0.030) metabolizability were detected, following the feeding of FBEs, especially at the 10% inclusion level, unlike control group. Phosphorus availability in ileum (p < 0.040) was considerably elevated in all groups fed with different levels of FBEs. Moreover, the duodenal pH (p < 0.030) decreased simultaneously with increasing FBE levels in diets. Jejunal digesta viscosity (p < 0.060) showed differences among different experimental groups. The inclusion of different levels of FBEs increased the activities of pancreatic lipase and amylase (p < 0.001). Broilers fed with FBEs at the level of 10 and 15% (p < 0.010) showed an increase in intestinal maltase and sucrase activities. Increasing the inclusion level of FBEs enhanced trypsin (p < 0.030) and chymotrypsin (p < 0.01) activities when compared with control group.

3.4. Estimating Immune and Biochemical-Related Parameters

The immune response and biochemical parameters of broilers supplemented with various levels of FBEs are illustrated in Table 8. With increasing levels of FBEs in broiler diets, IgG (p < 0.090) and lysozyme (p < 0.001) increased but inversely when the nitric oxide levels were reduced. Higher levels of IgM were noticed in the group supplemented with 15% FBEs. Compared to the control, various substitution levels of FBEs had no significant effect on uric acid, creatinine, AST and ALT. The noticeable reduction in the levels of cholesterol, triglycerides and LDL-c and the elevation in levels of HDL-c were observed in the group fed with FBEs at the level of 15%.

3.5. Antioxidant Functions of FBEs on Intestinal Tissues and Breast Muscle

The biomarkers of the antioxidant and oxidative stability of intestinal tissues and breast muscles are presented in Table 9. The selected antioxidant enzymes in intestinal tissues (GSH-PX, SOD and CAT) showed an increased activity in response to higher inclusion levels of FBEs. Moreover, their activities were significantly elevated in a dose-dependent pattern with increasing levels of dietary FBE inclusion in breast muscle. Regarding T-AOC, their levels were elevated (p < 0.001) in intestinal tissues and breast muscle in groups fed with 10 and 15% FBEs when compared with control group. The intestinal and breast muscle contents from ROS and H2O2 lowered with the rise in the inclusion levels of FBEs. The lowest level of lipid peroxidation biomarker (MDA) was obviously detected in intestinal tissues and breast muscle in the group fed with 15% of FBEs.

3.6. Intestinal Nutrient Transporter-Related Genes Expression

The higher inclusion levels of FBEs upregulated (p < 0.050) the mRNA expression of GLUT1 and GLUT2 (Figure 1). Regarding the proteins that related to transporters genes, groups fed with 10 and 15% of FBEs had an upregulated level of CAT-1. Additionally, the most remarkable mRNA expression of PEPT-1 was observed in the group fed with FBEs at the level of 15%.

3.7. Intestinal Tight Junction-Related Genes Expression

Real-time qPCR analysis results for JAM, occludin, claudin-1, MUC-2 and β-defeinesin-1 are shown in Figure 2. Compared with the control group, all FBE-fed groups exhibited an elevation (p < 0.050) in the levels of the mRNA expression of tight junction-associated genes, with the ultimate significant level obtained for the 15% FBE group (increased by 1.39-, 1.29-, 1.61-, 1.52- and 1.68-fold compared to control group).

3.8. Evaluating Intestinal Histomorphology in Response to Feeding on FBEs

The impact of feeding broiler chickens on FBEs (p < 0.050) influenced the villi length, crypt depth and their ratio in the duodenum compared to control (Table 10). The supplementation of the broiler’s diets with FBEs10% heightened the villi length and lessened crypt depth in the duodenum (p < 0.050), up to 6.78% and 28.18%, respectively. A significant increase in the duodenal villi height: crypt depth ratio was detected with an increasing dietary inclusion of FBEs up to 10%. As described in Figure 3A,B, duodenum showed normal villi, glands, lamina propria, submucosa and the muscular layer. Meanwhile, birds fed with FBEs10% showed an increased activity of the columnar lining epithelium of villi, normal lamina propria, submucosa, muscular layer and serosa (Figure 3C). For the FBEs15%-fed birds, as described in Figure 3D, duodenum layers were apparently normal layers with numerous and hyperactive glands.

