Development of a Multiplexed Fluorescent Pseudovirus Neutralization Test for Simultaneous Assessment of Immunity to Three SARS-CoV-2 Variants
Abstract
1. Introduction
2. Materials and Methods
3. Results
3.1. Production Conditions for PVPs
3.2. Efficiency of Neutralization Did Not Differ in Single- and Multiplex Setup
3.3. Analysis of Neutralization Effectiveness Dynamics Against Three Variants of SARS-CoV-2 Using a Multiplex Assay
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A. Plasmid Constructions
| Name | Sequence (5′–3′) |
|---|---|
| For_AgeI-PacI-addition | ATGGACCACCGGTGCTTAATTAAACCCC |
| Rev_AgeI-PacI-addition | TCGAGGGGTTTAATTAAGCACCGGTGGTCCATGGTT |
| Name | Sequence (5′–3′) |
|---|---|
| For_clover_AgeI cloning | ATTACCGGTATGGTGAGCAAGGGCGAGGAGCTG |
| Rev_clover_PacI cloning | ATTTTAATTAATTACTTGTACAGCTCGTCCATGCCATGTG |
| For_mRuby3_AgeI cloning | ATTACCGGTATGGTGTCTAAGGGCGAAGAGCTG |
| Rev_mRuby3_PacI cloning | ATTTTAATTAATTACCCACCAAGATTGGAGTACTTGGCAACTG |
| For_mRhubarb713_AgeI cloning | ATTACCGGTATGGCTGAAGGATCCGTCGCC |
| Rev_mRhubarb713_PacI cloning | ATTTTAATTAATTACTCTTCCATCACGCCGATCG |
| Name | Sequence (5′–3’) |
|---|---|
| pUCHR-IR-AgeIPacI_seq-for | GCTGAAGGATGCCCAGAAGGTAC |
| Clover-seq1-rev | GGCGCGGGTCTTGTAGGT |
| Clover-seq2-for | GCAGCACGACTTCTTCAAGTCC |
| mRhubarb713-seq1-rev | CCCGATCGAAGCCGGTAATCT |
| mRhubarb713-seq2-for | TCCGCCACACCAACAGC |
| mRuby3-seq1-rev | CCCTCAGACCACCATCTGCTG |
| mRuby3-seq2-for | CCCTCCAATGGTCCCGTGA |
Appendix B. PEI Titration
| PEI:pDNA Ratio | PEI Origin | Transfection Mean, % |
|---|---|---|
| 1:1 | Sigma Aldrich, St. Louis, MO, USA | 62.7 |
| Servicebio, Wuhan, China | 53.9 | |
| 2:1 | Sigma Aldrich, St. Louis, MO, USA | 48.0 |
| Servicebio, Wuhan, China | 63.1 | |
| 3:1 | Sigma Aldrich, St. Louis, MO, USA | 19.8 |
| Servicebio, Wuhan, China | 61.3 |
Appendix C. Neutralization Percentage Data

Appendix D. Neutralization Percentage Data
| Dilution | Wuhan-Hu-1 | BA.1 | XBB.1.5 | ||||
|---|---|---|---|---|---|---|---|
| Singleplex | Multiplex | Singleplex | Multiplex | Singleplex | Multiplex | ||
| 1.1 | 1:20 | 10.78% | 39.87% | 0.00% | 0.00% * | 0.00% | 0.00% |
| 1:40 | 15.76% | 7.93% | 15.29% | ||||
| 1:80 | 22.36% | 12.35% | 0.00% | ||||
| 1:160 | 0.00% | 0.00% | 0.00% | ||||
| 1:320 | 0.00% | 0.00% | 0.00% | ||||
| 1.2 | 1:20 | 94.12% | 72.79% | 95.45% | 93.24% | 23.79% | 47.21% |
| 1:40 | 94.77% | 91.15% | 35.13% | ||||
| 1:80 | 91.83% | 89.03% | 17.40% | ||||
| 1:160 | 86.17% | 78.76% | 32.36% | ||||
| 1:320 | 63.21% | 60.09% | 3.71% | ||||
| 1.3 | 1:20 | 91.50% | 89.63% | 80.92% | 87.72% | 75.98% | 79.56% |
