Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress
Abstract
1. Introduction
2. Materials and Methods
2.1. Prawns Used for Experiments
2.2. Experimental Methods
2.2.1. Screening the Optimal siRNA
2.2.2. Screening the Optimal siRNA Injection Concentration
2.2.3. RNAi with ACC Gene in M. rosenbergii under Cold Stress
2.2.4. RNA Extraction and Expression Analyses of the Target Genes
2.2.5. Statistical Analysis
3. Results
3.1. Optimal siRNA for Interference with ACC Gene
3.2. Optimal Concentration of siRNA for Interference with ACC Gene
3.3. Effects of RNAi with ACC Gene on Mortality of M. rosenbergii under Cold Stress
3.4. Effects of RNAi with ACC Gene on Expression of the Fatty Acid Metabolism-Related Genes in M. rosenbergii under Cold Stress
4. Discussion
4.1. Factors Affecting the Efficacy of siRNA Interference
4.2. The Influence of Interfering with the ACC Gene on Fatty Acid Metabolism
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | siRNA-I vs. PBS | −0.043 | 0.929 | down |
| siRNA-II vs. PBS | −0.040 | 0.934 | down | ||
| siRNA-III vs. PBS | −0.587 | 0.246 | down | ||
| 6 h | siRNA-I vs. PBS | 0.115 | 0.734 | up | |
| siRNA-II vs. PBS | 0.291 | 0.402 | up | ||
| siRNA-III vs. PBS | −0.419 | 0.238 | down | ||
| 12 h | siRNA-I vs. PBS | −0.478 | 0.365 | down | |
| siRNA-II vs. PBS | −0.810 | 0.143 | down | ||
| siRNA-III vs. PBS | −0.667 | 0.218 | down | ||
| 24 h | siRNA-I vs. PBS | 0.258 | 0.632 | up | |
| siRNA-II vs. PBS | −0.523 | 0.343 | down | ||
| siRNA-III vs. PBS | −0.682 | 0.225 | down | ||
| muscles | 2 h | siRNA-I vs. PBS | −0.394 | <0.01 | down |
| siRNA-II vs. PBS | −0.517 | <0.01 | down | ||
| siRNA-III vs. PBS | −0.535 | <0.01 | down | ||
| 6 h | siRNA-I vs. PBS | −0.178 | 0.394 | down | |
| siRNA-II vs. PBS | −0.193 | 0.356 | down | ||
| siRNA-III vs. PBS | −0.338 | 0.125 | down | ||
| 12 h | siRNA-I vs. PBS | −0.222 | 0.387 | down | |
| siRNA-II vs. PBS | −0.142 | 0.573 | down | ||
| siRNA-III vs. PBS | −0.279 | 0.282 | down | ||
| 24 h | siRNA-I vs. PBS | −0.446 | <0.01 | down | |
| siRNA-II vs. PBS | −0.166 | 0.079 | down | ||
| siRNA-III vs. PBS | 0.480 | <0.01 | up |
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | 1.2 vs. PBS | −1.033130301 | <0.05 | down |
| 2.0 vs. PBS | −0.826504288 | 0.085 | down | ||
| 2.8 vs. PBS | −1.125366284 | <0.05 | down | ||
| 6 h | 1.2 vs. PBS | −1.030205555 | 0.060 | down | |
| 2.0 vs. PBS | −0.755244227 | <0.05 | down | ||
| 2.8 vs. PBS | −0.812130448 | <0.05 | down | ||
| 12 h | 1.2 vs. PBS | −1.166649643 | <0.05 | down | |
| 2.0 vs. PBS | −0.770975262 | 0.114 | down | ||
| 2.8 vs. PBS | −0.843998366 | 0.088 | down | ||
| 24 h | 1.2 vs. PBS | −0.1767506 | 0.076 | down | |
| 2.0 vs. PBS | −0.865795579 | <0.01 | down | ||
| 2.8 vs. PBS | −0.776727349 | <0.01 | down | ||
| muscles | 2 h | 1.2 vs. PBS | −0.36783873 | <0.01 | down |
| 2.0 vs. PBS | −0.141112979 | 0.212 | down | ||
| 2.8 vs. PBS | −0.289875935 | <0.05 | down | ||
| 6 h | 1.2 vs. PBS | −0.242709411 | 0.381 | down | |
| 2.0 vs. PBS | −0.400211499 | 0.165 | down | ||
| 2.8 vs. PBS | −0.284508805 | 0.308 | down | ||
| 12 h | 1.2 vs. PBS | −0.273136694 | 0.109 | down | |
| 2.0 vs. PBS | −0.283068528 | 0.098 | down | ||
| 2.8 vs. PBS | −0.250016135 | 0.137 | down | ||
| 24 h | 1.2 vs. PBS | −0.219449812 | 0.476 | down | |
| 2.0 vs. PBS | −0.495745874 | 0.130 | down | ||
| 2.8 vs. PBS | −0.22408862 | 0.467 | down |
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | siRNA vs. scrambled-siRNA | −0.070 | 0.430 | down |