4. Discussion

The most common conventional cereals such as corn and wheat are predicted to not meet the future demand of the animal feed sector in the modern fast-growing poultry industry. This overdemand not only exerts pressure on the feed market’s raw materials, but also encourages the evaluation of alternative feed materials that can be included in poultry diets [33]. The dietary inclusion of barley grains is low in poultry diets due to their high content of anti-nutritional factors such as NSPs and phytic acid [34]. Additionally, the degradation of NSPs in barley-based diets by exogenous fibrolytic enzymes can overcome the adverse consequences of NSPs on the birds’ utilization of nutrients and performance [35]. These limitations to using barley as an energy source in poultry diets require searching for novel processing strategies to increase its dietary inclusion levels. Applying solid-state fermentation technology can improve the inclusion rate of raw plant materials with low nutritional characteristics such as barley grains in animal feed [36].
Microbial fermentation is an effective technology for improving barley’s nutrient metabolizability and nutrient assimilation in poultry and other monogastric animals. Using the synergistic impact of probiotics and enzymes to predigest feed is better than using single fermentation or enzymatic hydrolysis alone by enhancing macromolecule degradation and microbial fermentation efficiency [37]. The crude protein content in fermented barley increased by 10.88% compared with non-fermented barley, which may be due to the fermenting microorganisms using the carbonaceous substrates in the grains as energy sources to produce microbial protein. Moreover, fermenting microorganisms with additional exogenous enzymes can depolymerize the fibrous content of plant cell walls, use it to produce nitrogenous compounds and alter protein solubility, improving plant proteins’ degradability [38,39]. Correspondingly, Liu et al. [40] stated that the solid-state fermentation of different barley grain forms (germinated, soaked and unsoaked) increased protein and amino acid contents, especially valine, alanine, phenylalanine, aspartic acid and glutamic acid. A similar study proved that lactic acid bacteria fermentation produces proteases that hydrolyze proteins and elevate the free amino acids content [41].
Barley grains are an essential feedstuff used in animal feeding characterized by its 11–13% hull and 4–6.0% total fiber contents and considerable NSP content, comprising mostly pentosans and β-glucans [42]. Carbohydrates in barley are not as easily digested as that in corn as the fiber in corn contains lower levels of NSP, such as β-glucans, lignin and cellulose, compared to barley grains.
The crude fiber and NSP constituents of barley can be degraded via ruminal fermentation, while monogastric animals do not have adequate enzymatic and microbial activities to appropriately degrade them, causing the formation of viscous digesta in the digestive tract, which impairs the nutrients’ absorption [43]. Solid-state fermentation has been reported as an effective approach for improving the nutritive value of cereals by reducing the cellulose content and improving the acid-soluble protein content [44,45]. Our study showed that the FBEs nutritive content was altered after solid-state fermentation using multi-exogenous enzymes that mainly acted on the fiber substrate (beta-xylanase- beta-glucanase, pectinase, xylanase and cellulase). These fibrolytic enzymes hydrolyze the polysaccharides in crude fiber into smaller carbohydrate units that act as a carbon source for the metabolic processes in energy production. Likewise, supplementation with exogenous fibrolytic enzymes during fermentation decreased the crude fiber content in FBEs, which accounted for the reduced biodegradation of lignin, cellulose, hemicellulose, NDF and ADF and increased reduced sugar content. Moreover, Xiao et al. [46] described that the degradation and hydrolysis of cellulose and hemicellulose and the loosening of lignin bonds increased the soluble polysaccharides and decreased the insoluble fibrous content due to the solid-state fermentation process with added exogenous enzymes. In agreement, Shi et al. [36] indicated that NDF, hemicellulose and phytic acid were reduced after the microbial fermentation of corn–soybean meal, which could be attributed to enzyme secretion by microorganisms, such as those degrading NSPs and phytase. These modifications may be due to the fermentation products such as organic acids, various endogenous enzymes in the kernels, or bacterial enzyme production during the fermentation process.
Additionally, the majority of the phosphorous in barley remain in the form of phytate phosphorus that have low availability in monogastric animals [47]. In the current study, phytase activity increased after the fermentation of barley grains, which resulted in higher non-phytate phosphorus amount compared to unfermented barley grains. Yasar and Tosun [48] described that the supplementation of exogenous enzymes, including phytase, during the solid-state fermentation process to barley grains successfully increased phytase enzyme content and their activity consequently increased non-phytate phosphorus quantity, which is in agreement with our finding. A reduced phytic acid amount in fermented feed may be resulted from an increased microbial phytase production during fermentation [49]. Among a variety of factors, the pH of fermented feed is an essential parameter to assess its quality, since lowering the pH may promote nutrient digestion in the intestine and prevent pathogenic microorganisms’ proliferation in feed [50]. Our results showed that the pH of FBEs decreased from 6.25 to 4.25, which indicated good-quality fermented barley. This decrease in pH resulted from a higher lactic acid production as the pH may have declined only when the cereals were fermented because they have a minimal buffering capability than compound feed [51]. Also, lowering the pH was due to the higher proliferation of lactic acid-producing bacteria in fermented barley, which is consistent with Shi et al.’s findings of an increased count of total lactic acid bacteria and B. subtilis count after the fermentation process [36].
Replacing corn with raw barley grains reduced the BWG of broiler chicks during the starter period [6]. However, in the current study, substituting corn with fermented barley up to FBEs10% in diets for broiler chicks resulted in a noticeable improvement in the growth performance, which can be explained by the synergistic positive impact of adding enzymes and fermentation barley grains that enhanced their nutritional value and increased the availability of nutrients for the birds. Also, Li et al. [52] described that broilers fed with numerous ratios of feed fermented with Lactobacillus spp. and B. subtilis at the level of 10% increased the average daily gain of broilers and their feed efficiency. Skrede et al. [53] stated that the weight gain of broiler chickens fed with fermented barley and fermented wheat without the addition of commercial enzymes was greatly improved compared to those fed a control diet. Similarly, feeding on fermented feed at the level of 10% boosted the FCR of broilers and tended to increase the body gain compared to those fed with 20% and 0% for fermented feed [54].
In addition, the inclusion of a barley-based diet as well as a cocktail of NSPs-degrading enzymes as a substitute to a corn–soy-based diet effectively improved BWG and feed utilization in broiler chickens [55]. The additional advantages of feeding on FBEs included an enhanced nutrient metabolizability (DM, CP and CF) and phosphorus bioavailability by augmenting the substrate availability, which accelerated the activity of digestive enzymes in the broiler chickens, which consequently agrees with the findings of Shi et al. [36]. Accordingly, dietary FBE inclusion enhanced the building of carbohydrates and protein by raising the nutrient transport proficiency in intestinal epithelial cells, which follows the findings of Horvatovic et al. [56]. Compared with a corn-based diet, adding carbohydrases to barley during fermentation enhanced the activities of starch digestive enzymes (amylase, maltase and sucrase), thus improving the metabolizability of barley-based diets for broilers, which agrees with the findings of Perera et al. [26,57]. As such, the fermentation process can degrade macromolecular factors and anti-nutritional elements in raw feed stuff via microorganisms, thereby facilitating the feed’s metabolizability and absorption, with an improvement in the subsequent growth performance of the broilers [58]. Furthermore, applying feed fermentation technology to broiler feed not only decreases anti-nutritional substances, but also augments the concentrations of beneficial probiotic bacteria, enzymes and fermentation metabolites [59,60]. Meanwhile, the lowered feed and duodenal pH found in the current study could be related to the enhanced proliferation of beneficial probiotic bacteria such as Lactobacillus and Bacillus spp. in fermented barley that might encourage the degradation of compound carbohydrates, especially cellulose and hemicelluloses, into organic acids [61,62].
Lactic acid produced via fermentation can decrease the pH of feed and the digestive tract, which provides a good environment for phosphorus absorption. This may be because the beneficial microorganisms in the fermentation broth can produce some metabolites, such as lactic acid, bacteriocin, antibacterial substances, higher alcohols which can reduce the pH of the digestive tract, inhibit or kill harmful bacteria (such as Escherichia coli) and improve the digestion and absorption capacity of the intestines [63]. The enhanced broiler growth performance in the current study could be associated with the improved nutritive values of FBEs. Moreover, the starch content in corn ranges from 65 to 70% and is easily digested, while the starch content in barley is approximately 60% and proven to not be easily digested in monogastric animals and poultry [64]. Therefore, barley grain inclusion in broilers’ diets, especially in the starter phase, is limited as it causes an increase in digesta viscosity and lowered nutrient absorption, which cause growth performance retardation in broiler chickens [65]. Therefore, the fermentation technology with exogenous additions showed its maximum efficiency in broiler performance when including up to 10% of FBEs. Even though feeding on FBEs decreases the adverse effects of NSPs content in barley grains, a higher inclusion level in broiler diets, especially in the starter stage, may exceed the birds’ capability to digest it efficiently, with a consequent retarding effect on growth performance [34]. Moreover, this explanation is supported by the nutrient metabolizability analyzed data, which showed higher values of up to 10% FBE inclusion.
Accordingly, the duodenum histomorphological images revealed an increased villus height and lowered crypt depth after feeding on FBEs, especially at the 10% level. Similarly, birds fed with solid-state fermented feed with Lactobacillus casei had a greater villus height and lower crypt depth in the duodenum than chickens fed with the control diet, as well as a greater villus height/crypt depth ratio in a study conducted by Peng et al. [66]. There is a strong correlation between enhanced nutrient digestion and improved intestine histomorphology as the function of intestinal villi improves with an increasing villus height/crypt depth ratio [67]. Our study revealed that the inclusion of 10% FBEs improved the villus height and villus height/crypt depth ratio, which follows the findings of Peng et al. [66,68]. In addition, El-Sanhoury and Ahmed [69] reported increased villus height and numbers after supplementation with exogenous enzymes containing cellulase and xylanase in broiler chickens. An explanation for the improved intestinal villus height and villus height/crypt depth ratio is that cereals containing high levels of NSPs increase the size of the gastrointestinal tract and change the intestinal morphology [70].
Other possible explanations for the enhanced broiler performance are that fermented barley-based diets treated with exogenous NSPs-degrading enzymes decrease the digesta viscosity, prompt the degradation of the cell wall, release the encapsulated nutrients, and induce gut microbiota modification via prebiotic oligosaccharides [71,72,73]. The viscous contents inside the intestines of birds fed with barley-based diets unlike birds fed with corn-based diets were noted due to their higher β-glucans content [74]. Higher levels of dietary NSPs can bind with a large amount of water, which increases the fluid viscosity and consequently hinders the digestion of nutrients, reducing their utilization [75]. An excess of insoluble fiber shortens the residence time of chyme in the intestines, and an excess of soluble fiber adheres to the surface of chyme to form a nutritional barrier, which is not conducive to the digestion of nutrients [76]. Herein, the viscosity of the intestinal digesta of broilers fed with FBEs up to 10% did not differ from those fed a corn-based diet, which is supported by the findings of Bedford [71].
Nutrient absorption in the small intestines is mainly intermediated by transporter proteins expressed in enterocytes. The upregulation of these transporters boosts nutrient transportation efficiency and enhances the influx of digested nutrients into the enterocytes and, later, to all body parts [77]. Herein, feeding broiler chickens with FBEs upregulated the expressions of glucose (GLUT1) and amino acid (CAT-1, LAT2 and PEPT1) transporter genes. These results agree with those of Al-Khalaifah et al. [78], who reported that feeding broiler chickens with enzymatically treated fermented dried brewer’s grains upregulated amino acids and all glucose transporter encoding gene expressions. Following our results, supplementing a reduced-energy feed with enzymes in broiler diets boosted micronutrient absorption via GLUT-2 and PEPT1 upregulation [79]. Additionally, using carbohydrate-rich feed can greatly upregulate the expression of glucose transmitters and consequently increase the absorption of glucose [80]. Moreover, xylanase enzyme supplementation in broilers’ diets was reported to upregulate the expressions of GLUT2 and PEPT1, which positively impacted nutrient absorption [81,82].
The intestinal barriers can protect the intestine from pathogen colonization and adhesion [83]. Fermentation products, including probiotics [84], have been demonstrated to upregulate the gut barrier-related genes in poultry, but their mechanisms of action need further investigation. Our results showed a significant improvement in the expression of intestinal JAM, occludin, claudin-1, MUC-2 and β-defensin-1 with increasing levels of FBEs, suggesting the positive impact of fermented feed on gut barrier functions. OCLN and zona OCLN can produce a gut extracellular barrier [85,86], which are the main tight junction proteins that provide protection against invasive intestinal pathogens [87]. MUC2 is an essential gene responsible for mucin secretion in the intestinal mucosa that control the attachment sites for host bacteria [85,88].
The main microbial fermentation metabolites include prebiotic-like compounds such as oligosaccharides that have been proven to have an immune-boosting function [89]. These probiotic and prebiotic effects of FBEs might have the potential to not only enhance the growth performance, but also modify the gastrointestinal ecosystem, metabolic activities and immune response. Serum immunoglobulins are the key indicators of an animal’s humoral immunity as they play crucial roles in defending against pathogenic microorganisms [90,91]. Herein, serum IgG and IgM concentrations increased in response to the increase in the level of fermented barley in the feed. Previous studies have proven that the elevation in immunoglobulin concentrations in the serum of broilers fed with fermented feed may be associated with the production of small-sized peptides and the increase in amino acid concentration during fermentation, which act as a substrate for immunoglobulin synthesis [92,93]. Another explanation might be that fermented feed inclusion increases the source of beneficial probiotic bacteria, such as Lactobacillus, which has been verified to stimulate the production of immunoglobulin in broilers [94]. Similar results were obtained by Xu et al. [95], who reported that dietary supplementation with fermented feed in broiler chickens increased serum immunoglobulin levels. Serum lysozyme plays an important role in the lysis of invading Gram-positive bacteria by hydrolyzing the b-1,4 glycosidic bonds of peptide glycans, which destroys the murein layer of the bacterial cell wall and reduces its mechanical strength, resulting in the destruction and lysis of the bacteria [96]. In our study, including fermented barley in the feed stimulated the lysozyme activity in broiler serum. Agreeing with our findings, Zhu et al. [97] proved that fermented feed supplementation increased serum lysozyme activity. Nitric oxide (NO) is a typical free radical and pro-oxidant produced via the oxidation of L-arginine by nitric oxide synthase in macrophage cells in response to inflammation. Nitric oxide can freely pass through the cell membrane and shows strong oxidation activity [98]. An excessive amount of NO production can cause tissue damage via reactive nitrogen and oxidative stress effects [99]. Herein, the NO levels decreased by increasing the inclusion levels of FBEs, which is consistent with the findings of Wu et al. [94].
Liver health status can be indirectly estimated by serum concentrations of AST and ALT, as higher levels are considered markers for liver damage [100]. Furthermore, kidney function can be anticipated by measuring up-normal variations in urea and creatinine serum levels. Our concurrent results show that dietary FBEs had no significant impact on serum AST, ALT, uric acid and creatinine levels, which were within the normal ranges, indicating healthy liver and kidney functions in the FBE groups. Moreover, the highest reductions in total cholesterol and triglyceride concentrations in the broiler serum were detected in the group fed with 15% FBEs, which was attributed to the hypocholesterolemic effects of probiotics resulting from microbial fermentation [101]. Probiotic strains may boost bile salt hydrolase activity, resulting in bile salt deconjugation, and can uptake cholesterol into their cells with a subsequent decrease in the cholesterol level in the surrounding environment [102].
Intestinal tissue and breast muscle concentrations of antioxidant enzymes and lipid peroxidation biomarkers such as MDA and T-AOC reflect the general antioxidant status and consequently the health of birds. Herein, increasing the antioxidant capacity of intestinal tissues and breast muscle and enhancing their capacity to scavenge free radicals demonstrated the antioxidant role of FBEs. A higher production of fermented metabolites with antioxidant potential in fermented feed has been proven to enhance its functional properties [103,104,105]. Furthermore, the higher antioxidant efficacy in fermented products could result from various active peptides generated from the protein hydrolysates in the substrates and the production of phenolic compounds that counteract free radicals [106,107]. MDA is an end-product of lipid peroxidation; hence, its level can be used to monitor the degree of lipid peroxidation [108]. The decline in the MDA concentration in our experiment was associated with a drop in the level of lipid peroxidation end-products. In accordance, fermentation products such as microbial glucosidases are more effective at scavenging free radicals [109]. Furthermore, dietary probiotics have been verified to promote antioxidant enzyme activities and reduce the harmful impacts of oxidative stress [110]. Antioxidant compounds such as phenolic and flavonoid complexes, T-SOD, catalase enzymes, GSH-Px activities and total antioxidant capacity were increased, and MDA generation was inhibited in hepatic tissues and serum in response to microbially fermented soybean meal with Bacillus amyloliquefaciens [111]. In broiler chickens’ diets, the addition of solid-state fermented Isaria cicadae enhanced the activities of GSH-Px, T-SOD and T-AOC due to the presence of polyphenols with strong free radical scavenging activity [112,113].

