Next Article in Journal
Effects of RNA Interference with Acetyl-CoA Carboxylase Gene on Expression of Fatty Acid Metabolism-Related Genes in Macrobrachium rosenbergii under Cold Stress
Previous Article in Journal
The Role of Functional Feed Additives in Enhancing Aquaculture Sustainability
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 5
10.3390/fishes9050169
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Development and Characterization of Fifteen Polymorphic Microsatellite Loci for Rare and Endangered Species within Luciobarbus Heckel, 1843 Genus in the Aral Basin and Their Conservation Application

by
Kamila Adyrbekova
1,2,3,
Silvia Perea
4 and
Ignacio Doadrio
4,*
1
Department of Molecular Biology and Genetics, Faculty of Biology and Biotechnology, Al-Farabi Kazakh National University, Almaty 050040, Kazakhstan
2
Fisheries Research and Production Center LLP, Almaty 050016, Kazakhstan
3
Institute of Genetics and Physiology, Almaty 050060, Kazakhstan
4
Biodiversity and Evolutionary Group, National Museum of Natural Sciences, CSIC, 28006 Madrid, Spain
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(5), 169; https://doi.org/10.3390/fishes9050169
Submission received: 27 March 2024 / Revised: 3 May 2024 / Accepted: 5 May 2024 / Published: 7 May 2024
(This article belongs to the Section Taxonomy, Evolution, and Biogeography)
Browse Figures
Versions Notes

Abstract

:
Biodiversity conservation entails not only the preservation of specific taxa but also genetic diversity. Despite the crucial role of molecular data in freshwater fish conservation management, there is a scarcity of information regarding the genetic diversity of Luciobarbus Heckel, 1843 (Actinopterygii, Cyprinidae) populations in the Aral system. Therefore, the primary aim of this study was to provide genetic information on two native species of the Luciobarbus genus found in the Aral system: L. conocephalus (Kessler, 1872) and L. brachycephalus (Kessler, 1872). These species, like many others in the Aral system, confront the imminent threat of extinction due to system alterations. However, genetic studies on these species at the nuclear level are challenging because Luciobarbus is an allotetraploid genus. Consequently, genetic investigations thus far have focused mainly on sequencing mitochondrial genes due to their haploid nature. This study has successfully developed fifteen new polymorphic microsatellite loci, which can prove to be valuable for population genetics, conservation, and other pertinent research on these species.
Keywords:
Aral; Syrdarya; microsatellite markers; allotetraploids; conservation; population genetics
Key Contribution: This study assessed the genetic diversity of rare and endangered species of the Aral Basin in Kazakhstan to address a knowledge gap in this area. An assessment of genetic diversity was not carried out before this work. This study provides valuable insights for further research aimed at investigating genetic structure.

1. Introduction

The cyprinid family includes 152 genera and within freshwater fishes, this family stands out as the most diverse, comprising a remarkable 1695 species [1]. Within the cyprinid fishes, the genus Luciobarbus Heckel, 1843 includes 51 medium to large-sized species distributed along rivers draining into the Persian Gulf, the Mediterranean, the Black, Caspian, and Aral Seas and into the Atlantic Ocean, from the Iberian Peninsula in Europe to Central Asia and North Africa [2,3,4].
The Aral Sea was once the world’s fourth-largest inland body of water in terms of surface area [5]. A lake basin, fed by two rivers, the Amu Darya and the Syrdarya, supports a diverse ecosystem and boasts a highly economically valuable fishery [6]. Currently, the Aral Sea is facing severe environmental degradation primarily attributable to a rapid reduction in its water level. The main consequence of this dwindling water level is an increase in salinity, which reduces biodiversity [7]. It has been reported that the population of Luciobarbus brachycephalus (Kessler, 1872) has declined by 30% over the past 30 years and continues to decline due to the rising salinity of the Aral Sea and the construction of dams on its tributaries [8]. Two species of barbels of the genus Luciobarbus Heckel, 1843 inhabit water bodies within the Aral Basin: Luciobarbus brachycephalus (Kessler, 1872) and Luciobarbus conocephalus (Kessler, 1872). They are part of the Ponto-Caspian freshwater faunal complex [9,10], and their distribution ranges largely overlap [11,12,13]. Luciobarbus brachycephalus is a migratory species represented by two populations: one in the Caspian Sea Basin and the other in the Aral Basin. In contrast, L. conocephalus primarily inhabits freshwater environments and does not undergo extensive migration. Luciobarbus conocephalus is mainly found in the flat regions of the Amudarya, Syrdarya, Zeravshan, Kafirnigan, Kashkadarya, and Chu Rivers as well as in reservoirs on these rivers, in floodplain lakes, and in the main and waste channels of irrigation systems [14,15,16]. The Kazakhstan part of the range includes the Syrdarya Basin from the Shardara Reservoir to the lower reaches, including the basins of rivers flowing from the southwestern slopes of the Karatau Ridge (Arys, Bugun, Badam, and Keles Rivers) [17]. The taxonomic status of L. conocephalus has been a subject of debate [18], and it was initially classified as a subspecies [4] of Luciobarbus capito (Güldenstädt, 1773) and later considered to be a synonym of L. capito [19]. However, recent molecular and morphological studies [20] support the recognition of L. conocephalus as a distinct and valid species. In this study, we aligned with this more recent and supported taxonomy [20] and recognized the species as L. conocephalus.
Luciobarbus species display a high degree of morphological similarity, with only a few distinguishing traits. Previous studies on the systematic position and taxonomic classification of barbels in the Aral–Syrdarya Basin have predominantly relied on comparative morphological methods. However, these studies have yielded inconsistent results among different authors [21,22,23,24]. The morphological variation in the barbel traits of both species was limited, with significant overlap observed. An analysis of morphometric traits in juvenile individuals has revealed that the number of scales in the lateral line is the most visually significant characteristic [13]. The available literature highlights the necessity for further investigation and clarification of the genus’s taxonomy [17], which requires molecular genetic analysis based on both mitochondrial and nuclear markers.
Many published works have focused on the evolution of the Luciobarbus genus by examining mitochondrial genes [25,26,27,28,29,30]. This genus represents an allopolyploid, specifically a tetraploid formed as a result of ancient hybridization, which renders the study of its nuclear genome particularly challenging. Regarding the evolution of ploidy in cyprinids, only general studies have been conducted, encompassing several species of the genus Luciobarbus, and only one study used a small number of nuclear genes to resolve relationships within the cyprinid family [31]. Mitochondrial and nuclear genes do not always correspond [32,33] because the mitochondrial genome is haploid and maternally inherited; therefore, its effective population size is four times smaller than the nuclear genome [34]. Therefore, intraspecific polymorphisms are lost more quickly than that in the nuclear genome since this rate is inversely proportional to the effective population size [32]. This is especially important for allopolyploid organisms such as the genus Luciobarbus [35]. Nonetheless, for a more precise interpretation of the genus’s evolutionary history, additional exploration of the nuclear genome is imperative.
Among nuclear markers, microsatellites have been extensively employed due to their versatility in various applications across the domains of population genetics, conservation, and evolutionary biology. Their codominant characteristics, high levels of polymorphism, and reproducibility make them highly suitable tools for evaluating population structure and genetic diversity [36,37,38,39,40,41].
This study represents the first attempt to determine the genetic structure (variation), diversity (variability), and evolutionary history of populations of the genus Luciobarbus in the Aral Basin by investigating their nuclear genomes by employing microsatellites. These findings hold particular significance for the conservation and sustainable utilization of resources in one of the ecosystems, the Aral Sea, which has been severely impacted by human activities.