| 1:40 | 89.56% | 87.79% | 56.95% | ||||
| 1:80 | 90.40% | 80.59% | 29.50% | ||||
| 1:160 | 94.27% | 82.11% | 12.94% | ||||
| 1:320 | 82.47% | 74.60% | 19.47% | ||||
| 1.4 | 1:20 | 97.46% | 84.25% | 96.51% | 92.84% | 0.00% | 28.13% |
| 1:40 | 72.42% | 72.89% | 5.23% | ||||
| 1:80 | 81.19% | 68.74% | 18.38% | ||||
| 1:160 | 53.67% | 61.47% | 27.40% | ||||
| 1:320 | 50.01% | 23.77% | 20.55% | ||||
| 1.5 | 1:20 | No data | 92.96% | No data | 95.79% | No data | 93.20% |
| 1:40 | 91.94% | 96.41% | 64.80% | ||||
| 1:80 | 90.91% | 89.62% | 46.06% | ||||
| 1:160 | 86.13% | 72.54% | 20.44% | ||||
| 1:320 | 46.80% | 46.49% | 17.27% | ||||
| 2.1 | 1:20 | 87.72% | 70.62% | 0.00% | 3.07% | 0.00% | 0.00% |
| 1:40 | 79.64% | 3.75% | 2.72% | ||||
| 1:80 | 54.96% | 2.39% | 0.00% | ||||
| 1:160 | 32.60% | 10.20% | 8.65% | ||||
| 1:320 | 30.93% | 10.46% | 16.69% | ||||
| 2.2 | 1:20 | 97.24% | 97.13% | 95.00% | 88.55% | 52.02% | 33.28% |
| 1:40 | 97.86% | 90.35% | 54.18% | ||||
| 1:80 | 88.64% | 78.33% | 63.27% | ||||
| 1:160 | 91.44% | 64.34% | 36.19% | ||||
| 1:320 | 49.92% | 52.34% | |||||
| 2.3 | 1:20 | 98.22% | 76.37% | 95.86% | 90.70% | 29.94% | 22.27% |
| 1:40 | 92.65% | 82.53% | 27.40% | ||||
| 1:80 | 81.93% | 64.91% | 14.65% | ||||
| 1:160 | 69.75% | 37.83% | 12.87% | ||||
| 1:320 | 49.65% | 26.32% | 12.12% | ||||
| 2.4 | 1:20 | No data | 95.53% | No data | 92.46% | No data | 36.17% |
| 1:40 | 90.67% | 90.26% | 66.07% | ||||
| 1:80 | 73.28% | 44.10% | 13.45% | ||||
| 1:160 | 69.05% | 44.82% | 33.85% | ||||
| 1:320 | 56.13% | 48.41% | 40.42% | ||||
| 3.1 | 1:20 | 0.00% | 17.82% | 0.00% | 0.00% | 0.00% | 0.00% |
| 1:40 | 6.57% | 13.14% | 0.00% | ||||
| 1:80 | 0.00% | 0.00% | 0.00% | ||||
| 1:160 | 0.00% | 0.00% | 0.00% | ||||
| 1:320 | 0.00% | 0.00% | 0.00% | ||||
| 3.2 | 1:20 | 95.69% | 94.52% | 96.18% | 92.59% | 37.58% | 13.28% |
| 1:40 | 91.74% | 90.48% | 12.41% | ||||
| 1:80 | 91.20% | 79.63% | 0.00% | ||||
| 1:160 | 60.34% | 26.19% | 0.00% | ||||
| 1:320 | 9.94% | 6.26% | 6.35% | ||||
| 3.3 | 1:20 | 98.23% | 88.30% | 85.47% | 38.38% | 0.00% | 0.00% |
| 1:40 | 56.12% | 17.98% | 0.00% | ||||
| 1:80 | 29.72% | 27.20% | 26.01% | ||||
| 1:160 | 27.26% | 32.35% | 14.21% | ||||
| 1:320 | 25.66% | 20.64% | 15.82% | ||||
| 3.4 | 1:20 | No data | 94.07% | No data | 95.38% | No data | 81.41% |
| 1:40 | 88.22% | 93.00% | 60.82% | ||||
| 1:80 | 75.57% | 85.44% | 47.72% | ||||
| 1:160 | 25.89% | 49.59% | 25.50% | ||||
| 1:320 | 28.06% | 32.56% | 17.70% | ||||
| 4.1 | 1:20 | 67.24% | 44.90% | 61.02% | 33.44% | 39.31% | 10.11% |