| siRNA vs. PBS | −0.132 | 0.159 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.867 | <0.05 | down | |
| siRNA vs. PBS | −0.653 | 0.07 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.788 | 0.07 | down | |
| siRNA vs. PBS | −0.928 | <0.05 | down | ||
| muscles | 2 h | siRNA vs. scrambled-siRNA | −0.591 | 0.061 | down |
| siRNA vs. PBS | −0.399 | 0.171 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.508 | <0.05 | down | |
| siRNA vs. PBS | −0.345 | 0.106 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.486 | <0.05 | down | |
| siRNA vs. PBS | −0.342 | 0.072 | down | ||
| gills | 2 h | siRNA vs. scrambled-siRNA | −1.062 | <0.01 | down |
| siRNA vs. PBS | −0.949 | <0.01 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.152 | 0.076 | down | |
| siRNA vs. PBS | −0.350 | <0.01 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.374 | 0.173 | down | |
| siRNA vs. PBS | −0.380 | 0.168 | down |
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | siRNA vs. scrambled-siRNA | −0.530 | <0.01 | down |
| siRNA vs. PBS | −0.795 | <0.01 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.961 | <0.01 | down | |
| siRNA vs. PBS | −0.835 | <0.01 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | 0.061 | 0.809 | up | |
| siRNA vs. PBS | −0.036 | 0.887 | down | ||
| muscles | 2 h | siRNA vs. scrambled-siRNA | −0.706 | <0.05 | down |
| siRNA vs. PBS | −0.793 | <0.05 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.084 | 0.725 | down | |
| siRNA vs. PBS | −0.121 | 0.615 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.326 | 0.093 | down | |
| siRNA vs. PBS | −0.380 | 0.059 | down | ||
| gills | 2 h | siRNA vs. scrambled-siRNA | −0.959 | <0.01 | down |
| siRNA vs. PBS | −0.557 | <0.05 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.609 | <0.05 | down | |
| siRNA vs. PBS | −0.613 | <0.05 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.929 | <0.01 | down | |
| siRNA vs. PBS | −0.841 | <0.01 | down |
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | siRNA vs. scrambled-siRNA | −0.013 | 0.964 | down |
| siRNA vs. PBS | 0.080 | 0.774 | up | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.420 | 0.052 | down | |
| siRNA vs. PBS | −0.464 | <0.05 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.539 | <0.05 | down | |
| siRNA vs. PBS | −0.624 | <0.05 | down | ||
| muscles | 2 h | siRNA vs. scrambled-siRNA | −0.809 | <0.01 | down |
| siRNA vs. PBS | −0.581 | <0.01 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.653 | <0.01 | down | |
| siRNA vs. PBS | −0.646 | <0.01 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.343 | 0.258 | down | |
| siRNA vs. PBS | −0.531 | 0.102 | down | ||
| gills | 2 h | siRNA vs. scrambled-siRNA | −0.845 | <0.01 | down |
| siRNA vs. PBS | −0.754 | <0.01 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.419 | <0.05 | down | |
| siRNA vs. PBS | −0.422 | <0.05 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −1.027 | <0.05 | down | |
| siRNA vs. PBS | −0.991 | <0.05 | down |
| Tissue | Time | Comparison Group | Log2 Foldchange | Padj | Regulated |
|---|---|---|---|---|---|
| hepatopancreas | 2 h | siRNA vs. scrambled-siRNA | −0.546 | <0.05 | down |
| siRNA vs. PBS | −0.518 | 0.051 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.709 | <0.01 | down | |
| siRNA vs. PBS | −0.701 | <0.01 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.635 | <0.05 | down | |
| siRNA vs. PBS | −0.646 | <0.05 | down | ||
| muscles | 2 h | siRNA vs. scrambled-siRNA | −1.212 | <0.05 | down |