2. Materials and Methods

Specimens of barbels were collected from the Aral Basin from May to September 2022. Along the Syrdarya River, specimens belonging to the genus Luciobarbus were found at five sampling points. The names and geographical coordinates of each locality are presented in Table 1.
A map of the river basins (Figure 1) was constructed using QGIS 3.22.13 (QGIS Development Team 2021).
Eighty-one individuals were collected from the sampling points using nets. Fin clips were preserved in 96% ethanol. All the samples were collected using the appropriate permits from the Ministry of Ecology and Natural Resources of the Republic of Kazakhstan. The specimens were released alive back into the river, with the exception of a small selection of 2 specimens from each population, and fin fragments are now deposited in the Collections and BioBank of the National Museum of Natural Sciences (MNCN-CSIC) in Madrid, Spain. For the first time, the developed microsatellite markers were tested in the MNCN-CSIC for the current populations analyzed. Total genomic DNA from the sampled tissues was obtained using Qiagen DNeasy 96 Blood and Tissue kits (QiagenTM, Venlo, Netherlands) following the manufacturer’s recommendations.
A total of 17 primer pairs were designed for microsatellite loci (Table 2). These primers were grouped into 4 sets of multiplex (1: M1287, M1417, M1182; 2: M2237, M2108, M2044, M2164, M2306; 3: M3230, M3264, M3318, M3444; 4: M4211, M4455, M4215, M4138, M4474) PCRs according to the primer properties, forward and reverse sequences, expected amplicon size, repeat motif, tail of the primer, and type of fluorescent marker used.
PCRs were performed in a final volume of 12.5 μL containing 1 μL of DNA (10 ng/L), 6.25 μL of Type-it Microsatellite PCR Kit (Qiagen), 4 μL of PCR grade water, and 1.25 µL of the 10X primer mix. The optimal PCR protocol consisted of an initial denaturation step at 95 °C for 5 min: 30 cycles of 95 °C for 30 s, 57 °C for 90 s, 72 °C for 30 s; 8 cycles of 95 °C for 30 s, 53 °C for 90 s, 72 °C for 30 s; and a final extension step at 68 °C for 30 min. All the PCRs included a negative control to verify possible contamination. The tails of the oligonucleotides were attached to the 5′ ends of the primers for fluorescent labeling. The oligonucleotide tails used were the universal sequences M13 (GGA AAC AGC TAT GAC CAT), CAG (CAG TCG GGC GTC ATC) and T3 (AAT TAA CCC TCA CTA AAG GG). The oligonucleotide tails were labeled with PET, NED, and VIC dyes. The amplified PCR products were processed on an ABI Prism 3730 DNA Analyzer (250–500 LIZ size standards). Allele assignment was performed using GENEMAPPER 3.7 (Applied Biosystems, Foster City, CA, USA).
The genetic diversity of each locus was estimated using the GenoDive v.3.0 program. [42], which allows the analysis of polyploid organisms. For this purpose, the following indices were estimated: the number of alleles per locus (NA), the effective number of alleles per locus (AE), the observed heterozygosity (Ho), the heterozygosity within populations (Hs), the total heterozygosity (Ht), the corrected total heterozygosity (H’t), and the inbreeding coefficient (Gis). The genetic differentiation between populations was performed based on the G’st statistics [43]. The significance value for this parameter was estimated using 999 permutations. Previously, MICRO-CHECKER v2.23 [44] was used to explore the existence of null alleles and evaluate their impact on the estimation of genetic differentiation.
Polymorphism information content (PIC) is a way to evaluate the ability of genetic markers to detect polymorphisms among individuals. This parameter was calculated using the following formula [45]:
PIC = 1 − ∑ i = 1 n P i 2 − ∑ i = 1 n − 1 ∑ j = i + 1 n 2 P i 2 P j 2
A model based on Bayesian clustering was used to study the population structure. The number of populations (K) with the highest posterior probability (mean lnProb [D]) was calculated using the program STRUCTURE 2.3.4 [46], assuming an admixed model and a uniform prior probability of the number of populations, K, and a ploidy of 4 (tetraploids). The MCMC simulations consisted of 1 × 106 burn-in iterations followed by 1 × 105 sampled iterations. Furthermore, the modal values of λ and ∆K [47] were also calculated to infer the best value of K in [48].
To determine the amount of genetic structuring among grouping levels, an analysis of molecular variance (AMOVA) [49] was carried out to estimate the percentage of variation in the allele frequency of the microsatellites among and within each population, grouping them by sampling location (population) for L. brachycephalus. The AMOVA was carried out in the GenoDive v.3.0 program [42].