| 1:40 | 34.87% | 42.95% | 22.31% | ||||
| 1:80 | 18.79% | 47.69% | 16.57% | ||||
| 1:160 | 7.48% | 29.87% | 3.23% | ||||
| 1:320 | 8.28% | 29.87% | 0.00% | ||||
| 5.1 | 1:20 | No data | 77.69% | No data | 52.82% | No data | 41.50% |
| 1:40 | 63.71% | 44.39% | 50.34% | ||||
| 1:80 | 37.28% | 27.65% | 31.02% | ||||
| 1:160 | 29.66% | 23.86% | 21.19% | ||||
| 1:320 | 20.12% | 28.21% | 38.67% | ||||
| 5.2 | 1:20 | No data | 93.04% | No data | 78.31% | No data | 17.99% |
| 1:40 | 94.08% | 53.95% | 13.82% | ||||
| 1:80 | 83.44% | 22.88% | 8.36% | ||||
| 1:160 | 71.71% | 10.82% | 0.00% | ||||
| 1:320 | 20.12% | 2.35% | 0.00% | ||||
| 5.3 | 1:20 | No data | 78.62% | No data | 46.53% | No data | 0.00% |
| 1:40 | 58.13% | 30.04% | 0.00% | ||||
| 1:80 | 16.80% | 1.43% | 0.00% | ||||
| 1:160 | 0.64% | 0.00% | 0.00% | ||||
| 1:320 | 0.00% | 0.00% | 0.00% | ||||
| 5.4 | 1:20 | No data | 95.01% | No data | 88.65% | No data | 45.67% |
| 1:40 | 95.67% | 74.48% | 0.00% | ||||
| 1:80 | 74.01% | 35.17% | 0.00% | ||||
| 1:160 | 66.72% | 34.80% | 0.00% | ||||
| 1:320 | 69.24% | 36.36% | 12.80% | ||||
References
- Popova, A.Y.; Smirnov, V.S.; Egorova, S.A.; Melik-Andreasyan, G.G.; Atoyan, S.A.; Milichkina, A.M.; Drozd, I.V.; Palozyan, G.H.; Ivanov, V.A.; Ramsay, E.S.; et al. Herd Immunity to SARS-CoV-2 Among the Armenian Population in the Second Half of 2022. Epidemiologia 2025, 6, 29. [Google Scholar] [CrossRef] [PubMed]
- Tasew, G.; Abdella, S.; Bejiga, B.; Ejeta, E.; Gizachew, L.; Lisanwork, L.; Bati, F.; Abate, E.; Negash, L.; Bonger, Z.; et al. Seroprevalence of SARS-CoV-2 Antibodies in Ethiopia: Findings from the 2022 National Population-Based Survey (Second Round). BMC Infect. Dis. 2025, 25, 1126. [Google Scholar] [CrossRef] [PubMed]
- Nishigaki, A.; Kinoshita, R.; Sakuraba, S.; Sugihara, J.; Suzuki, T.; Suzuki, M.; Yoneoka, D. Comparison of Infection-Induced SARS-CoV-2 Seroprevalence Across Large-Scale Residual Samples From Blood Donors, Commercial Laboratories, and Health Checkups in Japan, 2023. Open Forum Infect. Dis. 2025, 12, ofaf415. [Google Scholar] [CrossRef] [PubMed]
- Singhal, T. The Emergence of Omicron: Challenging Times Are Here Again! Indian J. Pediatr. 2022, 89, 490–496. [Google Scholar] [CrossRef]
- Fan, Q.; Nie, Z.; Xie, S. Panorama of Breakthrough Infection Caused by SARS-CoV-2: A Review. Medicina 2022, 58, 1733. [Google Scholar] [CrossRef]
- Haque, A.; Pant, A.B. Mitigating COVID-19 in the Face of Emerging Virus Variants, Breakthrough Infections and Vaccine Hesitancy. J. Autoimmun. 2022, 127, 102792. [Google Scholar] [CrossRef]