| siRNA vs. PBS | −0.971 | <0.05 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −1.162 | <0.05 | down | |
| siRNA vs. PBS | −0.988 | <0.05 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −1.009 | <0.01 | down | |
| siRNA vs. PBS | −0.974 | <0.01 | down | ||
| gills | 2 h | siRNA vs. scrambled-siRNA | −1.033 | <0.01 | down |
| siRNA vs. PBS | −0.791 | <0.01 | down | ||
| 12 h | siRNA vs. scrambled-siRNA | −0.146 | 0.663 | down | |
| siRNA vs. PBS | −0.433 | 0.223 | down | ||
| 18 h | siRNA vs. scrambled-siRNA | −0.755 | <0.01 | down | |
| siRNA vs. PBS | −0.819 | <0.01 | down |
References
- Ren, X.; Wang, Q.; Shao, H.; Xu, Y.; Liu, P.; Li, J. Effects of low temperature on shrimp and crab physiology, behavior, and growth: A review. Front. Mar. Sci. 2021, 8, 746177. [Google Scholar] [CrossRef] [Scilit]
- Hennig, O.L.; Andreatta, E.R. Effect of temperature in an intensive nursery system for Penaeus paulensis (Pérez Farfante, 1967). Aquaculture 1998, 164, 167–172. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Liu, M.; Shao, R.; Zhang, J.; Zuo, R.; Tan, B.; Ai, Q.; Mai, K.; Wan, M.J.A. The effects of different lipid sources on the growth, intestinal health, and lipid metabolism of the pacific white shrimp (Litopenaeus vannamei). Aquaculture 2022, 548, 737655. [Google Scholar] [CrossRef] [Scilit]
- Ren, X.; Yu, Z.; Xu, Y.; Zhang, Y.; Mu, C.; Liu, P.; Li, J. Integrated transcriptomic and metabolomic responses in the hepatopancreas of kuruma shrimp (Marsupenaeus japonicus) under cold stress. Ecotoxicol. Environ. Saf. 2020, 206, 111360. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, J.; Shi, W.; Zhao, R.; Gu, C.; Shen, H.; Li, H.; Wang, L.; Cheng, J.; Wan, X. Integrated physiological, transcriptome, and metabolome analyses of the hepatopancreas of Litopenaeus vannamei under cold stress. Comp. Biochem. Physiol. Part D Genom. Proteom. 2024, 49, 101196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, J.; Shi, W.; Zhao, R.; Gu, C.; Li, H.; Wang, L.; Wan, X. Effects of Cold Stress on the Hemolymph of the Pacific White Shrimp Penaeus vannamei. Fishes 2024, 9, 36. [Google Scholar] [CrossRef] [Scilit]
- New, M.B. Freshwater prawn farming: Global status, recent research and a glance at the future. Aquac. Res. 2005, 36, 210–230. [Google Scholar] [CrossRef] [Scilit]
- New, M.B. Freshwater prawn culture: A review. Aquaculture 1990, 88, 99–143. [Google Scholar] [CrossRef] [Scilit]
- Banu, M.R.; Christianus, A.; Ikhsan, N.F.M.; Rajaee, A.H.J.A.R. Effect of cold shock and hormone on growth and male morphotypes of freshwater prawn, Macrobrachium rosenbergii (de Man). Aquac. Res. 2016, 47, 3740–3746. [Google Scholar] [CrossRef] [Scilit]
- Niu, C.; Lee, D.; Goshima, S.; Nakao, S. Effects of temperature on food consumption, growth and oxygen consumption of freshwater prawn Macrobrachium rosenbergii (de Man 1879) postlarvae. Aquac. Res. 2003, 34, 501–506. [Google Scholar] [CrossRef] [Scilit]
- Tay, J.; Suhanizen, A.; Aziz, M.; Yassin, N.; Arai, T. Effects of domestication and temperature on the growth and survival of the giant freshwater prawn (Macrobrachium rosenbergii) postlarvae. Open Agric. 2022, 7, 181–190. [Google Scholar] [CrossRef] [Scilit]
- Hongtuo, F.; Sufei, J.; Yiwei, X. Current status and prospects of farming the giant river prawn (Macrobrachium rosenbergii) and the oriental river prawn (Macrobrachium nipponense) in China. Aquac. Res. 2012, 43, 993–998. [Google Scholar] [CrossRef] [Scilit]