5. Conclusions

The beneficial impacts that emerged from the fermentation of barley grains with probiotics and exogenous enzymes not only improved their nutritive quality, but also promoted the birds’ performance due to the health-boosting benefits, augmenting feed utilization. The beneficial molecular findings of gene expression regulating the intestinal barrier and nutrient transports can support the favorable use of higher-dietary-inclusion levels of FBEs in the diets of broiler chickens. Herein, our outcomes described that the building up of strong antioxidant qualities and the immune system after feeding on FBEs can provide a new sense of hope to minimize the oxidative stress in poultry farms. Taken together, our study recommended that a dietary inclusion of 10% FBEs enhances birds’ performance and improves the feed efficiency of broiler chickens.

Author Contributions

Conceptualization, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., E.M.Y., A.T.Y.K., S.J.D. and A.E.M.; methodology, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., E.M.Y.; A.T.Y.K., S.J.D. and A.E.M.; software, D.I., H.I.E.-s., E.R.M., A.T.Y.K., S.S.K. and A.E.M.; validation, D.I., H.I.E.-s., E.R.M., A.T.Y.K. and A.E.M.; formal analysis, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.E. and A.T.Y.K.; investigation, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., E.M.Y., A.T.Y.K., S.J.D. and A.E.M.; resources, D.I., H.I.E.-s., E.R.M., S.S.K. and A.T.Y.K.; data curation, D.I., E.R.M. and A.T.Y.K.; writing—original draft preparation, D.I., H.I.E.-s., E.R.M. and A.T.Y.K.; writing—review and editing, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., S.S.K., E.M.Y., A.T.Y.K., S.J.D. and A.E.M.; visualization, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., S.S.K., E.M.Y., A.T.Y.K., S.J.D. and A.E.M.; supervision, D.I., H.I.E.-s., A.T.Y.K. and A.E.M.; project administration, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., E.M.Y., A.T.Y.K., S.J.D. and A.E.M.; funding acquisition, D.I., H.I.E.-s., E.R.M., G.I.A.E.-R., S.M.B., A.A.A., A.E., S.S.K., E.M.Y., A.T.Y.K., S.J.D. and A.E.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the researches supporting project number (RSPD2023R700), King Saud University, Riyadh, Saudi Arabia.

Institutional Review Board Statement

The management steps, the experimental conditions regarding the housing and care of birds and all related experimental procedures were performed according to the Ethics Committee “Institutional Animal Care and Use Committee (ZU-IACUC/2/F/321/2022)” of the Faculty of Veterinary Medicine at Zagazig University.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data are accessible from the corresponding author upon request.