- Yeganeh, A.; Kalantar, E.; Ghaffari, A.; Keramatinia, A.; Yeganeh, F. Seroprevalence and Determinants of SARS-CoV-2 Anti-Nucleocapsid IgG in a Vaccinated Iranian Adult Population: A Cross-Sectional Study, Summer 2023. Hum. Vaccin. Immunother. 2025, 21, 2560063. [Google Scholar] [CrossRef]
- Rizatdinova, S.N.; Ershova, A.E.; Astrakhantseva, I.V. Pseudotyped Viruses: A Useful Platform for Pre-Clinical Studies Conducted in a BSL-2 Laboratory Setting. Biomolecules 2025, 15, 135. [Google Scholar] [CrossRef]
- Ashley, C.L.; Bloul, M.; Alca, S.; Smith, L.; Jin, W.; Khoury, D.; Counoupas, C.; Davenport, M.; Triccas, J.A.; Steain, M. Optimisation of a Multiplexed, High Throughput Assay to Measure Neutralising Antibodies against SARS-CoV-2 Variants. J. Virol. Methods 2025, 332, 115073. [Google Scholar] [CrossRef]
- Kruglova, N.; Siniavin, A.; Gushchin, V.; Mazurov, D. Different Neutralization Sensitivity of SARS-CoV-2 Cell-to-Cell and Cell-Free Modes of Infection to Convalescent Sera. Viruses 2021, 13, 1133. [Google Scholar] [CrossRef]
- Du, P.; Li, J.; Kong, T.; Lu, B.; Li, R.; Gao, G.F.; Wang, Q. Defining the Serotypes of SARS-CoV-2 Subvariants up to December, 2024. Lancet Microbe 2025, 6, 101124. [Google Scholar] [CrossRef] [PubMed]
- Hu, S.; Wu, C.; Wu, X.; Ma, X.; Shu, C.; Chen, Q.; Zheng, A.; Yang, H.; Lu, J.; Du, P.; et al. Classification of Five SARS-CoV-2 Serotypes Based on RBD Antigenicities. Sci. Bull. 2023, 68, 3003–3012. [Google Scholar] [CrossRef] [PubMed]
- Simon-Loriere, E.; Schwartz, O. Towards SARS-CoV-2 Serotypes? Nat. Rev. Microbiol. 2022, 20, 187–188. [Google Scholar] [CrossRef] [PubMed]
- Lobas, M.A.; Tao, R.; Nagai, J.; Kronschläger, M.T.; Borden, P.M.; Marvin, J.S.; Looger, L.L.; Khakh, B.S. A Genetically Encoded Single-Wavelength Sensor for Imaging Cytosolic and Cell Surface ATP. Nat. Commun. 2019, 10, 711. [Google Scholar] [CrossRef]
- Rogers, O.C.; Johnson, D.M.; Firnberg, E. MRhubarb: Engineering of Monomeric, Red-Shifted, and Brighter Variants of IRFP Using Structure-Guided Multi-Site Mutagenesis. Sci. Rep. 2019, 9, 15653. [Google Scholar] [CrossRef]
- Bajar, B.T.; Lam, A.J.; Badiee, R.K.; Oh, Y.-H.; Chu, J.; Zhou, X.X.; Kim, N.; Kim, B.B.; Chung, M.; Yablonovitch, A.L.; et al. Fluorescent Indicators for Simultaneous Reporting of All Four Cell Cycle Phases. Nat. Methods 2016, 13, 993–996. [Google Scholar] [CrossRef]
- FPbase. Available online: https://www.fpbase.org/spectra/ (accessed on 10 September 2024).
- BioRender: Scientific Image and Illustration. Available online: https://www.biorender.com/ (accessed on 3 October 2025).