- Kim, B.M.; Amores, A.; Kang, S.; Ahn, D.H.; Kim, J.H.; Kim, I.C.; Lee, J.H.; Lee, S.G.; Lee, H.; Lee, J.; et al. Antarctic blackfin icefish genome reveals adaptations to extreme environments. Nat. Ecol. Evol. 2019, 3, 469–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, C.H.; Ye, C.X.; Guo, Z.X.; Wang, A.L. Immune and physiological responses of pufferfish (Takifugu obscurus) under cold stress. Fish Shellfish Immunol. 2017, 64, 137–145. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Li, W.; Su, J.; Zhou, Z.; Miao, Y.; Tian, X.; Tao, M.; Zhang, C.; Zhou, Y.; Qin, Q.; et al. Integration of transcriptome and metabolome reveals molecular mechanisms responsive to cold stress in gynogenetic mrigal carp (Cirrhinus mrigala). Aquaculture 2024, 579, 740200. [Google Scholar] [CrossRef] [Scilit]
- Wakil, S.J.; Stoops, J.K.; Joshi, V.C. Fatty acid synthesis and its regulation. Annu. Rev. Biochem. 1983, 52, 537–579. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Galdieri, L.; Gatla, H.; Vancurova, I.; Vancura, A. Activation of AMP-activated protein kinase by metformin lnduces protein acetylation in prostate and ovarian cancer cells. J. Biol. Chem. 2016, 291, 25154–25166. [Google Scholar] [CrossRef] [Scilit]
- Sone, H.; Kamiyama, S.; Higuchi, M.; Fujino, K.; Kubo, S.; Miyazawa, M.; Shirato, S.; Hiroi, Y.; Shiozawa, K. Biotin augments acetyl CoA carboxylase 2 gene expression in the hypothalamus, leading to the suppression of food intake in mice. Biochem. Biophys. Res. Commun. 2016, 476, 134–139. [Google Scholar] [CrossRef] [Scilit]
- Brocker, C.; Carpenter, C.; Nebert, D.W.; Vasiliou, V. Evolutionary divergence and functions of the human acyl-CoA thioesterase gene (ACOT) family. Hum. Genom. 2010, 4, 411. [Google Scholar] [CrossRef] [Scilit]
- Jung, S.H.; Lee, H.C.; Hwang, H.J.; Park, H.A.; Moon, Y.A.; Kim, B.C.; Lee, H.M.; Kim, K.P.; Kim, Y.N.; Lee, B.L.; et al. Acyl-CoA thioesterase 7 is involved in cell cycle progression via regulation of PKCζ-p53-p21 signaling pathway. Cell Death Dis. 2017, 8, e2793. [Google Scholar] [CrossRef] [Scilit]
- Florova, G.; Kazanina, G.; Reynolds, K.A. Enzymes involved in fatty acid and polyketide biosynthesis in Streptomyces glaucescens: Role of FabH and FabD and their acyl carrier protein specificity. Biochemistry 2002, 41, 10462–10471. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ito, H.; Nakamae, I.; Kato, J.Y.; Yoneda-Kato, N. Stabilization of fatty acid synthesis enzyme acetyl-CoA carboxylase 1 suppresses acute myeloid leukemia development. J. Clin. Investig. 2021, 131, e141529. [Google Scholar] [CrossRef] [Scilit]
- Teixeira, V.; Mohamed, I.; Lavoie, J.C. Neonatal Vitamin C and cysteine deficiencies program adult hepatic glutathione and specific activities of glucokinase, phosphofructokinase, and acetyl-CoA carboxylase in guinea pigs’ livers. Antioxidants 2021, 10, 953. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, L.; Zhao, L.P.; Chen, Y.Q.; Chang, X.S.; Xiong, H.; Zhang, D.M.; Xu, W.T.; Chen, J.C. Adropin inhibits the phenotypic modulation and proliferation of vascular smooth muscle cells during neointimal hyperplasia by activating the AMPK/ACC signaling pathway. Exp. Ther. Med. 2021, 21, 560. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Ma, A.; Yuan, C.; Zhao, T.; Chang, H.; Zhang, J. Transcriptome analysis of liver lipid metabolism disorders of the turbot Scophthalmus maximus in response to low salinity stress. Aquaculture 2021, 534, 736273. [Google Scholar] [CrossRef] [Scilit]