Acknowledgments

This work was supported by the researches supporting project number (RSPD2023R700), King Saud University, Riyadh, Saudi Arabia.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Thirumalaisamy, G.; Muralidharan, J.; Senthilkumar, S.; Hema Sayee, R.; Priyadharsini, M. Cost-effective feeding of poultry. Int. J. Sci. Environ. Technol. 2016, 5, 3997–4005. [Google Scholar]
  2. Perera, W.; Abdollahi, M.; Ravindran, V.; Zaefarian, F.; Wester, T.; Ravindran, G. Nutritional evaluation of two barley cultivars, without and with carbohydrase supplementation, for broilers: Metabolisable energy and standardised amino acid digestibility. Br. Poult. Sci. 2019, 60, 404–413. [Google Scholar] [CrossRef] [PubMed]
  3. Messia, M.C.; Candigliota, T.; De Arcangelis, E.; Marconi, E. Arabinoxylans and [beta]-glucans assessment in cereals. Ital. J. Food Sci. 2017, 29, 112–123. [Google Scholar]
  4. Kim, C.; Kang, H. Effects of fermented barley or wheat as feed supplement on growth performance, gut health and meat quality of broilers. Eur. Poult. Sci. 2016, 80, 1–11. [Google Scholar]
  5. Al-Khalaifah, H.S.; Shahin, S.; Omar, A.E.; Mohammed, H.A.; Mahmoud, H.; Ibrahim, D. Effects of graded levels of microbial fermented or enzymatically treated dried brewer’s grains on growth, digestive and nutrient transporter genes expression and cost effectiveness in broiler chickens. BMC Vet. Res. 2020, 16, 424. [Google Scholar] [CrossRef] [PubMed]
  6. García, M.; Lázaro, R.; Latorre, M.; Gracia, M.; Mateos, G. Influence of enzyme supplementation and heat processing of barley on digestive traits and productive performance of broilers. Poult. Sci. 2008, 87, 940–948. [Google Scholar] [CrossRef] [PubMed]
  7. Abdel-Wareth, A.A.; Mohamed, E.M.; Hassan, H.A.; Eldeek, A.A.; Lohakare, J. Effect of substituting hydroponic barley forage with or without enzymes on performance of growing rabbits. Sci. Rep. 2023, 13, 943. [Google Scholar] [CrossRef]
  8. Sharma, R.; Garg, P.; Kumar, P.; Bhatia, S.K.; Kulshrestha, S. Microbial fermentation and its role in quality improvement of fermented foods. Fermentation 2020, 6, 106. [Google Scholar] [CrossRef]
  9. Sugiharto, S.; Yudiarti, T.; Isroli, I. Performances and haematological profile of broilers fed fermented dried cassava (Manihot esculenta Crantz). Trop. Anim. Health Prod. 2016, 48, 1337–1341. [Google Scholar] [CrossRef]
  10. Abdel-Raheem, S.M.; Mohammed, E.S.Y.; Mahmoud, R.E.; El Gamal, M.F.; Nada, H.S.; El-Ghareeb, W.R.; Marzok, M.; Meligy, A.M.; Abdulmohsen, M.; Ismail, H. Double-fermented soybean meal totally replaces soybean meal in broiler rations with favorable impact on performance, digestibility, amino acids transporters and meat nutritional value. Animals 2023, 13, 1030. [Google Scholar] [CrossRef]
  11. Ibrahim, D.; Moustafa, A.; Shahin, S.; Sherief, W.; Farag, M.; Nassan, M. Impact of fermented or enzymatically fermented dried olive pomace on growth, expression of digestive enzymes and glucose transporters genes, oxidative stability of frozen meat and economic efficiency of broiler chickens. Front. Vet. Sci. 2021, 8, 442. [Google Scholar] [CrossRef] [PubMed]
  12. Stanbury, P.F.; Whitaker, A.; Hall, S.J. Principles of Fermentation Technology; Elsevier: Amsterdam, The Netherlands, 2013. [Google Scholar]
  13. Omar, A.E.; Al-Khalaifah, H.S.; Ismail, T.A.; Abd El-Aziz, R.M.; El-Mandrawy, S.A.; Shalaby, S.I.; Ibrahim, D. Performance, serum biochemical and immunological parameters, and digestive enzyme and intestinal barrier-related gene expression of broiler chickens fed fermented fava bean by-products as a substitute for conventional feed. Front. Vet. Sci. 2021, 8, 696841. [Google Scholar] [CrossRef] [PubMed]
  14. Zhu, F.; Zhang, B.; Li, J.; Zhu, L. Effects of fermented feed on growth performance, immune response, and antioxidant capacity in laying hen chicks and the underlying molecular mechanism involving nuclear factor-κB. Poult. Sci. 2020, 99, 2573–2580. [Google Scholar] [CrossRef] [PubMed]
  15. Agyekum, A.; Beaulieu, A.; Pieper, R.; Van Kessel, A.G. Fermentation of barley and wheat with lactic acid bacteria and exogenous enzyme on nutrient composition, microbial count, and fermentative characteristics. Can. J. Anim. Sci. 2020, 101, 106–117. [Google Scholar] [CrossRef]
  16. AOAC. Official Methods of Analysis of AOAC International; Association of Official Analytical Chemists: Rockville, MD, USA, 2023. [Google Scholar]
  17. Van Soest, P.v.; Robertson, J.; Lewis, B. Methods for dietary fiber, neutral detergent fiber, and nonstarch polysaccharides in relation to animal nutrition. J. Dairy Sci. 1991, 74, 3583–3597. [Google Scholar] [CrossRef]
  18. Miller, G.L. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal. Chem. 1959, 31, 426–428. [Google Scholar] [CrossRef]
  19. Kirkpatrick, D.S.; Bishop, S.H. Simplified wet ash procedure for total phosphorus analysis of organophosphonates in biological samples. Anal. Chem. 1971, 43, 1707–1709. [Google Scholar] [CrossRef]
  20. Gao, Y.; Shang, C.; Maroof, M.S.; Biyashev, R.; Grabau, E.; Kwanyuen, P.; Burton, J.; Buss, G. A modified colorimetric method for phytic acid analysis in soybean. Crop Sci. 2007, 47, 1797–1803. [Google Scholar] [CrossRef]
  21. ISO 30024:2009; Animal Feeding Stuffs—Determination of Phytase Activity. International Organization for Standardization: Geneva, Switzerland, 2009.
  22. Aviagen. Ross 308: Broiler’s Management and Nutrition Specification; Aviagen: Huntsville, AL, USA, 2018. [Google Scholar]
  23. Janssen, W. European Table of Energy Values for Poultry Feedstuffs; Spelderholt Center for Poultry Research and Information Services: Beekbergen, The Netherlands, 1989. [Google Scholar]
  24. Souza, O.; Adams, C.; Rodrigues, B.; Krause, A.; Bonamigo, R.; Zavarize, K.; Stefanello, C. The impact of Bacillus subtilis PB6 and chromium propionate on the performance, egg quality and nutrient metabolizability of layer breeders. Animals 2021, 11, 3084. [Google Scholar] [CrossRef]
  25. Zhang, C.; Hao, E.; Chen, X.; Huang, C.; Liu, G.; Chen, H.; Wang, D.; Shi, L.; Xuan, F.; Chang, D. Dietary Fiber Level Improve Growth Performance, Nutrient Digestibility, Immune and Intestinal Morphology of Broilers from Day 22 to 42. Animals 2023, 13, 1227. [Google Scholar] [CrossRef]
  26. Perera, W.; Abdollahi, M.; Zaefarian, F.; Wester, T.; Ravindran, G.; Ravindran, V. Influence of inclusion level of barley in wheat-based diets and supplementation of carbohydrase on growth performance, nutrient utilisation and gut morphometry in broiler starters. Br. Poult. Sci. 2019, 60, 736–748. [Google Scholar] [CrossRef] [PubMed]
  27. Fernández-Puente, E.; Sánchez-Martín, M.A.; de Andrés, J.; Rodríguez-Izquierdo, L.; Méndez, L.; Palomero, J. Expression and functional analysis of the hydrogen peroxide biosensors HyPer and HyPer2 in C2C12 myoblasts/myotubes and single skeletal muscle fibres. Sci. Rep. 2020, 10, 871. [Google Scholar] [CrossRef] [PubMed]
  28. Pranczk, J.; Jacewicz, D.; Wyrzykowski, D.; Chmurzynski, L. Analytical methods for determination of reactive oxygen species. Curr. Pharm. Anal. 2014, 10, 293–304. [Google Scholar] [CrossRef]
  29. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  30. Suvarna, K.S.; Layton, C.; Bancroft, J.D. Bancroft’s Theory and Practice of Histological Techniques; Elsevier: Amsterdam, The Netherlands, 2018. [Google Scholar]
  31. Aptekmann, K.; Artoni, S.B.; Stefanini, M.; Orsi, M. Morphometric analysis of the intestine of domestic quails (Coturnix coturnix japonica) treated with different levels of dietary calcium. Anat. Histol. Embryol. 2001, 30, 277–280. [Google Scholar] [CrossRef]
  32. Sakamoto, K.; Hirose, H.; Onizuka, A.; Hayashi, M.; Futamura, N.; Kawamura, Y.; Ezaki, T. Quantitative study of changes in intestinal morphology and mucus gel on total parenteral nutrition in rats. J. Surg. Res. 2000, 94, 99–106. [Google Scholar] [CrossRef]
  33. Abdollahi, M.; Ravindran, V. Alternative feed ingredients for poultry diets: Challenges and prospects. In Proceedings of the Australian Poultry Science Symposium, Sydney, Australia, 17–20 February 2019; pp. 102–108. [Google Scholar]
  34. Jacob, J.; Pescatore, A. Using barley in poultry diets—A review. J. Appl. Poult. Res. 2012, 21, 915–940. [Google Scholar] [CrossRef]
  35. Amerah, A. Interactions between wheat characteristics and feed enzyme supplementation in broiler diets. Anim. Feed Sci. Technol. 2015, 199, 1–9. [Google Scholar] [CrossRef]
  36. Shi, C.; Zhang, Y.; Lu, Z.; Wang, Y. Solid-state fermentation of corn-soybean meal mixed feed with Bacillus subtilis and Enterococcus faecium for degrading antinutritional factors and enhancing nutritional value. J. Anim. Sci. Biotechnol. 2017, 8, 50. [Google Scholar] [CrossRef]
  37. Cheng, Y.-H.; Hsiao, F.S.-H.; Wen, C.-M.; Wu, C.-Y.; Dybus, A.; Yu, Y.-H. Mixed fermentation of soybean meal by protease and probiotics and its effects on the growth performance and immune response in broilers. J. Appl. Anim. Res. 2019, 47, 339–348. [Google Scholar] [CrossRef]
  38. Azeez, S.O.; Chinma, C.E.; Bassey, S.O.; Eze, U.R.; Makinde, A.F.; Sakariyah, A.A.; Okubanjo, S.S.; Danbaba, N.; Adebo, O.A. Impact of germination alone or in combination with solid-state fermentation on the physicochemical, antioxidant, in vitro digestibility, functional and thermal properties of brown finger millet flours. LWT 2022, 154, 112734. [Google Scholar] [CrossRef]
  39. Stoffel, F.; Santana, W.D.O.; Fontana, R.C.; Gregolon, J.G.N.; Kist, T.B.L.; De Siqueira, F.G.; Mendonça, S.; Camassola, M. Chemical features and bioactivity of grain flours colonized by macrofungi as a strategy for nutritional enrichment. Food Chem. 2019, 297, 124988. [Google Scholar] [CrossRef] [PubMed]
  40. Liu, B.; Lu, H.; Shu, Q.; Chen, Q.; Wang, J. The Influence of Different Pretreatment Methods of Highland Barley by Solid-State Fermentation with Agaricus sinodeliciosus var. Chaidam ZJU-TP-08 on Its Nutrient Content, Functional Properties and Physicochemical Characteristics. J. Fungi 2022, 8, 940. [Google Scholar] [CrossRef] [PubMed]
  41. Dallagnol, A.M.; Pescuma, M.; De Valdez, G.F.; Rollán, G. Fermentation of quinoa and wheat slurries by Lactobacillus plantarum CRL 778: Proteolytic activity. Appl. Microbiol. Biotechnol. 2013, 97, 3129–3140. [Google Scholar] [CrossRef]
  42. Blake, T.; Blake, V.C.; Bowman, J.G.; Abdel-Haleem, H. Barley feed uses and quality improvement. In Barley: Production, Improvement, and Uses; Ministry of Education Ethiopia: Addis Ababa, Ethiopia, 2011; pp. 522–531. [Google Scholar]
  43. Bedford, M.R. The effect of enzymes on digestion. J. Appl. Poult. Res. 1996, 5, 370–378. [Google Scholar] [CrossRef]
  44. Yeh, R.H.; Hsieh, C.W.; Chen, K.L. Screening lactic acid bacteria to manufacture two-stage fermented feed and pelleting to investigate the feeding effect on broilers. Poult. Sci. 2018, 97, 236–246. [Google Scholar] [CrossRef]
  45. Teng, D.; Gao, M.; Yang, Y.; Liu, B.; Tian, Z.; Wang, J. Bio-modification of soybean meal with Bacillus subtilis or Aspergillus oryzae. Biocatal. Agric. Biotechnol. 2012, 1, 32–38. [Google Scholar] [CrossRef]
  46. Xiao, X.; Li, J.; Xiong, H.; Tui, W.; Zhu, Y.; Zhang, J. Effect of extrusion or fermentation on physicochemical and digestive properties of barley powder. Front. Nutr. 2022, 8, 794355. [Google Scholar] [CrossRef]
  47. Yasar, S.; Desen, E.D. Analytical transferability of a universal method to determine in vitro activities of different phytase products in feed and their in vivo efficacies in Japanese quails (Coturnix coturnix japonica). Bull. UASVM Anim. Sci. Biotechnol. 2014, 71, 36–50. [Google Scholar]