- Thimmiraju, S.R.; Villar, M.J.; Kimata, J.T.; Strych, U.; Bottazzi, M.E.; Hotez, P.J.; Pollet, J. Optimization of Cellular Transduction by the HIV-Based Pseudovirus Platform with Pan-Coronavirus Spike Proteins. Viruses 2024, 16, 1492. [Google Scholar] [CrossRef]
- Abedon, S.T.; Bartom, E. Multiplicity of Infection. In Brenner’s Encyclopedia of Genetics, 2nd ed.; Maloy, S., Hughes, K., Eds.; Academic Press: San Diego, CA, USA, 2013; pp. 509–510. [Google Scholar]
- Monaco, G.; Chen, H.; Poidinger, M.; Chen, J.; de Magalhães, J.P.; Larbi, A. FlowAI: Automatic and Interactive Anomaly Discerning Tools for Flow Cytometry Data. Bioinformatics 2016, 32, 2473–2480. [Google Scholar] [CrossRef]
- Roca, C.P.; Burton, O.T.; Gergelits, V.; Prezzemolo, T.; Whyte, C.E.; Halpert, R.; Kreft, Ł.; Collier, J.; Botzki, A.; Spidlen, J.; et al. AutoSpill Is a Principled Framework That Simplifies the Analysis of Multichromatic Flow Cytometry Data. Nat. Commun. 2021, 12, 2890. [Google Scholar] [CrossRef]
- Gulova, S.M.; Veselkina, U.S.; Astrakhantseva, I.V. Adaptation of the Vaccine Prophylaxis Strategy to Variants of the SARS-CoV-2 Virus. Vaccines 2025, 13, 761. [Google Scholar] [CrossRef]
- Willett, B.J.; Grove, J.; MacLean, O.A.; Wilkie, C.; De Lorenzo, G.; Furnon, W.; Cantoni, D.; Scott, S.; Logan, N.; Ashraf, S.; et al. SARS-CoV-2 Omicron Is an Immune Escape Variant with an Altered Cell Entry Pathway. Nat. Microbiol. 2022, 7, 1161–1179. [Google Scholar] [CrossRef] [PubMed]
- Meng, B.; Abdullahi, A.; Ferreira, I.A.T.M.; Goonawardane, N.; Saito, A.; Kimura, I.; Yamasoba, D.; Gerber, P.P.; Fatihi, S.; Rathore, S.; et al. Altered TMPRSS2 Usage by SARS-CoV-2 Omicron Impacts Infectivity and Fusogenicity. Nature 2022, 603, 706–714. [Google Scholar] [CrossRef] [PubMed]
- Denis, K.J.S.; Hoelzemer, A.; Iafrate, A.J.; Naranbhai, V.; Balazs, A.B. mRNA-Based COVID-19 Vaccine Boosters Induce Neutralizing Immunity against SARS-CoV-2 Omicron Variant. Cell 2022, 185, 457–466.e4. [Google Scholar] [CrossRef]
- Le, K.; Kannappan, S.; Kim, T.; Lee, J.H.; Lee, H.-R.; Kim, K.K. Structural Understanding of SARS-CoV-2 Virus Entry to Host Cells. Front. Mol. Biosci. 2023, 10, 1288686. [Google Scholar] [CrossRef]
- Pochtovyi, A.A.; Kustova, D.D.; Siniavin, A.E.; Dolzhikova, I.V.; Shidlovskaya, E.V.; Shpakova, O.G.; Vasilchenko, L.A.; Glavatskaya, A.A.; Kuznetsova, N.A.; Iliukhina, A.A.; et al. In Vitro Efficacy of Antivirals and Monoclonal Antibodies against SARS-CoV-2 Omicron Lineages XBB.1.9.1, XBB.1.9.3, XBB.1.5, XBB.1.16, XBB.2.4, BQ.1.1.45, CH.1.1, and CL.1. Vaccines 2023, 11, 1533. [Google Scholar] [CrossRef]
- Liu, Z.; Lu, L.; Jiang, S. Receptor-Binding Domain-Associated Serotypes of SARS-CoV-2. Emerg. Microbes Infect. 2024, 13, 2309968. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Jiang, S.; Ma, W.; Li, X.; Wei, K.; Xie, F.; Zhao, C.; Zhao, X.; Wang, S.; Li, C.; et al. Enhanced Neutralization of SARS-CoV-2 Variant BA.2.86 and XBB Sub-Lineages by a Tetravalent COVID-19 Vaccine Booster. Cell Host Microbe 2024, 32, 25–34.e5. [Google Scholar] [CrossRef]
- Plante, J.A.; Liu, Y.; Liu, J.; Xia, H.; Johnson, B.A.; Lokugamage, K.G.; Zhang, X.; Muruato, A.E.; Zou, J.; Fontes-Garfias, C.R.; et al. Spike Mutation D614G Alters SARS-CoV-2 Fitness. Nature 2021, 592, 116–121. [Google Scholar] [CrossRef]