3. Results

No evidence of shadow banding or genotyping errors was found, and the frequency of null alleles was low. Based on the allele frequencies observed in the analysis of 15 loci across 81 individuals, a total of 90 alleles were identified, accounting for a missing data percentage of 10.93%. The number of alleles per locus varied between 2 and 12, with a polymorphism information content (PIC > 0.5) of 0.774, indicating high polymorphism. Notably, one locus, M2108, exhibited a significant deviation from Hardy–Weinberg equilibrium (p = 0.0001).
The AMOVA revealed that the highest percentage of genetic variation for all the L. brachycephalus samples from four sampled populations was explained by the “within individuals” component (98.4%), while a low percentage of genetic variation explained the among individual and among population components at 0.3% and 1.3%, respectively.
For all measures of genetic diversity, including the average number of alleles per locus, the effective number of alleles, and heterozygosity, L. brachycephalus from the Basykara Dam consistently displayed higher values compared to all the other sampling locations. Within the examined populations of L. brachycephalus, the population closest to the Aral Sea estuary exhibited the lowest diversity.
The inbreeding coefficient values were statistically significant for all the studied populations, except for the population of L. brachycephalus from Rice Check, which is located in the headwaters of the Syrdarya River watershed (Table 3).
Among the seventeen tested microsatellites, fifteen loci amplified successfully (Table 4) and were polymorphic; two of the loci (M3318 and M4455) were monomorphic and they were excluded from subsequent analyses. Among the fifteen amplified loci, M2044, M4215, and M1287 showed the greatest degree of polymorphism (Table 4).
The number of alleles per locus ranged from 2 to 12 (mean 6). The observed heterozygosity and total heterozygosity ranged from 0.037 to 0.911 (average 0.525) and from 0.055 to 0.860, respectively. The highest effective number of alleles was 5.093 for the M2044 locus and 3.030 for the M4215 locus; the observed heterozygosity ranged from 0.911–0.715 for the M2044, M1287, M1417, M1182, M3264, M3444, and M4138 loci. The heterozygosity within the population was noted for the loci M2044—0.842, M4215—0.721, and M1287–0.699, and high values of total heterozygosity were detected for the loci with the greatest number of alleles from 8 to 12: M2044—0.860, M4215—0.811, M4474—0.738, M1287—0.730, and M3444—0.676.
Structural analyses did not reveal a clear genetic structure between the four populations of L. brachycephalus (Figure 2, clusters 1–4), which were separated from sampling site 5, represented by L. conocephalus (Figure 2). On detecting the population structure for the analyzed barbels from different sampling points in the Aral–Syrdarya Basin, bar plots showing the division of runs by mode for the optimal (K = 5) number of clusters were generated (Figure 2), although no genetic structure was found. Only two clusters of both species were separated: one with populations of the species L. conocephalus (sampling point 5) and the other with populations of L. brachycephalus (sampling points 1–4). However, some individuals belonging to L. conocephalus of the 2 and 4 at the sampling points collapsed into differentiated clusters (Figure 2).
However, we assume that four specimens from sample points 2 and 4 (Kyzylorda region and Rice Check) are indeed L. conocephalus and not the result of introgression. Apparently, these four specimens were misidentified in the field. It is also worth noting that four specimens were caught in these places, although L. brachycephalus is traditionally found there.
Genetic introgression, also known as introgressive hybridization, is the transfer of genetic material from one species into the gene pool of another by repeated backcrossing of the interspecific hybrid to one of its parent species. Genetic introgression from native species is recognized as a detrimental impact resulting from biological invasions involving taxonomically similar invaders. The ecological consequences of genetic introgression from an invasive congener were tested using the endemic barbel populations from central Italy, where the invader was the European barbel Barbus barbus. The results indicate that the genetic introgression of an invasive congener from native species can result in substantial ecological consequences, including the potential for cascading effects [50].
However, our genetic analysis provided support for a low level of introgression of L. conocephalus into L. brachycephalus in the Bayesian cluster where L. brachycephalus was only present (one sampling point in Bairykum village), but not vice versa, indicating limited genetic exchange between the two species.
Bayesian structure analysis with microsatellites revealed differences between individuals of the two species; however, no evidence of intraspecific genetic structure was found within L. brachycephalus.
The studied species exhibit significant morphological similarities, making it rather challenging to differentiate between them. In cases where their geographical ranges overlap, their separation primarily relies on ecological factors related to habitat and lifestyle (including migratory and resident forms). Our nuclear study effectively distinguished between these two species without any ambiguities. It is worth noting that previous research [17] suggested the possibility of interbreeding between them.
These microsatellite loci can also be used for intrageneric genetic identification, according to the results obtained, since individuals of L. conocephalus show clear differentiation when divided into clusters. For this purpose, we also noted private alleles for L. conocephalus, such as M1447, M0244, and M4215 as well as M2237, which is only one locus that is not valid for individuals of this species.