  48. Yasar, S.; Tosun, R. Predicting chemical, enzymatic and nutritional properties of fermented barley (Hordeum vulgare L.) by second derivate spectra analysis from attenuated total reflectance—Fourier transform infrared data and its nutritional value in Japanese quails. Arch. Anim. Nutr. 2018, 72, 407–423. [Google Scholar] [CrossRef]
  49. Liu, Y.; Feng, J.; Wang, Y.; Lv, J.; Li, J.; Guo, L.; Min, Y. Fermented corn–soybean meal mixed feed modulates intestinal morphology, barrier functions and cecal microbiota in laying hens. Animals 2021, 11, 3059. [Google Scholar] [CrossRef] [PubMed]
  50. Varsha, K.K.; Priya, S.; Devendra, L.; Nampoothiri, K.M. Control of spoilage fungi by protective lactic acid bacteria displaying probiotic properties. Appl. Biochem. Biotechnol. 2014, 172, 3402–3413. [Google Scholar] [CrossRef] [PubMed]
  51. Canibe, N.; Jensen, B.B. Fermented liquid feed—Microbial and nutritional aspects and impact on enteric diseases in pigs. Anim. Feed Sci. Technol. 2012, 173, 17–40. [Google Scholar] [CrossRef]
  52. Li, L.; Chou, X.; Yang, H. Optimization of fermentation conditions for broiler feed and its application effect. Feed Res. 2019, 491, 19–22. [Google Scholar]
  53. Skrede, G.; Herstad, O.; Sahlstrøm, S.; Holck, A.; Slinde, E.; Skrede, A. Effects of lactic acid fermentation on wheat and barley carbohydrate composition and production performance in the chicken. Anim. Feed Sci. Technol. 2003, 105, 135–148. [Google Scholar] [CrossRef]
  54. Gong, L.; Wang, B.; Mei, X.; Xu, H.; Qin, Y.; Li, W.; Zhou, Y. Effects of three probiotic Bacillus on growth performance, digestive enzyme activities, antioxidative capacity, serum immunity, and biochemical parameters in broilers. Anim. Sci. J. 2018, 89, 1561–1571. [Google Scholar] [CrossRef]
  55. Yaghobfar, A.; Kalantar, M. Effect of non-starch polysaccharide (NSP) of wheat and barley supplemented with exogenous enzyme blend on growth performance, gut microbial, pancreatic enzyme activities, expression of glucose transporter (SGLT1) and mucin producer (MUC2) genes of broiler chickens. Braz. J. Poult. Sci. 2017, 19, 629–638. [Google Scholar]
  56. Horvatovic, M.; Glamocic, D.; Zikic, D.; Hadnadjev, T. Performance and some intestinal functions of broilers fed diets with different inclusion levels of sunflower meal and supplemented or not with enzymes. Braz. J. Poult. Sci. 2015, 17, 25–30. [Google Scholar] [CrossRef]
  57. Perera, W.; Abdollahi, M.; Zaefarian, F.; Wester, T.; Ravindran, V. The effect of graded inclusions of waxy starch hull-less barley and a multi-component exogenous carbohydrase on the growth performance, nutrient digestibility and intestinal morphometry of broiler chickens. Br. Poult. Sci. 2020, 61, 442–453. [Google Scholar] [CrossRef]
  58. Elbaz, A.M.; El-Sheikh, S.E.; Abdel-Maksoud, A. Growth performance, nutrient digestibility, antioxidant state, ileal histomorphometry, and cecal ecology of broilers fed on fermented canola meal with and without exogenous enzymes. Trop. Anim. Health Prod. 2023, 55, 46. [Google Scholar] [CrossRef]
  59. Liu, S.; Du, M.; Tu, Y.; You, W.; Chen, W.; Liu, G.; Li, J.; Wang, Y.; Lu, Z.; Wang, T. Fermented mixed feed alters growth performance, carcass traits, meat quality and muscle fatty acid and amino acid profiles in finishing pigs. Anim. Nutr. 2023, 12, 87–95. [Google Scholar] [CrossRef] [PubMed]
  60. Su, W.; Jiang, Z.; Wang, C.; Zhang, Y.; Gong, T.; Wang, F.; Jin, M.; Wang, Y.; Lu, Z. Co-fermented defatted rice bran alters gut microbiota and improves growth performance, antioxidant capacity, immune status and intestinal permeability of finishing pigs. Anim. Nutr. 2022, 11, 413–424. [Google Scholar] [CrossRef]
  61. Hui, Y.; Tamez-Hidalgo, P.; Cieplak, T.; Satessa, G.D.; Kot, W.; Kjærulff, S.; Nielsen, M.O.; Nielsen, D.S.; Krych, L. Supplementation of a lacto-fermented rapeseed-seaweed blend promotes gut microbial-and gut immune-modulation in weaner piglets. J. Anim. Sci. Biotechnol. 2021, 12, 85. [Google Scholar] [CrossRef]
  62. Lv, J.; Guo, L.; Chen, B.; Hao, K.; Ma, H.; Liu, Y.; Min, Y. Effects of different probiotic fermented feeds on production performance and intestinal health of laying hens. Poult. Sci. 2022, 101, 101570. [Google Scholar] [CrossRef]
  63. Lawal, T.; Iyayi, E.; Adeniyi, B.; Adaramoye, O. Biodegradation of palm kernel cake with multienzyme complexes from fungi and its feeding value for broilers. Int. J. Poult. Sci. 2010, 9, 695–701. [Google Scholar] [CrossRef]
  64. Khalil, M.; Abdollahi, M.; Zaefarian, F.; Chrystal, P.; Ravindran, V. Apparent metabolizable energy of cereal grains for broiler chickens is influenced by age. Poult. Sci. 2021, 100, 101288. [Google Scholar] [CrossRef] [PubMed]
  65. McNab, J.; Smithard, R. Barley β-glucan: An antinutritional factor in poultry feeding. Nutr. Res. Rev. 1992, 5, 45–60. [Google Scholar] [CrossRef]
  66. Peng, W.; Talpur, M.Z.; Zeng, Y.; Xie, P.; Li, J.; Wang, S.; Wang, L.; Zhu, X.; Gao, P.; Jiang, Q. Influence of fermented feed additive on gut morphology, immune status, and microbiota in broilers. BMC Vet. Res. 2022, 18, 218. [Google Scholar] [CrossRef]
  67. Drażbo, A.; Ognik, K.; Zaworska, A.; Ferenc, K.; Jankowski, J. The effect of raw and fermented rapeseed cake on the metabolic parameters, immune status, and intestinal morphology of turkeys. Poult. Sci. 2018, 97, 3910–3920. [Google Scholar] [CrossRef]
  68. Peng, W.; Talpur, M.Z.; Zeng, Y.; Xie, P.; Li, J.; Wang, S.; Wang, L.; Zhu, X.; Gao, P.; Jiang, Q. Effect of fermented feed additive on the broilers’ histology/morphology of the GIT, immune status, and microbiota. Res. Sq. 2021, preprint. [Google Scholar] [CrossRef]
  69. El-Sanhoury, M.; Ahmed, A. Broiler performance, enzymes activity and histological observations affected by multi enzymes complex (ZADO®). Egypt. J. Nutr. Feed. 2017, 20, 309–320. [Google Scholar] [CrossRef][Green Version]
  70. El-Ghamry, A.; Al-Harthi, M.; Attia, Y. Possibility to improve rice polishing utilisation in broiler diets by enzymes or dietary formulation based on digestible amino acids. Arch. Geflugelk. 2005, 69, 49–56. [Google Scholar]
  71. Bedford, M.R. The evolution and application of enzymes in the animal feed industry: The role of data interpretation. Br. Poult. Sci. 2018, 59, 486–493. [Google Scholar] [CrossRef] [PubMed]
  72. González-Ortiz, G.; Kozłowski, K.; Drażbo, A.; Bedford, M.R. Response of turkeys fed wheat-barley-rye based diets to xylanase supplementation. Anim. Feed Sci. Technol. 2017, 229, 117–123. [Google Scholar] [CrossRef]
  73. Kanhar, A.R.; Hussain, S.F.; Shar, A.H.; Ujjan, J.A. Isolation of A Novel Bacterial Strain Planococcus Plakortidi from Ross Broiler Chicken Gut (CECUM) with Combination of Non-Starch Polysaccride Degrading Pectinase Enzyme. Pak. J. Med. Health Sci. 2022, 16, 962. [Google Scholar] [CrossRef]
  74. Perera, W.N.U.; Abdollahi, M.R.; Zaefarian, F.; Wester, T.J.; Ravindran, V. Barley, an undervalued cereal for poultry diets: Limitations and opportunities. Animals 2022, 12, 2525. [Google Scholar] [CrossRef]
  75. Alagawany, M.; Elnesr, S.S.; Farag, M. The role of exogenous enzymes in promoting growth and improving nutrient digestibility in poultry. Iran. J. Vet. Res. 2018, 19, 157. [Google Scholar]
  76. Lijie, Y.; Xiangfang, Z.; Shiyan, Q. Research progress of non starch polysaccharides in the regulation of intestinal flora in pigs. Biotechnol. Bull. 2020, 36, 9–16. [Google Scholar]
  77. Ruhnke, I.; Röhe, I.; Goodarzi Boroojeni, F.; Knorr, F.; Mader, A.; Hafeez, A.; Zentek, J. Feed supplemented with organic acids does not affect starch digestibility, nor intestinal absorptive or secretory function in broiler chickens. J. Anim. Physiol. Anim. Nutr. 2015, 99, 29–35. [Google Scholar] [CrossRef]
  78. Saleh, A.A.; El-Far, A.H.; Abdel-Latif, M.A.; Emam, M.A.; Ghanem, R.; Abd El-Hamid, H.S. Exogenous dietary enzyme formulations improve growth performance of broiler chickens fed a low-energy diet targeting the intestinal nutrient transporter genes. PLoS ONE 2018, 13, e0198085. [Google Scholar] [CrossRef]
  79. Ferraris, R.P. Dietary and developmental regulation of intestinal sugar transport. Biochem. J. 2001, 360, 265–276. [Google Scholar] [CrossRef] [PubMed]
  80. Lee, S.A.; Wiseman, J.; Masey O’Neill, H.V.; Scholey, D.V.; Burton, E.J.; Hill, S.E. Understanding the direct and indirect mechanisms of xylanase action on starch digestion in broilers. J. World’s Poult. Res. 2017, 7, 35–47. [Google Scholar]
  81. Hosseini, S.M.; Manafi, M.; Nazarizadeh, H. Effects of xylanase supplementation and citric acid on performance, ileal nutrients digestibility, and gene expression of intestinal nutrient transporters in broilers challenged with Clostridium perfringens. J. Poult. Sci. 2017, 54, 149–156. [Google Scholar] [CrossRef] [PubMed]
  82. Kumar, N.; Arthur, C.P.; Ciferri, C.; Matsumoto, M.L. Structure of the secretory immunoglobulin A core. Science 2020, 367, 1008–1014. [Google Scholar] [CrossRef] [PubMed]
  83. Gharib-Naseri, K.; de Paula Dorigam, J.C.; Doranalli, K.; Kheravii, S.; Swick, R.A.; Choct, M.; Wu, S.-B. Modulations of genes related to gut integrity, apoptosis, and immunity underlie the beneficial effects of Bacillus amyloliquefaciens CECT 5940 in broilers fed diets with different protein levels in a necrotic enteritis challenge model. J. Anim. Sci. Biotechnol. 2020, 11, 104. [Google Scholar] [CrossRef]
  84. Johansson, M.E.; Larsson, J.M.H.; Hansson, G.C. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host–microbial interactions. Proc. Natl. Acad. Sci. USA 2011, 108, 4659–4665. [Google Scholar] [CrossRef] [PubMed]
  85. Schneeberger, E.E.; Lynch, R.D. The tight junction: A multifunctional complex. Am. J. Physiol. Cell Physiol. 2004, 286, C1213–C1228. [Google Scholar] [CrossRef]
  86. Awad, W.A.; Hess, C.; Hess, M. Enteric pathogens and their toxin-induced disruption of the intestinal barrier through alteration of tight junctions in chickens. Toxins 2017, 9, 60. [Google Scholar] [CrossRef]
  87. Farahat, M.; Ibrahim, D.; Kishawy, A.; Abdallah, H.; Hernandez-Santana, A.; Attia, G. Effect of cereal type and plant extract addition on the growth performance, intestinal morphology, caecal microflora, and gut barriers gene expression of broiler chickens. Animal 2021, 15, 100056. [Google Scholar] [CrossRef]
  88. Sohail, M.U.; Ijaz, A.; Younus, M.; Shabbir, M.Z.; Kamran, Z.; Ahmad, S.; Anwar, H.; Yousaf, M.S.; Ashraf, K.; Shahzad, A. Effect of supplementation of mannan oligosaccharide and probiotic on growth performance, relative weights of viscera, and population of selected intestinal bacteria in cyclic heat-stressed broilers. J. Appl. Poult. Res. 2013, 22, 485–491. [Google Scholar] [CrossRef]
  89. Kong, X.; Wu, G.; Liao, Y.; Hou, Z.; Liu, H.; Yin, F.; Li, T.; Huang, R.; Zhang, Y.; Deng, D. Dietary supplementation with Chinese herbal ultra-fine powder enhances cellular and humoral immunity in early-weaned piglets. Livest. Sci. 2007, 108, 94–98. [Google Scholar] [CrossRef]
  90. Kishawy, A.T.; Al-Khalaifah, H.S.; Nada, H.S.; Roushdy, E.M.; Zaglool, A.W.; Ahmed Ismail, T.; Ibrahim, S.M.; Ibrahim, D. Black Pepper or Radish Seed Oils in a New Combination of Essential Oils Modulated Broiler Chickens’ Performance and Expression of Digestive Enzymes, Lipogenesis, Immunity, and Autophagy-Related Genes. Vet. Sci. 2022, 9, 43. [Google Scholar] [CrossRef] [PubMed]
  91. Li, L.; Li, W.; Liu, S.; Wang, H. Probiotic fermented feed improved the production, health and nutrient utilisation of yellow-feathered broilers reared in high altitude in Tibet. Br. Poult. Sci. 2020, 61, 746–753. [Google Scholar] [CrossRef] [PubMed]