- Qu, P.; Xu, K.; Faraone, J.N.; Goodarzi, N.; Zheng, Y.M.; Carlin, C.; Bednash, J.S.; Horowitz, J.C.; Mallampalli, R.K.; Saif, L.J.; et al. Immune Evasion, Infectivity, and Fusogenicity of SARS-CoV-2 BA.2.86 and FLip Variants. Cell 2024, 187, 585–595.e6. [Google Scholar] [CrossRef]
- Sievers, B.L.; Gelbart, T.; Tan, G.S. A High-Throughput SARS-CoV-2 Pseudovirus Multiplex Neutralization Assay. STAR Protoc. 2022, 3, 101835. [Google Scholar] [CrossRef]
- Chen, J.; Huang, Z.; Xiao, J.; Du, S.; Bu, Q.; Guo, H.; Ye, J.; Chen, S.; Gao, J.; Li, Z.; et al. A Quadri-Fluorescence SARS-CoV-2 Pseudovirus System for Efficient Antigenic Characterization of Multiple Circulating Variants. Cell Rep. Methods 2024, 4, 100856. [Google Scholar] [CrossRef]






| Donors | Gender | Vaccination Status | Positive PCR Test | Sample ID (Date of Collection) |
|---|---|---|---|---|
| 1 | F | Gam-COVID-Vac date 1—12 February 2021, date 2—15 March 2021, date 3—26 January 2022 | 4 February 2022 | 1.1 (31 March 2021) 1.2 (20 April 2022) 1.3 (24 November 2022) 1.4 (20 June 2024) 1.5 (5 November 2025) |
| 2 | M | Gam-COVID-Vac date 1—29 January 2021, date 2—20 February 2021, date 3—19 October 2021 | 5 February 2022 | 2.1 (23 March 2021) 2.2 (16 February 2022) 2.3 (3 August 2022) 2.4 (6 November 2025) |
| 3 | M | ChAdOx1 nCoV-19 date 1—16 March 2021, date 2—28 May 2021, Gam-COVID-Vac date 1—17 December 2021, date 2—4 February 2022 | No data | 3.1 (1 July 2021) 3.2 (20 April 2022) 3.3 (5 October 2023) 3.4 (5 November 2025) |
| 4 | F | None | 27 December 2020 | 4.1 (31 March 2021) |
| 5 | M | Gam-COVID-Vac date 1—1 June 2021, date 2—22 June 2021 | 5 September 2020 | 5.1 (3 February 2021) 5.2 (27 July 2021) 5.3 (3 August 2022) 5.4 (7 November 2025) |
| Plasmid | Mass Per 10 cm Dish, μg |
|---|---|
| pCMV-dR8-2 | 5.00 |
| pCG1-SARS-2S | 3.33 |
| pUCHR-IR-FluorProtein | 6.67 |
| Fluorochrome | Excitation Max., nm | Emission Max., nm | Laser Line, nm | Bandpass Filter |
|---|---|---|---|---|
| DAPI | 354 | 456 | 405 | 450/50 |
| Clover | 505 | 515 | 488 | 530/30 |
| mRuby3 | 558 | 592 | 561 | 610/20 |
| mRhubarb713 | 690 | 713 | 640 | 730/45 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Gulova, S.M.; Ershova, A.E.; Shumeev, A.N.; Rizatdinova, S.N.; Pavlova, A.V.; Bogdanova, D.A.; Astrakhantseva, I.V. Development of a Multiplexed Fluorescent Pseudovirus Neutralization Test for Simultaneous Assessment of Immunity to Three SARS-CoV-2 Variants. Immuno 2026, 6, 17. https://doi.org/10.3390/immuno6010017
Gulova SM, Ershova AE, Shumeev AN, Rizatdinova SN, Pavlova AV, Bogdanova DA, Astrakhantseva IV. Development of a Multiplexed Fluorescent Pseudovirus Neutralization Test for Simultaneous Assessment of Immunity to Three SARS-CoV-2 Variants. Immuno. 2026; 6(1):17. https://doi.org/10.3390/immuno6010017
Chicago/Turabian StyleGulova, Sofia M., Alina E. Ershova, Alexander N. Shumeev, Sophia N. Rizatdinova, Alexandra V. Pavlova, Daria A. Bogdanova, and Irina V. Astrakhantseva. 2026. "Development of a Multiplexed Fluorescent Pseudovirus Neutralization Test for Simultaneous Assessment of Immunity to Three SARS-CoV-2 Variants" Immuno 6, no. 1: 17. https://doi.org/10.3390/immuno6010017
APA StyleGulova, S. M., Ershova, A. E., Shumeev, A. N., Rizatdinova, S. N., Pavlova, A. V., Bogdanova, D. A., & Astrakhantseva, I. V. (2026). Development of a Multiplexed Fluorescent Pseudovirus Neutralization Test for Simultaneous Assessment of Immunity to Three SARS-CoV-2 Variants. Immuno, 6(1), 17. https://doi.org/10.3390/immuno6010017