- Wu, D.; Liu, Z.; Yu, P.; Huang, Y.; Cai, M.; Zhang, M.; Zhao, Y. Cold stress regulates lipid metabolism via AMPK signalling in Cherax quadricarinatus. J. Therm. Biol. 2020, 92, 102693. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamore, P.D. RNA interference: Listening to the sound of silence. Nat. Struct. 2001, 8, 746–750. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Belles, X. Beyond drosophila: RNAi in vivo and functional genomics in insects. Annu. Rev. Entomol. 2010, 55, 111–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lima, P.C.; Harris, J.O.; Cook, M. Exploring RNAi as a therapeutic strategy for controlling disease in aquaculture. Fish Shellfish Immunol. 2013, 34, 729–743. [Google Scholar] [CrossRef] [Scilit]
- Tan, K.; Zhou, M.; Jiang, H.; Jiang, D.; Li, Y.; Wang, W. siRNA-mediated MrIAG silencing induces sex reversal in Macrobrachium rosenbergii. Mar. Biotechnol. 2020, 22, 456–466. [Google Scholar] [CrossRef] [Scilit]
- Guo, Q.; Li, S.; Lv, X.; Xiang, J.; Manor, R.; Sagi, A.; Li, F. Sex-biased CHHs and their putative receptor regulate the expression of IAG gene in the shrimp Litopenaeus vannamei. Front. Physiol. 2019, 10, 1525. [Google Scholar] [CrossRef] [Scilit]
- Tu, H.; Peng, X.; Yao, X.; Tang, Q.; Xia, Z.; Li, J.; Yang, G.; Yi, S. Integrated transcriptomic and metabolomic analyses reveal low-temperature tolerance mechanism in giant freshwater prawn Macrobrachium rosenbergii. Animals 2023, 13, 1605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, M.; Yang, R.; Chen, X.; Fu, Z.; Ma, Z.; Yu, G.J.A.R. Transcriptional response of golden pompano Trachinotus ovatus larvae to cold and heat stress. Aquac. Rep. 2021, 20, 100755. [Google Scholar] [CrossRef] [Scilit]
- Ge, H.L.; Tan, K.; Shi, L.L.; Sun, R.; Wang, W.M.; Li, Y.H. Comparison of effects of dsRNA and siRNA RNA interference on insulin-like androgenic gland gene (IAG) in red swamp crayfish Procambarus clarkii. Gene 2020, 752, 144783. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, S.; Yao, L.; Zhang, J.; Huang, L. Direct and indirect effects of RNA interference against pyridoxal kinase and pyridoxine 5’-phosphate oxidase genes in Bombyx mori. Gene 2016, 587, 48–52. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, Y.; Lü, L.; Yang, L.S.; Weng, S.P.; Chan, S.M.; He, J.G. Inhibition of white spot syndrome virus in Litopenaeus vannamei shrimp by sequence-specific siRNA. Aquaculture 2007, 271, 21–30. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiang, Y.; Yu, Y.; Li, Q.; Chen, J.; Li, Y.; Cao, W. Chicken telomerase reverse transcriptase mediates LMH cell pyroptosis by regulating the nuclear factor-kappa B signaling pathway. Poult. Sci. 2022, 101, 101826. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farkas, T.; Csengeri, I.; Majoros, F.; Oláh, J. Metabolism of fatty acids in fish: III. Combined effect of environmental temperature and diet on formation and deposition of fatty acids in the carp, Cyprinus carpio Linnaeus 1758. Aquaculture 1980, 20, 29–40. [Google Scholar] [CrossRef] [Scilit]
- Deng, W.; Sun, J.; Chang, Z.G.; Gou, N.N.; Wu, W.Y.; Luo, X.L.; Zhou, J.S.; Yu, H.B.; Ji, H. Energy response and fatty acid metabolism in Onychostoma macrolepis exposed to low-temperature stress. J. Therm. Biol. 2020, 94, 102725. [Google Scholar] [CrossRef] [Scilit]
- Tillander, V.; Alexson, S.E.H.; Cohen, D.E. Deactivating fatty acids: Acyl-CoA thioesterase-mediated control of lipid metabolism. Trends Endocrinol. Metab. 2017, 28, 473–484. [Google Scholar] [CrossRef] [Scilit]