  92. Tang, J.; Sun, H.; Yao, X.; Wu, Y.; Wang, X.; Feng, J. Effects of replacement of soybean meal by fermented cottonseed meal on growth performance, serum biochemical parameters and immune function of yellow-feathered broilers. Asian-Australas. J. Anim. Sci. 2012, 25, 393. [Google Scholar] [CrossRef] [PubMed]
  93. Wu, Q.; Wang, Z.; Wang, G.; Li, Y.; Qi, Y. Effects of feed supplemented with fermented pine needles (Pinus ponderosa) on growth performance and antioxidant status in broilers. Poult. Sci. 2015, 94, 1138–1144. [Google Scholar] [CrossRef] [PubMed]
  94. Xu, F.; Zeng, X.; Ding, X. Effects of replacing soybean meal with fermented rapeseed meal on performance, serum biochemical variables and intestinal morphology of broilers. Asian-Australas J. Anim. Sci. 2012, 25, 1734. [Google Scholar] [CrossRef] [PubMed]
  95. Wu, Y.; Zhen, W.; Geng, Y.; Wang, Z.; Guo, Y. Effects of dietary Enterococcus faecium NCIMB 11181 supplementation on growth performance and cellular and humoral immune responses in broiler chickens. Poult. Sci. 2019, 98, 150–163. [Google Scholar] [CrossRef]
  96. Zhu, X.; Tao, L.; Liu, H.; Yang, G. Effects of fermented feed on growth performance, immune organ indices, serum biochemical parameters, cecal odorous compound production, and the microbiota community in broilers. Poult. Sci. 2023, 102, 102629. [Google Scholar] [CrossRef]
  97. Wells, S.M.; Holian, A. Asymmetric dimethylarginine induces oxidative and nitrosative stress in murine lung epithelial cells. Am. J. Respir. Cell Mol. Biol. 2007, 36, 520–528. [Google Scholar] [CrossRef]
  98. Berndt, C.; Lillig, C.H. Glutathione, glutaredoxins, and iron. Antioxid. Redox Signal. 2017, 27, 1235–1251. [Google Scholar] [CrossRef]
  99. Son, H.-K.; Kang, S.-T.; Lee, J.-J. Effects of Peucedanum japonicum Thunb. on lipid metabolism and antioxidative activities in rats fed a high-fat/high-cholesterol diet. J. Korean Soc. Food Sci. Nutr. 2014, 43, 641–649. [Google Scholar] [CrossRef]
  100. Mayahi, M.; Jalali, M.R.; Kiani, R. Effects of dietary probiotic supplementation on cholesterol and triglyceride levels in broiler chicks’ sera. In Proceedings of the World Poultry Science Association (WPSA), 2nd Mediterranean Summit of WPSA, Antalya, Turkey, 4–7 October 2009; pp. 4–7. [Google Scholar]
  101. Klaver, F.; Van der Meer, R. The assumed assimilation of cholesterol by Lactobacilli and Bifidobacterium bifidum is due to their bile salt-deconjugating activity. Appl. Environ. Microbiol. 1993, 59, 1120–1124. [Google Scholar] [CrossRef] [PubMed]
  102. Sugiharto, S.; Yudiarti, T.; Isroli, I.; Widiastuti, E.; Wahyuni, H.I.; Sartono, T.A. Fermented feed as a potential source of natural antioxidants for broiler chickens—A mini review. Agric. Conspec. Sci. 2019, 84, 313–318. [Google Scholar]
  103. Ibrahim, D.; Kishawy, A.T.; Khater, S.I.; Hamed Arisha, A.; Mohammed, H.A.; Abdelaziz, A.S.; El-Rahman, A.; Ghada, I.; Elabbasy, M.T. Effect of dietary modulation of selenium form and level on performance, tissue retention, quality of frozen stored meat and gene expression of antioxidant status in Ross broiler chickens. Animals 2019, 9, 342. [Google Scholar] [CrossRef] [PubMed]
  104. Kishawy, A.T.; Ibrahim, D.; Roushdy, E.M.; Moustafa, A.; Eldemery, F.; Hussein, E.M.; Hassan, F.A.; Elazab, S.T.; Elabbasy, M.T.; Kanwal, R. Impact of resveratrol-loaded liposomal nanocarriers on heat-stressed broiler chickens: Effects on performance, sirtuin expression, oxidative stress regulators, and muscle building factors. Front. Vet. Sci. 2023, 10, 1137896. [Google Scholar] [CrossRef] [PubMed]
  105. Wang, Y.; Deng, Q.; Song, D.; Wang, W.; Zhou, H.; Wang, L.; Li, A. Effects of fermented cottonseed meal on growth performance, serum biochemical parameters, immune functions, antioxidative abilities, and cecal microflora in broilers. Food Agric. Immunol. 2017, 28, 725–738. [Google Scholar] [CrossRef]
  106. Martins, S.; Mussatto, S.I.; Martínez-Avila, G.; Montañez-Saenz, J.; Aguilar, C.N.; Teixeira, J.A. Bioactive phenolic compounds: Production and extraction by solid-state fermentation. A review. Biotechnol. Adv. 2011, 29, 365–373. [Google Scholar] [CrossRef]
  107. Sumida, S.; Tanaka, K.; Kitao, H.; Nakadomo, F. Exercise-induced lipid peroxidation and leakage of enzymes before and after vitamin E supplementation. Int. J. Biochem. 1989, 21, 835–838. [Google Scholar]
  108. Lin, C.-H.; Wei, Y.-T.; Chou, C.-C. Enhanced antioxidative activity of soybean koji prepared with various filamentous fungi. Food Microbiol. 2006, 23, 628–633. [Google Scholar] [CrossRef]
  109. Deng, G.; Wang, J.; Zhang, Q.; He, H.; Wu, F.; Feng, T.; Zhou, J.; Zou, K.; Hattori, M. Hepatoprotective effects of phloridzin on hepatic fibrosis induced by carbon tetrachloride against oxidative stress-triggered damage and fibrosis in rats. Biol. Pharm. Bull. 2012, 35, 1118–1125. [Google Scholar] [CrossRef]
  110. Yang, J.; Wu, X.-B.; Chen, H.-L.; Sun-waterhouse, D.; Zhong, H.-B.; Cui, C. A value-added approach to improve the nutritional quality of soybean meal byproduct: Enhancing its antioxidant activity through fermentation by Bacillus amyloliquefaciens SWJS22. Food Chem. 2019, 272, 396–403. [Google Scholar] [CrossRef] [PubMed]
  111. Liu, S.; Yan, W.; Ma, C.; Liu, Y.; Gong, L.; Levesque, C.; Dong, B. Effects of supplemented culture media from solid-state fermented Isaria cicadae on performance, serum biochemical parameters, serum immune indexes, antioxidant capacity and meat quality of broiler chickens. Asian-Australas. J. Anim. Sci. 2020, 33, 568. [Google Scholar] [CrossRef] [PubMed]
  112. El-Ghareeb, W.R.; Kishawy, A.T.; Anter, R.G.; Aboelabbas Gouda, A.; Abdelaziz, W.S.; Alhawas, B.; Meligy, A.M.; Abdel-Raheem, S.M.; Ismail, H.; Ibrahim, D. Novel Antioxidant Insights of Myricetin on the Performance of Broiler Chickens and Alleviating Experimental Infection with Eimeria spp.: Crosstalk between Oxidative Stress and Inflammation. Antioxidants 2023, 12, 1026. [Google Scholar] [CrossRef]
  113. Ibrahim, D.; Sewid, A.H.; Arisha, A.H.; Abd El-Fattah, A.H.; Abdelaziz, A.M.; Al-Jabr, O.A.; Kishawy, A.T. Influence of Glycyrrhiza glabra Extract on Growth, Gene Expression of Gut Integrity, and Campylobacter jejuni Colonization in Broiler Chickens. Front. Vet. Sci 2020, 7, 612063. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Effects of different levels of microbially fermented barley treated with exogenous enzymes (FBEs) on the expression of duodenal genes (GLUT1, Cationic amino acid transporter-1 (CAT-1), L-type amino acid transporter-1 (LAT2) and Peptide transporter-1 (PEPT1)). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–d Means within the equivalent column with dissimilar superscripts are significantly diverse (p < 0.050).
Figure 1. Effects of different levels of microbially fermented barley treated with exogenous enzymes (FBEs) on the expression of duodenal genes (GLUT1, Cationic amino acid transporter-1 (CAT-1), L-type amino acid transporter-1 (LAT2) and Peptide transporter-1 (PEPT1)). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–d Means within the equivalent column with dissimilar superscripts are significantly diverse (p < 0.050).
Vetsci 10 00594 g001
Figure 2. Effects of different levels of fermented and enzymatically treated barley grains (FBEs) on the expression of duodenal tight junction genes JAM (junctional adhesion molecule-2, (A)), occluding (B), claudin-1 (C), MUC-2 ((D), mucin-2) and β-defensin-1 (E). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–c Means within the equivalent column carrying dissimilar superscripts are significantly diverse (p < 0.050).
Figure 2. Effects of different levels of fermented and enzymatically treated barley grains (FBEs) on the expression of duodenal tight junction genes JAM (junctional adhesion molecule-2, (A)), occluding (B), claudin-1 (C), MUC-2 ((D), mucin-2) and β-defensin-1 (E). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–c Means within the equivalent column carrying dissimilar superscripts are significantly diverse (p < 0.050).
Vetsci 10 00594 g002
Figure 3. Effects of feeding different levels of fermented and enzymatically treated barley grains (FBEs) on duodenal histomorphological architectures. (A) Control: Intestine showed normal intestinal villi, lamina propria, submucosa, intestinal glands and muscular layer; (B) FBEs5%-fed birds: Sections from intestine showed apparently normal intestinal villi, submucosa and muscular layer; (C) FBEs10%-fed birds: showed an increased activity of columnar lining epithelium of villi, normal lamina propria, submucosa, muscular layer and serosa; (D) FBEs15%-fed birds: intestine showed apparent normal intestinal layers with numerous and hyperactive intestinal glands. H&E 10×.
Figure 3. Effects of feeding different levels of fermented and enzymatically treated barley grains (FBEs) on duodenal histomorphological architectures. (A) Control: Intestine showed normal intestinal villi, lamina propria, submucosa, intestinal glands and muscular layer; (B) FBEs5%-fed birds: Sections from intestine showed apparently normal intestinal villi, submucosa and muscular layer; (C) FBEs10%-fed birds: showed an increased activity of columnar lining epithelium of villi, normal lamina propria, submucosa, muscular layer and serosa; (D) FBEs15%-fed birds: intestine showed apparent normal intestinal layers with numerous and hyperactive intestinal glands. H&E 10×.
Vetsci 10 00594 g003
Table 1. Levels of ingredients and nutrients in diets throughout the starter phase (as fed basis).
Table 1. Levels of ingredients and nutrients in diets throughout the starter phase (as fed basis).
IngredientsControlFBEs5%FBEs10%FBEs15%
Yellow corn58.8055.3050.3045.80
Soybean meal, 48% CP34.0032.5032.5032.00
Corn gluten1.201.201.201.20
FBEs 1-5.0010.0015.00
Soybean oil1.801.801.801.80
Calcium carbonate1.201.201.201.20
Calcium diphasic phosphate1.501.501.501.50
Common salt0.300.300.300.30
Premix 20.300.300.300.30
L-Lysine0.350.350.350.35
DL-Methionine0.250.250.250.25
Choline chloride0.200.200.200.20
Anti-mycotoxin0.100.100.100.10
Analyzed and calculated composition
Metabolizable energy (kcal/kg) 33048303830153000
Crude protein (%)23.4023.0723.1623.06
Ether extract%4.284.224.124.03
Crude fiber (%)2.632.672.702.75
Calcium (%)1.041.041.031.03
Available phosphorous (%)0.460.490.540.57
Lysine (%)1.331.301.301.29
Methionine (%)0.580.580.570.57
1 FBEs (microbially and enzymatically fermented barley), FBEs5% (dietary inclusion of 5% microbially and enzymatically fermented barley), FBEs10% (dietary inclusion of 10% microbially and enzymatically fermented barley), FBEs15% (dietary inclusion of 15% microbially and enzymatically fermented barley). 2 Vitamin premix supplied per kilogram of diet: vitamin A, 10,000 IU; vitamin D3, 2000 IU; vitamin E, 6500 IU; vitamin K3, 1 mg; vitamin B1, 2560 mg; vitamin B2, 5000 mg; vitamin B6, 1500 mg; B5, 8 mg; niacin, 20,000 mg; biotin, 0.25 mg; folic acid, 1000 mg; vitamin B12, 60 mg; Cu, 8 mg; Fe, 80 mg; Mn, 60 mg; Zn, 40 mg; Se, 0.15 mg. 3 Calculated based on Janssen’s equation [23].
Table 2. Levels of ingredients and nutrients in diets throughout the grower phase (as fed basis).
Table 2. Levels of ingredients and nutrients in diets throughout the grower phase (as fed basis).
IngredientsControlFBEs5%FBEs10%FBEs15%
Yellow corn63.3059.3055.2050.80
Soybean meal, 48% CP27.9026.9026.0025.40
Corn gluten2.002.002.002.00
FBEs 1-5.0010.0015.00
Soybean oil2.502.502.502.50
Calcium carbonate1.201.201.201.20
Calcium diphasic phosphate1.501.501.501.50
Common salt0.300.300.300.30
Premix 20.300.300.300.30
L-Lysine0.450.450.450.45
DL-Methionine0.250.250.250.25
Choline chloride0.200.200.200.20
Anti-mycotoxin0.100.100.100.10
Analyzed and calculated composition
Metabolizable energy (kcal/kg) 33122312831133105
Crude protein (%)21.3021.3021.1420.95