4. Discussion

In this article, we present the first results of a study with nuclear microsatellite markers for two Luciobarbus species inhabiting the Aral Basin. The nuclear markers analyzed in this study represent the first microsatellites isolated from Luciobarbus and increase the available molecular resources for these tetraploid species, which makes it difficult to study the nuclear genome. These microsatellites have been suggested to be informative for the analysis of the genetic diversity and structure of two Luciobarbus species inhabiting the Aral Basin and they will provide significant insights into species genetic diversity and population structure in other species of the allotetraploid genus Luciobarbus, assisting in conservation and other relevant studies for its more vulnerable species.
Most of the habitats of rare and endangered barbels in the Aral Basin in Kazakhstan were surveyed, and the sampling points covered were Bairykum village, the Kyzylorda region, the Basykara Dam, Rice Check, and the Badam River. The rarity of the species L. conocephalus compared with L. brachycephalus has attracted attention because this population has a very limited distribution area in the geographical context of the Aral–Syrdarya Basin within Kazakhstan. In addition to the drying of the Aral Sea and the erosion that this part of the basin has suffered, conservation measures should be implemented to prevent future actions that jeopardize the conservation of these two Luciobarbus species.
Of the 17 analyzed loci, 15 were polymorphic for all individuals; microsatellites were used to study the genetic structure and diversity of both L. brachycephalus and L. conocephalus. The number of alleles per locus is estimated to range from 2 to 12, namely M2044 and M4474-12, M1287-11, M4215-9, and M3444-8, with an average value of 6, in comparison with the number of alleles that fluctuate from 2 to 7 in other species [51,52,53,54]. Additionally, at two points where L. brachycephalus is usually recorded, four individuals of L. conocephalus were also found, which was confirmed by our genetic results.
The contribution of this study, with fifteen newly developed microsatellites for Luciobarbus, is highly relevant given the precarious conservation status of the two species analyzed, especially L. conocephalus. The use of these microsatellites will allow us to gain a better understanding of the evolutionary history of the species within this genus and support the conservation of these rare and endangered species.
In this article, we embarked on a pioneering endeavor by isolating and employing microsatellite markers to unravel the enigmatic genetic landscape of the Luciobarbus genus within the confines of the Aral Basin. This landmark achievement significantly augments the molecular toolkit available for the study of Luciobarbus, a genus that has long confounded researchers due to its tetraploid nature. As such, the legacy of this research is poised to cast a long-lasting impact on the realms of ichthyology, genetics, and conservation biology.

5. Conclusions

In the conservation of biodiversity, the assessment of genetic diversity plays an important role. The conservation of a system of many genetically diverse local populations and their structure is necessary for the long-term survival of species and the functioning of ecosystems.
Therefore, the main goal of this study was to obtain genetic information about two native species of the genus Luciobarbus living in the Aral system: L. conocephalus (Kessler, 1872) and L. brachycephalus (Kessler, 1872). As a result of this research, nuclear markers for evaluating the genetic structure and diversity were successfully developed and applied. These microsatellite loci can also be used for intrageneric genetic identification. It should be noted that based on the level of genetic diversity, small, isolated populations are distinguished that show an average level of genetic diversity.
Despite the rare and endangered status of the barbels of the Aral Basin, in-depth studies to identify their population structure and assess their genetic diversity have not been carried out before this work. With the help of molecular genetic methods, it has been possible to largely solve this problem and make a significant contribution to the study of the genetic diversity of barbels, which has been unclear for more than 30 years. The results obtained from this study can be used to develop effective, science-based plans for the conservation of barbels and can be used by environmental, fishery, and other organizations whose activities are aimed at the protection, reproduction, and rational use of fish resources.
Reduced genetic diversity reduces the ability of a population to adapt to future environmental changes, such as biotic and abiotic changes, reducing the plasticity of population genomes. Further research is needed because these species, like many others in the Aral system, face an imminent threat of extinction due to changes in the drying water system. This emphasizes the need for continued investigation into these complexities and their implications.

Author Contributions

I.D.: supervision, conceptualization, and investigation; S.P.: software and analysis of the data; K.A.: wrote the first draft of the manuscript. We confirm that this manuscript and data are original and have not been previously published or considered elsewhere. All authors have read and agreed to the published version of the manuscript.

Funding

Ministerio de Ciencia e Innovación: PID2019-103936GB-C22.

Institutional Review Board Statement

Ethical review and approval were waived for this study due to the law of the Republic of Kazakhstan “On protection, reproduction and use of the animal world” from 9 July 2004 No593-II.

Data Availability Statement

The data presented in this study are available upon reasonable request from the corresponding author.