- Cooper, D.; Young, P.; Klett, E.; Coleman, R. Physiological consequences of compartmentalized acyl-CoA metabolism. J. Biol. Chem. 2015, 290, 20023–20031. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Steensels, S.; Ersoy, B.A. Fatty acid activation in thermogenic adipose tissue. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2019, 1864, 79–90. [Google Scholar] [CrossRef] [Scilit]
- Janben, U.; Davis, E.M.; Le Beau, M.M.; Stoffel, W. Human mitochondrial enoyl-CoA hydratase Gene (ECHS1): Structural organization and assignment to chromosome 10q26.2–q26.3. Genomics 1997, 40, 470–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hiltunen, J.K.; Mursula, A.M.; Rottensteiner, H.; Wierenga, R.K.; Kastaniotis, A.J.; Gurvitz, A. The biochemistry of peroxisomal β-oxidation in the yeast Saccharomyces cerevisiae. FEMS Microbiol. Rev. 2003, 27, 35–64. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, S.K.; Kim, K.H.; Park, J.K.; Jeong, K.W.; Kim, Y.; Kim, E.E. New design platform for malonyl-CoA-acyl carrier protein transacylase. FEBS Lett. 2010, 584, 1240–1244. [Google Scholar] [CrossRef] [Scilit]
- Tian, J.; Zheng, M.; Yang, G.; Zheng, L.; Chen, J.; Yang, B. Cloning and stress-responding expression analysis of malonyl CoA-acyl carrier protein transacylase gene of Nannochloropsis gaditana. Gene 2013, 530, 33–38. [Google Scholar] [CrossRef] [Scilit]







| Primer Name | siRNA/Primer Sequences (5′–3′) | SiRNA or Primer Length/bp | TM/°C |
|---|---|---|---|
| siRNA-I | CAGCACCUGGCAAGCUUCUUAAUUA | 25 | / |
| siRNA-II | GGUCGAGAUGUGAUAUGCAUUUGUA | 25 | / |
| siRNA-III | CCCAGUUAGGUGGUGUACAAAUUAU | 25 | / |
| scrambled-siRNA | CGUACAUGCGUAGUAUAGAUGUACU | 25 | / |
| ACC-F | TGGCAGCATTGGAGGTGTA | 19 | 60.8 |
| ACC-R | GATGAGATGATGGCAGCAGAA | 21 | 60.8 |
| ACOT-F | TCCACTGTCCTGTLTTCAT | 19 | 56.8 |
| ACOT-R | CGTCAACCTCACCATTCC | 19 | 56.8 |
| FabD-F | GCATTGGTGTAGCAGGTT | 19 | 63.0 |
| FabD-R | GTLTTGAATLTGGTCCGTAT | 20 | 63.0 |
| echA-F | GGCTLTCAATGCTLTATGT | 19 | 59.3 |
| echA-R | CCTGCTGTGCTGTAATCA | 18 | 59.3 |
| 18S-F | TATACGCTAGTGGAGCTGGAA | 21 | / |
| 18S-R | GGGGAGGTAGTGACGAAAAAT | 21 | / |
| Time (after Injection) | Interference Group (siRNA-III) | Negative Control Group (Scrambled-siRNA) | Blank Control Group (PBS) | |||
|---|---|---|---|---|---|---|
| Cumulative Deaths | Cumulative Mortality | Cumulative Deaths | Cumulative Mortality | Cumulative Deaths | Cumulative Mortality | |
| 2 h | 0 | 0 | 0 | 0 | 0 | 0 |
| 6 h | 0 | 0 | 0 | 0 | 0 | 0 |
| 12 h | 9 | 22.50% | 21 | 52.50% | 11 | 27.50% |
| 18 h | 30 | 75.00% | 38 | 95.00% | 39 | 97.50% |
| 24 h | 40 | 100.00% | 40 | 100.00% | 40 | 100.00% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhong, H.; Yao, X.; Tu, H.; Xia, Z.; Cai, M.; Sheng, Q.; Yi, S.; Yang, G.; Tang, Q. Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress. Fishes 2024, 9, 170. https://doi.org/10.3390/fishes9050170
Zhong H, Yao X, Tu H, Xia Z, Cai M, Sheng Q, Yi S, Yang G, Tang Q. Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress. Fishes. 2024; 9(5):170. https://doi.org/10.3390/fishes9050170
Chicago/Turabian StyleZhong, Hua, Xinyi Yao, Haihui Tu, Zhenglong Xia, Miaoying Cai, Qiang Sheng, Shaokui Yi, Guoliang Yang, and Qiongying Tang. 2024. "Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress" Fishes 9, no. 5: 170. https://doi.org/10.3390/fishes9050170
APA StyleZhong, H., Yao, X., Tu, H., Xia, Z., Cai, M., Sheng, Q., Yi, S., Yang, G., & Tang, Q. (2024). Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress. Fishes, 9(5), 170. https://doi.org/10.3390/fishes9050170