Ether extract%5.015.014.934.85
Crude fiber (%)2.522.562.602.63
Calcium (%)1.021.021.021.01
Available phosphorous (%)0.500.540.580.62
Lysine (%)1.251.251.231.22
Methionine (%)0.560.560.570.55
1 FBEs (microbially and enzymatically fermented barley), FBEs5% (dietary inclusion of 5% microbially and enzymatically fermented barley), FBEs10% (dietary inclusion of 10% microbially and enzymatically fermented barley), FBEs15% (dietary inclusion of 15% microbially and enzymatically fermented barley). 2 Vitamin premix supplied per kilogram of diet: vitamin D3, 2500 IU; vitamin A, 20,000 IU; vitamin E, 6500 IU; vitamin K3, 1.4 mg; vitamin B1, 2580 mg; vitamin B2, 3500 mg; vitamin B6, 1900 mg; B5, 11 mg; niacin, 20,000 mg; biotin, 0.45 mg; folic acid, 1000 mg; vitamin B12, 66 mg; Cu, 9 mg; Fe, 85 mg; Mn, 60 mg; Zn, 46 mg; Se, 0.15 mg. 3 Calculated based on Janssen’s equation [23].
Table 3. Levels of ingredients and nutrients in diets throughout the finisher stage (as fed basis).
Table 3. Levels of ingredients and nutrients in diets throughout the finisher stage (as fed basis).
IngredientsControlFBEs5%FBEs10%FBEs15%
Yellow corn68.0063.0059.0054.90
Soybean meal, 48% CP21.9021.9021.0020.00
Corn gluten2.502.502.502.50
FBEs 1-5.0010.0015.00
Soybean oil3.403.403.403.40
Calcium carbonate1.201.201.201.20
Calcium diphasic phosphate1.501.501.501.50
Common salt0.300.300.300.30
Premix 20.300.300.300.300
L-Lysine0.350.350.350.35
DL-Methionine0.250.250.250.25
Choline chloride0.200.200.200.20
Anti-mycotoxin0.100.100.100.100
Analyzed and calculated composition
Metabolizable energy (kcal/kg) 33214320532093199
Crude protein (%)19.4719.5619.3219.15
Ether extract%6.085.955.905.83
Crude fiber (%)2.412.472.502.53
Calcium (%)1.011.011.011.00
Available phosphorous (%)0.440.470.500.52
Lysine (%)1.051.051.051.03
Methionine (%)0.540.540.540.50
1 FBEs (microbially and enzymatically fermented barley), FBEs5% (dietary inclusion of 5% microbially and enzymatically fermented barley), FBEs10% (dietary inclusion of 10% microbially and enzymatically fermented barley), FBEs15% (dietary inclusion of 15% microbially and enzymatically fermented barley). 2 Vitamin premix supplied per kilogram of diet: vitamin D3, 2500 IU; vitamin A, 20,000 IU; vitamin E, 6500 IU; vitamin K3, 1.4 mg; vitamin B1, 2580 mg; vitamin B2, 3500 mg; vitamin B6, 1900 mg; B5, 11 mg; niacin, 20,000 mg; biotin, 0.45 mg; folic acid, 1000 mg; vitamin B12, 66 mg; Cu, 9 mg; Fe, 85 mg; Mn, 60 mg; Zn, 46 mg; Se, 0.15 mg. 3 Calculated based on Janssen’s equation [23].
Table 4. Primer sequences of targeted genes used for RT-qPCR.
Table 4. Primer sequences of targeted genes used for RT-qPCR.
Encoding GenePrimer Sequence (5′–3′)Accession No.
Barrier functions
β-Defensin-1F: AAACCATTGTCAGCCCTGTG
R: TTCCTAGAGCCTGGGAGGAT
NM_204993.1
MUC-2F: AAACAACGGCCATGTTTCAT
R: GTGTGACACTGGTGTGCTGA
NM_001318434
CLDN-1F: GGTGAAGAAGATGCGGATGG
R: TCTGGTGTTAACGGGTGTGA
NM_001013611
OccludinF: ACGGCAAAGCCAACATCTAC
R: ATCCGCCACGTTCTTCAC
XM_031604121.1
JAM-2F: AGACAGGAACAGGCAGTGCT
R: TCCAATCCCATTTGAGGCTA
XM_031556661.1
Nutrient transporters
GLUT1F: ACAACACCG GCGTCATCAA
R: TTGACATCAGCATGGAGTTACG
NM_205209.1
CAT1F: ATGTAGGTTGGGATGGAGCC
R: AACGAGTAAGCCAGGAGGGT
XM_015277949.1
LAT1F: CTCTCTCTCATCATCTGGGC
R: TCATTCCTGGGTCTGTTGCT
XM_415975
PepT1F: TTTCCTTTACATCCCTCTCC
R:TCACTTCTACTCTCACTC
NM-204365
House keeping
GAPDHF: CAACCCCCAATGTCTCTGTT
R: TCAGCAGCAGCCTTCACTAC
NM205518
TBPF: GTCCACGGTGAATCTTGGTT
R: GCGCAGTAGTACGTGGTTCTC
Acc:8484
β-Defensin-1: beta defensin-1; CLDN-1: claudins-1; MUC-2: mucin-2; JAM-2: junctional adhesion molecule-2; GLUT1, glucose transporter-1; CAT1: Cationic amino acid transporter-2; LAT1: L-type amino acid transporter-1; PepT1: peptide transporter-1; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; TBP: TATA-binding protein.
Table 5. Chemical analysis of unfermented barley (UFB) and fermented barley treated with exogenous enzymes (FBEs).
Table 5. Chemical analysis of unfermented barley (UFB) and fermented barley treated with exogenous enzymes (FBEs).
ParameterUFB 1FBEs 2SEMp-Value
Dry matter (%)89.60 b90.90 a0.39<0.030
Crude protein (%)10.75 b11.92 a0.11<0.001
Crude fiber (%)5.30 a3.25 b0.390.040
Ether extract (%)1.701.620.330.060
Lignin (%)12.23 a8.96 b0.24<0.001
Cellulose (%)14.69 a10.35 b0.77<0.001
Hemicellulose (%)27.19 a28.22 b0.31<0.006
Neutral detergent fiber (%)54.11 a47.53 b0.27<0.001
Acid detergent fiber (%)26.96 a19.31 b0.370.030
Reduced sugar (g/100 g)2.36 b8.19 a0.680.020
pH6.25 a4.25 b0.15<0.006
Total lactic acid bacteria (log CFU/g feed)4.57 b7.96 a0.50<0.001
Bacillus spp. log CFU/g feed3.96 b6.33 a0.35<0.001
Non-phytate phosphorus (g/kg)2.03 b2.82 a 0.16<0.007
Phytase activity (FTU/kg)59.36 b225.51 a0.83<0.001
1 UFB (unfermented barley), 2 FBEs (microbially and enzymatically fermented barley). Values are specified as means ± standard error. Number of replicates analyzed = 5. CFU (colony forming unit). a,b Means within the equivalent row with dissimilar superscripts express statistical variance (p < 0.050).
Table 6. Evaluating the growth performance parameters (days 1–38) of broiler chickens fed different levels of microbially fermented barley treated with fibrolytic exogenous enzymes.
Table 6. Evaluating the growth performance parameters (days 1–38) of broiler chickens fed different levels of microbially fermented barley treated with fibrolytic exogenous enzymes.
ItemControlFBEs5%FBEs10%FBEs15%SEMp-Value
Starter (1–10 days)
Initial BW44.3346.0045.0046.330.960.280
BW (g/bird)307 b310 b335 a299 b13.360.020
BWG (g/bird)262 b264 b290 a252 b14.350.004
FCR1.39 a1.38 a1.24 b1.44 a0.010.007
FI (g/bird)36536435936312.470.480
Grower (11–20 days)
BW (g/bird)1157 b1176 b1221 a1181 b6.30<0.001
BWG (g/bird)850 b865 ab 886 a882 a8.40<0.001
FCR1.79 a1.74 a1.64 b1.67 b0.02<0.001
FI (g/bird)1521 a1507 ab1449 b1467 ab3.510.020
Finisher (21–38 days)
BW (g/bird)2532 c2597 b2650 a2588 b12.83<0.001
BWG (g/bird)1376 c1421 ab1429 a1407 b9.200.010
FCR1.83 a1.75 b1.71 c1.76 b<0.001<0.001
FI (g/bird)2512 a2486 ab2447 b2480 ab2.60<0.001
Overall (1–38 days)
BWG (g/bird)2488 c2551 b2605 a2541 b12.390.030
FI (g/bird)4398 a4357 ab4255 c4301 bc11.320.020
FCR1.77 a1.71 b1.63 c1.69 b0.01<0.001
BW: body weight; BWG: body weight gain; FI: feed intake; FCR: feed conversion ratio. Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–c Means within the equivalent row with dissimilar superscripts express statistical variance (p < 0.050).
Table 7. Evaluating the total tract metabolizability and digestive enzymes’ activities of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
Table 7. Evaluating the total tract metabolizability and digestive enzymes’ activities of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
ItemControlFBEs5%FBEs10%FBEs15%SEMp-Value
Nutrients metabolizability (%)
Dry matter78.99 c81.78 b83.26 a82.00 b0.630.001
Crude protein72.12 c74.36 b76.36 a74.12 b0.750.020
Crude fiber22.99 c25.56 b27.36 a25.24 b0.830.030
Phosphorus48.69 d54.66 c60.36 b65.47 a0.290.040
Duodenal pH 6.12 a5.64 b5.42 bc5.12 c0.130.030
Jejunal digesta viscosity3.653.693.523.720.110.060
Digestive enzymes (U/mg protein)
Lipase30.93 b36.68 a37.53 a38.07 a0.440.001
Amylase140.57 b145.60 a149.33 a146.27 a1.290.001
Trypsin410 c469 b475 b492 a4.080.030
Chymotrypsin12.80 c15.30 b16.40 ab20.91 a0.240.010
Maltase153 c155 b163 a165 a1.320.001
Sucrase54.10 c58.90 b60.40 a61.40 a0.0.120.010
Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–d Means within the equivalent row with dissimilar superscripts express statistical variance (p < 0.050).
Table 8. Evaluating the biochemical and immune-related markers of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
Table 8. Evaluating the biochemical and immune-related markers of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
ItemControlFBEs5%FBEs10%FBEs15%SEMp-Value
IgM (ng/L)2.10 b0.553.60 ab3.77 a0.550.020
IgG (ng/L)1.83 b0.382.35 ab2.60 a0.380.090
Lysozyme (U/mL)109.43 c3.30116.73 ab118.63 a3.30<0.001
NO (μmol/L)4.37 a0.264.10 ab3.87 b0.26<0.001
Uric acid (mg/dL)11.700.1111.2011.430.110.060
Creatinine (mg/dL)0.630.050.580.570.050.030
ALT (U/L)11.670.0511.8711.670.050.090
AST (U/L)56.675.3156.2357.535.310.120
Cholesterol (mg/dL)149.17 a2.63145.60 a140.57 b2.630.020
Triglycerides (mg/dL)89.23 a4.2888.20 ab81.63 b4.28<0.001
HDL-c (mg/dL)34.33 b1.8237.53 ab38.07 a1.820.030
LDL-c (mg/dL)80.90 a2.0474.49 a66.44 b2.040.060
IgM: immunoglobulin M; IgG: immunoglobulin G; NO: nitric oxide; ALT: alanine transaminase; AST: aspartate transaminase; HDL-C: high-density lipoprotein cholesterol; LDL-C: low-density lipoprotein cholesterol; VLDL-C: very-low-density lipoprotein cholesterol. Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–c Means within the equivalent row with dissimilar superscripts express statistical variance (p < 0.050).
Table 9. Evaluating the redox status of broiler chickens’ intestinal tissues and breast muscle fed with different levels of microbially fermented barley treated with exogenous enzymes.
Table 9. Evaluating the redox status of broiler chickens’ intestinal tissues and breast muscle fed with different levels of microbially fermented barley treated with exogenous enzymes.
ItemControlFBEs5%FBEs10%FBEs15%SEMp-Value
Intestinal tissues
GSH-Px (U/mg protein)144.10 b151.01 b150.47 b163.01 a1.12<0.001
SOD (U/mg protein)20.27 b21.03 b22.06 ab23.80 a1.060.010
Catalase (U/mg protein)15.80 c18.20 c25.13 b25.08 a0.93<0.001
T-AOC (U/mg protein)1.59 c1.56 c1.71 b1.83 a0.26<0.001
ROS (μL/g tissue)6.31 a5.50 b5.10 bc4.86 c0.390.030
H2O2 (μmoL/g tissue)3.96 a3.60 b3.41 bc3.08 c0.11<0.001
Malondialdehyde (nmoL/mL)6.50 a6.07 a5.21 b4.45 c0.220.030
Breast muscle
GSH-Px (U/mg protein)152.83 d155.03 c160.07 b168.33 a0.860.030
SOD (U/mg protein)36.40 d50.40 c59.43 b66.07 a0.12<0.001
Catalase (U/mg protein)10.17 d12.87 c13.97 b15.90 a0.210.030
T-AOC (U/mg protein)1.80 b2.13 ab2.53 a2.50 a0.110.010
ROS7.86 a5.63 b4.99 bc4.20 c0.090.230
H2O2 (μmoL/g tissue)3.89 a3.72 b3.12 c3.10 c1.200.120
Malondialdehyde (nmoL/mL)7.50 a7.30 ab6.10 ab5.37 b0.630.290
Total antioxidant capacity (T-AOC), superoxide dismutase (SOD), reactive oxygen species (ROS), glutathione (GSH-Px), hydrogen peroxide (H2O2). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes). a–d Means within the equivalent row with dissimilar superscripts express statistical variance (p < 0.050).
Table 10. Evaluating the intestinal morphology of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
Table 10. Evaluating the intestinal morphology of broiler chickens fed with different levels of microbially fermented barley treated with exogenous enzymes.
ItemControlFBEs5%FBEs10%FBEs15%SEMp-Value
Intestinal tissues
Villus height duodenum, µm1166 c1229 c1245 a1233 a1.12<0.001
Crypt depth duodenum, µm254.33 d215.32 c182.67 b195.00 a1.060.010
Villus height: Crypt depth4.58 d5.71 c6.82 b6.33 a0.93<0.001
a–d Means within the same row with dissimilar superscripts express statistical variance (p < 0.050). Control: birds fed on basal diet; FBEs5% (birds fed dietary 5% microbially fermented barley treated with exogenous enzymes), FBEs10% (birds fed dietary 10% microbially fermented barley treated with exogenous enzymes), FBEs15% (birds fed dietary 15% microbially fermented barley treated with exogenous enzymes).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ibrahim, D.; El-sayed, H.I.; Mahmoud, E.R.; El-Rahman, G.I.A.; Bazeed, S.M.; Abdelwarith, A.A.; Elgamal, A.; Khalil, S.S.; Younis, E.M.; Kishawy, A.T.Y.; et al. Impacts of Solid-State Fermented Barley with Fibrolytic Exogenous Enzymes on Feed Utilization, and Antioxidant Status of Broiler Chickens. Vet. Sci. 2023, 10, 594. https://doi.org/10.3390/vetsci10100594