Acknowledgments

We greatly thank Lourdes Alcaraz from the Biodiversity and Evolutionary Group, National Museum of Natural Sciences, CSIC (Madrid, Spain) for all the laboratory assistance and the Fisheries Research and Production Center (Almaty, Kazakhstan) for obtaining biological basis documents for the study of rare and endangered fish species.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Froese, R.; Pauly, D. (Eds.) FishBase. Worldwide Web Electronic Publication. Version (06/2023). 2023. Available online: www.fishbase.org (accessed on 11 November 2023).
  2. Doadrio, I. Freshwater fish fauna of North Africa and its biogeography. Ann. R. Cent. Afr. Mus. 1994, 275, 21–34. [Google Scholar]
  3. Kottelat, M.; Freyhof, J. Handbook of European Freshwater Fishes; Cornol: Berlin, Germany, 2007; 646p. [Google Scholar]
  4. Berg, L.S. Fish of Freshwater of USSR and Neighboring Counties, 3rd ed.; AS USSR: Moscow, Russia, 1949; Part 2; p. 458. [Google Scholar]
  5. Xenarios, S.; Schmidt-Vogt, D.; Qadir, M.; Janusz-Pawletta, B.; Abdullaev, I. The Aral Sea Basin: Water for Sustainable Development in Central Asia; Routledge: Oxfordshire, UK, 2019. [Google Scholar]
  6. Reimov, P.; Fayzieva, D. The Present State of the South Aral Sea Area. In The Aral Sea; Micklin, P., Aladin, N., Plotnikov, I., Eds.; Springer Earth System Sciences; Springer: Berlin/Heidelberg, Germany, 2014. [Google Scholar]
  7. Anchita; Zhupankhan, A.; Khaibullina, Z.; Kabiyev, Y.; Persson, K.M.; Tussupova, K. Health impact of drying Aral Sea: One health and socio-economical approach. Water 2021, 13, 3196. [Google Scholar] [CrossRef]
  8. Esmaeili, H.R.; Mehraban, H.; Abbasi, K.; Keivany, Y.; Coad, B.W. Review and updated checklist of freshwater fishes of Iran: Taxonomy, distribution and conservation status. Iran J. Ichthyol. 2017, 4, 1–114. [Google Scholar]
  9. Dumont, H.J. Endemism in the Ponto—Caspian Fauna, with Special Emphasis on the Onychopoda (Crustacea). Adv. Ecol. Res. 2000, 31, 181–196. [Google Scholar]
  10. Nikolski, G.V. Structura vida i Zakonomernosti Izmenchivosti ryb; Pischevaya Prom.: Moskva, Russia, 1980; 183 s. [Google Scholar]
  11. Rass, T.S. Animal Life. T. Lancelets, Cyclostomes, Cartilaginous Fishes, Bony Fishes; Education: Moscow, Russia, 1983; 576p. [Google Scholar]
  12. Baimbetov, A.A.; Dukravets, G.M.; Ereshchenko, V.I.; Kulikov, E.V.; Kulikova, E.V.; Melnikov, V.A.; Mitrofanov, V.P.; Timirkhanov, S.R. The Red Data Book of the Republic of Kazakhstan, 4th ed.; revised and updated; Animals; Part 1: Vertebrates—Almaty, “DPS”; 2010; Volume I, p. 324. Available online: https://zool.kz/wp-content/uploads/2021/02/red-data-book-rk_v1_1_2010.pdf (accessed on 11 November 2023)ISBN 9965-32-738-6.
  13. Orlova, I.V.; Tereshchenko, A.M.; Murova, E.V.; Klimov, F.V. Features of the biology and morphology of the Aral and Turkestan barbels in the basin of the river. Syrdarya Tethys Aqua Zool. Res. III 2007, 1, 93–102. [Google Scholar]
  14. Maksunov, V.A. Materials for the morphometric and biological characteristics of the Turkestan barbel Barbus capito conocephalus Kessler in the upper reaches of the Syrdarya River. Issues Ichthyol. 1962, 4, 592–596. [Google Scholar]
  15. Turdakov, F.A. Fishes of Kyrgyzstan. In Academy of Sciences of the KirgSSR; KirgSSR: Frunze, Kyrgyzstan, 1963; p. 284. [Google Scholar]
  16. Pivnev, I.A. Fish from the Basins of the Chu and Talas Rivers; KirgSSR: Frunze, Kyrgyzstan, 1985; p. 190. [Google Scholar]
  17. Mitrofanov, V.P.; Dukravets, G.M.; Melnikov, V.A.; Baimbetov, A.A. Fishes of Kazakhstan: Vol.3; Carps (Continuation); Nauka: Alma-Ata, Kazakhstan, 1988; p. 304. [Google Scholar]
  18. Coad, B.W. Fresh water fishes of Iran. Acta Sci. Nat. Acad. Sci. Bohemicae 1995, 29, 1–64. [Google Scholar]
  19. Fricke, R.; Eschmeyer, W.N.; van der Laan, R. (Eds.) Eschmeyer’s Catalog of Fishes: Genera, Species, References. 2023. Available online: http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp (accessed on 25 July 2023).
  20. Jouladeh-Roudbar, A.; Ghanavi, H.R.; Doadrio, I. Ichthyofauna from Iranian freshwater: Annotated checklist, diagnosis, taxonomy, distribution and conservation assessment. Zool. Stud. 2020, 59, 21. [Google Scholar] [CrossRef]
  21. Galaktionova, E.L. Status, Reproduction and Conservation of the Syrdarya Population of the Aral Barbel Barbus Brachycephalus Kessler in Conditions of Regulated Flow. Protection and Rational Use of the Wildlife of Kazakhstan’s Water Bodies: Materials of the International conferencei; KazSSR: Alma-Ata, Kazakhstan, 1969; pp. 86–89. [Google Scholar]
  22. Markun, M.I. Aral barbel, its taxonomy and biology. In Proceedings of the Aral Branch, VNIMORKH, Aralsk, USSR; 1933; pp. 5–47. [Google Scholar]
  23. Pavlovskaya, L.P. Morphological characteristics and some questions of the biology of the Aral barbel in the river period of life. In Fishes and the Hydrobiological Regime of the South Aral Basin; USSR: Tashkent, Uzbekistan, 1966; pp. 51–120. [Google Scholar]
  24. Usmanova, R.G. Sexual Dimorphism, Age and Local Variability of the Turkestan Barbel Barbus Capito Conocephalus Kessler in the Basin of the River; Questions of Ichthyology; Kashkadarya, USSR; 1971; Volume 11, pp. 203–216. Available online: https://www.iucn.org (accessed on 11 November 2023).
  25. Machordom, A.; Doadrio, I. Evidence of a Cenozoic Betic–Kabilian connection based on freshwater fish phylogeography (Luciobarbus, Cyprinidae). Mol. Phylogenetics Evol. 2001, 18, 252–263. [Google Scholar] [CrossRef]
  26. Brahimi, A.; Freyhof, J.; Henrard, A.; Libois, R. Luciobarbus chelifensis and L. mascarensis, two new species from Algeria (Teleostei: Cyprinidae). Zootaxa 2017, 4277, 32–50. [Google Scholar] [CrossRef]
  27. Brahimi, A.; Libois, R.; Henrard, A.; Freyhof, J. Luciobarbus lanigarensis and L. numidiensis, two new species of barbels from the Mediterranean Sea basin in North Africa (Teleostei: Cyprinidae). Zootaxa 2018, 4433, 542–560. [Google Scholar] [CrossRef] [PubMed]
  28. Levin, B.A.; Freyhof, J.; Lajbner, Z.; Perea, S.; Abdoli, A.; Gaffaroğlu, M.; Doadrio, I. Phylogenetic relationships of the algae scraping cyprinid genus Capoeta (Teleostei: Cyprinidae). Mol. Phylogenetics Evol. 2012, 62, 542–549. [Google Scholar] [CrossRef] [PubMed]
  29. Ouassal, K.; Perea, S.; Doadrio, I.; Casal-Lopez, M.; Yahyaoui, A. Assessment of genetic diversity in Luciobarbus rifensis Doadrio, Casal-López & Yahyaoui, 2015 (Teleostei: Cyprinidae) using cytochrome b. Aquac. Aquar. Conserv. Legis. 2021, 14, 282–290. [Google Scholar]
  30. Touil, A.; Casal-Lopez, M.; Bouhadad, R.; Doadrio, I. Phylogeny and phylogeography of the genus Luciobarbus (Haeckel, 1843) in Algeria inferred from mitochondrial DNA sequence variation. Mitochondrial DNA Part A 2019, 30, 332–344. [Google Scholar] [CrossRef]
  31. Yang, L.; Sado, T.; Hirt, M.V.; Pasco-Viel, E.; Arunachalam, M.; Li, J.; Mayden, R.L. Phylogeny and polyploidy: Resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Mol. Phylogenetics Evol. 2015, 85, 97–116. [Google Scholar] [CrossRef] [PubMed]
  32. Funk, D.J.; Omland, K.E. Species level paraphyly and polyphyly: Frequency, causes, and consequences, with insights from animal mitochondrial DNA. Annu. Rev. Ecol. Evol. Syst. 2003, 34, 397–423. [Google Scholar] [CrossRef]
  33. Chan, K.M.A.; Levin, S.A. Leaky prezygotic isolation and porous genomes: Rapid introgression of maternally inherited DNA. Evolution 2005, 59, 720–729. [Google Scholar] [PubMed]
  34. Zink, R.M.; Barrowclough, G. Mitochondrial DNA under siege in avian phylogeography. Mol. Ecol. 2008, 17, 2107–2121. [Google Scholar] [CrossRef]
  35. Toews, D.P.; Brelsford, A. The biogeography of mitochondrial and nuclear discordance in animals. Mol. Ecol. 2012, 21, 3907–3930. [Google Scholar] [CrossRef]
  36. Slettan, A.; Olsaker, I.; Lie, Ø. Polymorphic Atlantic salmon, Salmo salar L., microsatellites at the SSOSL438, SSOSL439, and SSOSL444 loci. Anim. Genet. 1996, 27, 57–58. [Google Scholar] [CrossRef]
  37. Estoup, A.; Presa, P.; Krieg, F.; Vaiman, D.; Guyomard, R. (CT)n and (GT)n microsatellites: A new class of genetic markers for Salmo trutta L. (brown trout). Heredity 1993, 71, 488–496. [Google Scholar] [CrossRef]
  38. Garcia de Leon, F.J.; Dallas, J.F.; Chatain, B.; Canonne, F.; Versini, J.J.; Bonhomme, F. Development and use of microsatellite markers in sea bass, Dicentrarchus labrax (Linnaeus, 1758) (Perciformes: Serrandidae). Mol. Mar. Biol. Biotechnol. 1995, 4, 62–68. [Google Scholar]
  39. Tan, G.; Karsi, A.; Li, P.; Kim, S.; Zheng, X.; Kucuktas, H.; Argue, B.J.; Dunham, R.A.; Liu, Z.J. Polymorphic microsatellite markers in Ictalurus punctatus and related catfish species. Mol. Ecol. 1999, 59, 190–194. [Google Scholar] [CrossRef]
  40. Landínez-García, R.M.; Márquez, E.J. Development and characterization of 24 polymorphic microsatellite loci for the freshwater fish Ichthyoelephas longirostris (Characiformes: Prochilodontidae). PeerJ 2016, 4, e2419. [Google Scholar] [CrossRef]
  41. Mariette, S.; Le Corre, V.; Austerlitz, F.; Kremer, A. Sampling within the genome for measuring within-population diversity: Tradeoffs between markers. Mol. Ecol. 2002, 11, 1145–1156. [Google Scholar] [CrossRef] [PubMed]
  42. Meirmans, P.G. Genodive version 3.0: Easy-to-use software for the analysis of genetic data of diploids and polyploids. Mol. Ecol. Resour. 2020, 20, 1126–1131. [Google Scholar] [CrossRef]
  43. Nei, M. Molecular Evolutionary Genetics; Columbia University Press: New York, NY, USA, 1987. [Google Scholar]
  44. Van Oosterhout, C.; Hutchinson, W.F.; Wills, D.P.; Shipley, P. MICRO-CHECKER: Software for identifying and correcting genotyping errors in microsatellite data. Mol. Ecol. Notes 2004, 4, 535–538. [Google Scholar] [CrossRef]
  45. Bostein, D.; White, R.L.; Sckolnick, M.; Davis, R.W. Construction of a genetic linkage map in man using restriction fragment length polymorphisms. Am. J. Hum. Genet. 1980, 32, 317–331. [Google Scholar]
  46. Pritchard, J.K.; Stephens, M.; Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 2000, 155, 945–959. [Google Scholar] [CrossRef] [PubMed]
  47. Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [PubMed]
  48. Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. CLUMPAK: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef]
  49. Excoffier, L.; Smouse, P.E.; Quattro, J.M. Analysis of molecular variance inferred from metric distances among DNA haplotypes: Application to human mitochondrial DNA restriction data. Genetics 1992, 131, 479–491. [Google Scholar] [CrossRef]
  50. De Santis, V.; Quadroni, S.; Britton, R.J.; Carosi, A.; Gutmann Roberts, C.; Lorenzoni, M.; Crosa, G.; Zaccara, S. Biological and trophic consequences of genetic introgression between endemic and invasive Barbus fishes. Biol. Invasions 2021, 23, 3351–3368. [Google Scholar] [CrossRef]
  51. Jia, Z.Y.; Zhang, Y.Y.; Shi, L.Y.; Bai, Q.L.; Jin, S.B.; Mou, Z.B. Amplification of rainbow trout microsatellites in Brachymystax lenok. Mol. Ecol. Resour. 2008, 8, 1520–1521. [Google Scholar] [CrossRef] [PubMed]
  52. Luo, W.; Nie, Z.; Zhan, F.; Wei, J.; Wang, W.; Gao, Z. Rapid development of microsatellite markers for the endangered fish Schizothorax biddulphi (Günther) using next generation sequencing and cross-species amplification. Int. J. Mol. Sci. 2012, 13, 14946–14955. [Google Scholar] [CrossRef] [PubMed] [PubMed Central]
  53. Jian, S.; Luo, W.; Wei, Q.; Wang, F.; Guo, W.; Ye, H.; Chu, Z.; Wu, J.; Zhang, S. Assignment of parentage by microsatellite analysis in the endangered Brachymystax lenok tsinlingensis (Salmonidae). Aquat. Biol. 2017, 26, 69–73. [Google Scholar]
  54. Hu, Y.; Liu, X.; Yang, J.; Xiao, K.; Wang, B.; Du, H. Development of Twenty-Two Novel Cross-Species Microsatellite Markers for Amur sturgeon (Acipenser schrenckii) from Chinese Sturgeon (Acipenser sinensis) via next-Generation Sequencing. Turk. J. Fish. Aquat. Sci. 2019, 19, 175–178. [Google Scholar] [CrossRef]
Fishes 09 00169 g001
Figure 1. Sampling location of barbels; (a): Map of Republic of Kazakhstan; (b): Aral–Syrdarya Basin in Kazakhstan territory; 1–5: L. brachycephalus and L. conocephalus.
Figure 1. Sampling location of barbels; (a): Map of Republic of Kazakhstan; (b): Aral–Syrdarya Basin in Kazakhstan territory; 1–5: L. brachycephalus and L. conocephalus.
Fishes 09 00169 g001
Fishes 09 00169 g002
Figure 2. Bayesian cluster analysis based on STRUCTURE (A) and results analysis aligned in CLUMPAK (B). The colors represent the mean proportion of membership (Q) to each of the inferred groups K = 5. 1: Bairykum village (L. brachycephalus); 2: Kyzylorda region (L. brachycephalus; L. conocephalus); 3: Basykara Dam (L. brachycephalus); 4: Rice Check (L. brachycephalus; L. conocephalus); 5: Badam River (L. conocephalus).
Figure 2. Bayesian cluster analysis based on STRUCTURE (A) and results analysis aligned in CLUMPAK (B). The colors represent the mean proportion of membership (Q) to each of the inferred groups K = 5. 1: Bairykum village (L. brachycephalus); 2: Kyzylorda region (L. brachycephalus; L. conocephalus); 3: Basykara Dam (L. brachycephalus); 4: Rice Check (L. brachycephalus; L. conocephalus); 5: Badam River (L. conocephalus).
Fishes 09 00169 g002
Table 1. Sampling points and species of this study.
Table 1. Sampling points and species of this study.
N°LocationSpeciesNumber of Sampled Individuals (n = 81)LatitudeLongitude
1Bairykum villageL. brachycephalus742.076468.4753
2Kyzylorda regionL. brachycephalus2145.75738162.322459
L. conocephalus2
3Basykara damL. brachycephalus2545.758315662.3254401
4Rice checkL. brachycephalus2245.2104364.12054
L. conocephalus2
5Badam RiverL. conocephalus242.308893369.5388738
Table 2. Characterization of 17 nucleotide microsatellite loci for Luciobarbus brachycephalus (Kessler, 1872) and Luciobarbus conocephalus (Kessler, 1872).
Table 2. Characterization of 17 nucleotide microsatellite loci for Luciobarbus brachycephalus (Kessler, 1872) and Luciobarbus conocephalus (Kessler, 1872).
Locus NamePrimer Sequence (5′–3′)Amplicon SizeRepeat MotifTail of PrimerFluorescent Marker
M1287F:TAATTAGCAACAGGCCCGCA
R: TGCGTTCCCGTGTTTGAATG		170(AG)10T3PET
M1417F:CCAAGTCTCGCTATCCTCGG
R:AAGAGGAGTGATGACAGCGC		114(CCG)5CAGNED
M1182F:GCTCTCGTTCCAGTCCAGAC
R: AGCATCTGGCCATGATGGAG		193(AATC)7CAGVIC
M2237F:GAAGGTCACGTGGTTGTCCA
R: AGGGAATTGGATGCAGCTCC		91(AG)12CAGPET
M2108F:GCTGCGGATTGGTCAAGAAC
R: GCTCTTCTCCTCTCATCCGC		91(AG)14M13NED
M2044F:TATGCAGCTTCCACCCACTG
R:GTTCACGCTGTTTGCTGGAG		103(AC)10M13NED
M2164F:GGCGTTGTTGAGCCAATCAG
R: TGACTTTGGCAGGACGTGTT		91(AGC)5M13VIC
M2306F:CAGTCCCAGACTCTTCCAGC
R:CCGGTGTGCGATCCAATCTA		302(ATC)5CAGNED
M3230F:ATTGAGGATCCCGAGGCTCT
R:CGATAAGCCCGTGAGACGTT		149(AGG)5T3PET
M3264F:TGGTCATGCATGCGGTACAT
R:AAGGTCACTGAAGTGCTGCA		159(ACAG)6T3NED
M3318F:AGTGAAAGCATGTCCAGGCA
R:GGAACTGGCCGTGAAATGG		217(AG)18CAGVIC
M3444F:ATGACTCAGGTGAAGCAGGC
R:CCGCTCCTGCTTGACTTCAT		223(AGC)7CAGVIC
M4211F:CTAGACGAGCAGCACTGGAG
R:CATTAGACAGCCGAGCCCTT		109(AC)11CAGPET
M4455F:TGTATGACGCTGGTTGGAGC
R:ATGATACGATCCCAGCGCTG		110(AC)11M13NED
M4215F:CGAGCCGATCTCTGTCTGTG
R:CCCAAACCCAAGAAAGTGCG		91(AATC)10M13PET
M4138F:CTGGCTGTCAACCTGTGGAA
R:CTCCAGAGTCCGTACCTGGA		153(AG)10CAGVIC
M4474F:AACACTGACCATGTGACGCA
R:CCAACTTCTGGTCCGGCATA		238(AC)11T3PET
Table 3. Indices of genetic diversity for L. brachycephalus and L. conocephalus at each sampling point in the Aral–Syrdarya Basin.
Table 3. Indices of genetic diversity for L. brachycephalus and L. conocephalus at each sampling point in the Aral–Syrdarya Basin.
Sampling PointsSpeciesNaNeHoHeGis
Bairykum v.L. brachycephalus3.2672.2830.5180.497−0.042
Kyzylorda r.L. brachycephalus4.5332.6530.5780.546−0.058
L. conocephalus
Basykara d.L. brachycephalus5.0672.7070.5400.539−0.001
Rice checkL. brachycephalus4.6672.6590.5570.552−0.008
L. conocephalus
Badam R.L. conocephalus1.8671.8120.4330.428−0.014
Na: number of alleles; Ne: effective number of alleles; Ho: observed heterozygosity; He: expected heterozygosity; Gis: inbreeding coefficient.
Table 4. Indices of genetic diversity per locus.
Table 4. Indices of genetic diversity per locus.
LocusNaNeHoHsHtH’tGis
M128711.0002.9460.8270.6990.7300.738−0.184
M14173.0002.6400.8790.6500.6460.645−0.353
M11825.0002.6780.8210.6600.6950.704−0.243
M22375.0001.4090.1860.3200.3210.3210.420
M21083.0001.0570.0370.0570.0550.0550.341
M204412.0005.0930.9110.8420.8600.864−0.082
M21643.0001.0620.0410.0640.0610.0610.357
M23062.0001.5840.2420.3900.4760.4970.380
M32302.0001.9960.6540.5140.5030.500−0.273
M32646.0002.4030.7580.6020.5910.588−0.259
M34448.0002.8850.8240.6750.6760.676−0.221
M42114.0001.5140.2550.3570.3740.3780.288
M42159.0003.0300.2370.7210.8110.8330.672
M41385.0002.1450.7150.5500.5420.540−0.300
M447412.0002.4300.4900.6180.7380.7680.207
Mean6.0002.3250.5250.5150.5390.545−0.020
Na: number of alleles; Ne: effective number of alleles; Ho: observed heterozygosity; Hs: heterozygosity within populations; Ht: total heterozygosity: H’t; corrected total heterozygosity; Gis: inbreeding coefficient.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Adyrbekova, K.; Perea, S.; Doadrio, I. Development and Characterization of Fifteen Polymorphic Microsatellite Loci for Rare and Endangered Species within Luciobarbus Heckel, 1843 Genus in the Aral Basin and Their Conservation Application. Fishes 2024, 9, 169. https://doi.org/10.3390/fishes9050169

AMA Style

Adyrbekova K, Perea S, Doadrio I. Development and Characterization of Fifteen Polymorphic Microsatellite Loci for Rare and Endangered Species within Luciobarbus Heckel, 1843 Genus in the Aral Basin and Their Conservation Application. Fishes. 2024; 9(5):169. https://doi.org/10.3390/fishes9050169

Chicago/Turabian Style

Adyrbekova, Kamila, Silvia Perea, and Ignacio Doadrio. 2024. "Development and Characterization of Fifteen Polymorphic Microsatellite Loci for Rare and Endangered Species within Luciobarbus Heckel, 1843 Genus in the Aral Basin and Their Conservation Application" Fishes 9, no. 5: 169. https://doi.org/10.3390/fishes9050169

APA Style

Adyrbekova, K., Perea, S., & Doadrio, I. (2024). Development and Characterization of Fifteen Polymorphic Microsatellite Loci for Rare and Endangered Species within Luciobarbus Heckel, 1843 Genus in the Aral Basin and Their Conservation Application. Fishes, 9(5), 169. https://doi.org/10.3390/fishes9050169

Article Metrics

Back to TopTop