AMA Style

Ibrahim D, El-sayed HI, Mahmoud ER, El-Rahman GIA, Bazeed SM, Abdelwarith AA, Elgamal A, Khalil SS, Younis EM, Kishawy ATY, et al. Impacts of Solid-State Fermented Barley with Fibrolytic Exogenous Enzymes on Feed Utilization, and Antioxidant Status of Broiler Chickens. Veterinary Sciences. 2023; 10(10):594. https://doi.org/10.3390/vetsci10100594

Chicago/Turabian Style

Ibrahim, Doaa, Hassainen I. El-sayed, Elsabbagh R. Mahmoud, Ghada I. Abd El-Rahman, Shefaa M. Bazeed, Abdelwahab A. Abdelwarith, Aya Elgamal, Samah S. Khalil, Elsayed M. Younis, Asmaa T. Y. Kishawy, and et al. 2023. "Impacts of Solid-State Fermented Barley with Fibrolytic Exogenous Enzymes on Feed Utilization, and Antioxidant Status of Broiler Chickens" Veterinary Sciences 10, no. 10: 594. https://doi.org/10.3390/vetsci10100594

APA Style

Ibrahim, D., El-sayed, H. I., Mahmoud, E. R., El-Rahman, G. I. A., Bazeed, S. M., Abdelwarith, A. A., Elgamal, A., Khalil, S. S., Younis, E. M., Kishawy, A. T. Y., Davies, S. J., & Metwally, A. E. (2023). Impacts of Solid-State Fermented Barley with Fibrolytic Exogenous Enzymes on Feed Utilization, and Antioxidant Status of Broiler Chickens. Veterinary Sciences, 10(10), 594. https://doi.org/10.3390/vetsci10100594

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop