Next Article in Journal
Partial Replacement of Fish Meal with Protein Hydrolysates in the Diet of Penaeus vannamei (Boone, 1934) during the Nursery Phase
Previous Article in Journal
Different Protein Hydrolysates Can Be Used in the Penaeus vannamei (Boone, 1934) Diet as a Partial Replacement for Fish Meal during the Grow-Out Phase
Previous Article in Special Issue
Automated Monitoring of Bluefin Tuna Growth in Cages Using a Cohort-Based Approach
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 9
Issue 2
10.3390/fishes9020074
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Influence of Water Nitrate Concentration Combined with Elevated Temperature on Rainbow Trout Oncorhynchus mykiss in an Experimental Aquaponic Setup

by
Dimitrios K. Papadopoulos
1,
Athanasios Lattos
1,
Ioanna Chatzigeorgiou
2,
Aphrodite Tsaballa
2,
Georgios K. Ntinas
2 and
Ioannis A. Giantsis
1,*
1
Department of Animal Science, Faculty of Agricultural Sciences, University of Western Macedonia, 53100 Florina, Greece
2
Institute of Plant Breeding and Genetic Resources, ELGO-DIMITRA, 57001 Thessaloniki, Greece
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(2), 74; https://doi.org/10.3390/fishes9020074
Submission received: 13 January 2024 / Revised: 7 February 2024 / Accepted: 12 February 2024 / Published: 13 February 2024
(This article belongs to the Special Issue Development of Sustainable Aquaculture Production)
Browse Figures
Versions Notes

Abstract

:
Intensive recirculating systems are a fast-developing sector of aquaculture. While several warm-water fish have been reared in aquaponics, almost no data are available for cold-water species. The determination of nitrate toxicity thresholds in recirculating aquaculture is crucial. Different pollutants are typically more toxic at elevated temperatures. We investigated the performance of Oncorhynchus mykiss under two different nitrate levels and two temperatures. We applied a 2 × 2 factorial design, where fish (9.78 ± 0.51 g) were exposed to nitrate concentrations of 40 or 110 mg/L NO3− and to temperatures of 17 °C or 21 °C for 20 days. This study focused on understanding the physiological responses of rainbow trout to relatively low nitrate levels under heat stress in order to investigate the feasibility of integrating this species into commercial aquaponics. The growth, condition, and expression of genes involved in metabolism, heat shock, antioxidant, and immune response were assessed in the liver, together with the activities of enzymes related to glucose and fatty acid metabolism. High nitrate levels at 17 °C affected the condition but did not alter growth, leading to increased glycolytic potential and, occasionally, a greater reliance on lipid oxidation. Antioxidant defense was mainly induced due to high nitrates and the similar expression patterns of antioxidant genes observed under high nitrate at both 17 °C and 21 °C. Warm exposure decreased condition and growth, leading to greatly reduced glucokinase transcription, irrespective of the nitrate levels. Exposure to 21 °C and high nitrate led to equivalent growth and condition as well as to a milder inflammatory response combined with metabolic readjustments (enhancement of glycolytic and lipid oxidation pathways) compared to the low nitrates at 21 °C. Based on the results, rearing at a temperature close to 21 °C should be avoided for fingerling growth, while NO3− concentration until 110 mg/L may not have severe impacts on fingerling health and growth at 17 °C. In addition, rainbow trout fingerlings can tolerate a 20-day exposure at 21 °C and NO3− up to 110 mg/L. Additional factors should always be considered, such as specific water quality parameters, for a comprehensive approach to assessing the feasibility of rainbow trout aquaculture in aquaponics.
Keywords:
Oncorhynchus mykiss; heat stress; nitrate toxicity; gene expression; metabolism
Key Contribution: These results demonstrate that a temperature of 21 °C is an obstacle to fingerling rainbow trout productivity, affirming a relatively comfortable tolerance of 110 mg/L NO3− at 17 °C and suggesting that rainbow trout fingerlings can survive a 20-day exposure at 21 °C in a recirculating system (RAS) containing NO3− up to 110 mg/L. These conditions may occur in aquaponics applied in temperate climates that cultivate several plant species. Higher nitrate levels (appropriate for crop productivity in aquaponics) and longer exposure should be tested at 17 °C as a next step in future studies. Rainbow trout culture at 21 °C or greater temperature could be achieved in aquaponics by gradual temperature acclimation and by the use of existing genetically selected thermally resistant animals.

Graphical Abstract

1. Introduction

It is of great importance to expand food production sustainably in order to meet the demands of the growing human population [1]. However, the effort to satisfy these demands involves a strong reliance on natural resources like water, land, and nutrients that are already unsustainably exploited using modern agricultural practices [2]. Aquaponics is considered to be one of the most efficient and sustainable animal protein production systems since fishes have better feed conversion ratios than other agricultural animals, and, in parallel, residual feed and fish waste can be converted into plant biomass [3]. Aquaponic systems combine recirculation aquaculture systems (RASs) technology for rearing fish together with hydroponics for plant cultivation, where plants grow in water-based nutrients instead of soil [4,5]. Nitrogen is the main essential nutrient that the aquaculture system provides to the hydroponically co-cultured plants. These systems offer eco-friendly food supply chains that efficiently utilize resources, resulting in improved economic and environmental sustainability and increased food resilience [6]. Nevertheless, there is a lack of focus on commercial implementation despite the multiple advantages of these systems. Love et al. [7] conducted a survey of commercial aquaponic operations (mostly in the USA) and found that approximately 31% of the examined systems had prospects in terms of attaining profitability or economic sustainability.
The rainbow trout Oncorhynchus mykiss is the most important cultured freshwater fish species in Europe [5]. In 2020, rainbow trout production represented 1.72% of global finfish aquaculture [8]. This species is mainly cultured in outdoor grow-out facilities inside concrete raceways, flow-through Danish ponds, or cages. In many countries, environmental regulations for reducing effluents have already led to the utilization of RASs for rainbow trout aquaculture [9,10]. While several warm-water species have been reared in aquaponic systems [4,11], hardly any data are available for cold-water species, including rainbow trout [12]. However, it should be noted that due to its higher commercial value, rainbow trout could enhance the profitability and competitiveness of an aquaponic operation compared to tilapias and cyprinids [3].
Continuous water recycling leads to the accumulation of various undesirable substances that can severely deteriorate water quality and thus harm the cultured organism [13]. Water recirculation systems accumulate nitrate as an end product of nitrification. Nitrate ions can be removed from a recirculating system either by water exchanges or by organisms like plants and denitrifying or photosynthetic bacteria. Especially in carnivore fish rearing, nitrates may accumulate at higher rates since carnivores require high dietary protein. The determination of nitrate toxicity thresholds for cultured species in RASs is crucial for achieving the optimal health, welfare, and performance of the cultured organism and defining a critical criterion of water quality that guides the design of the system engineering [14].
Nitrate ions become toxic to fishes due to their conversion to nitrite ions, which subsequently oxidize blood hemoglobin to methemoglobin. The latter molecule is improper in terms of reversible oxygen binding affinity, leading to inherent loss of blood oxygen carrying capacity [15], resulting in tissue hypoxia. When water nitrate levels are high, passive or facilitated uptake of these ions takes place via the gill epithelium (HCO3−/Cl− channel), and nitrate is absorbed and dissolves in the plasma [16,17]. Oxygen uptake across the gills is reduced when fish are exposed to elevated nitrate levels [18]. Nitrate can reduce the growth of fish [19,20] and impede their survival [21]. The formation of methemoglobin lowers blood oxygen carrying capacity, which may lessen aerobic scope. Reduced aerobic scope leads to adverse consequences in fish in terms of their functional performance.
Due to their requirement for high oxygen levels [22], rainbow trout may be highly vulnerable to nitrate, especially at higher water temperatures. Fish, as poikilotherms, are highly sensitive to water temperature fluctuations. Rainbow trout’s optimal temperature for growth is 17 °C [23], while temperatures outside the range of 10–18 °C generate a stress response and affect physiological balance [24]. Under heat stress, fish respond by triggering mechanisms that increase blood oxygen carrying capacity or through modifications to hemoglobin oxygen binding affinity [25,26]. Modifications in the cardiorespiratory system to support efficient oxygen transportation are crucial for the acclimation of fish to elevated temperatures [27], and reduced oxygen supply capacity may increase thermal vulnerability in fish [28]. Blood oxygen carrying capacity was found to be positively linked to a higher temperature tolerance in chinook salmon (Oncorhynchus tshawytscha) [29] and in European grayling Thymallus thymallus [30].
The toxicity of different chemical substances at different temperatures is complicated since temperature affects chemical uptake and detoxification procedures [31]. Different pollutants are typically more toxic at elevated temperatures [32,33], which is possibly due to greater metabolic rates, increased uptake rates, or altered respiration efficiency [34]. Nitrate toxicity seems to be greatly influenced by temperature [30,35,36,37]. In aquaponics, plant demands for nitrogen may be elevated compared to fish nitrate tolerance range for achieving adequate crop productivity. However, leafy plants like water spinach (Ipomoea aquatica) and mustard green (Brassica juncea) have been successfully grown in aquaponics at lower than 3.2 mg/L NO3-N [38], which is equivalent to about 14 mg/L NO3−. Moreover, pak choi (Brassica chinensis) has been finely grown under NO3− concentrations ranging from about 70 to 220 mg/L in aquaponic systems together with Cyprinus carpio [39]. Research regarding the evaluation of chronic nitrate toxicity in rainbow trout is limited. Westin [40] reported an acceptable upper limit of 57 mg NO3-N/L as well as an optimal level of just 5.7 mg NO3-N/L (equivalent to about 250 and 25 mg NO3−, respectively) for long-term culture. In the eggs and fry of freshwater salmonid species, sublethal effects of chronic exposure occurred at concentrations of <25 mg/L NO3-N (or about 110 mg/L NO3−) [41]. On the other hand, Davidson et al. [14] pointed out that much greater NO3− levels (of about 400 mg/L) were responsible for chronic fitness and health issues in juvenile rainbow trout.
Nitrates and heat stress can independently disrupt fish energy homeostasis through enhanced maintenance costs and impaired oxygen transport capacity [36]. In combination, the two aforementioned factors can cooperate, resulting in unpredictable outcomes [37]. The objective of this study was to investigate the effects of heat stress, relatively elevated nitrate levels, and their interactions in relation to rainbow trout so as to evaluate the response of this species to conditions that may emerge in aquaponic systems. The low nitrate treatment was set to 40 mg/L NO3− in order to be below the current EU nitrate limit of 50 mg/L in surface and groundwaters (Nitrates Directive 91/676/EEC), and the high nitrate treatment was set to 110 mg/L. We recorded the growth rate, which is an outcome of various interacting factors on various organs, systems and biochemical pathways, indicating overall physiological health [42] and the condition factor that can reflect the overall ’well-being’ of an animal [43]. The activity of the enzymes citrate synthase (CS), 3-hydroxyacyl-CoA dehydrogenase (HOAD), and lactate dehydrogenase (LDH), and the transcription of genes involved in metabolism, heat shock, antioxidant activity, and immune response was also assessed in a 20-day trial.

2. Materials and Methods

2.1. Animal Acclimation

The fish were obtained from Pella Hydrobiological State Hatchery in Greece. The water temperature in the facility was 13.5 °C. After transportation, they were randomly distributed into 8 rectangular aquaria (55 cm × 35 cm × 42 cm, 80 L) filled with water from the supplementary water tanks of the adjacent aquaponic system (Figure 1). The aquaria contained a water pump for water circulation and a biological filter and an air stone. The aquaria were placed inside a pilot greenhouse at the Institute of Plant Breeding and Genetic Resources of ELGO-DIMITRA in Thermi Thessaloniki, Greece (40°32′17.4″ N, 22°59′58.2″ E). The experimental greenhouse includes two spaces, one above ground for plant production and one below ground for fish production, following a vertical production approach to achieve better land and energy use efficiency under the ICAS-Smart Aquaponics project. The water temperature in the aquaria was maintained at 16.9 ± 0.5 °C, and the fish were acclimated for two weeks to adapt to the conditions of the aquaria. The dissolved oxygen (DO) content was measured daily using a portable dissolved oxygen meter, HANNA HI9142 (HANNA Instruments Inc., Woonsocket, RI, USA). Total ammonium nitrogen (TAN), nitrite, and nitrate concentrations were checked twice daily using test kits (Tetra, Melle, Germany) and always maintained at levels below 0.25 mg/L, 0.25 mg/L, and 30 mg/L, respectively, conducting water exchanges around 20% every day using water from the supplementary aquaponic tanks that had nitrate levels of 22–25 mg/L. Each aquarium contained 20 fish with a mean initial weight of 7.84 ± 0.28 g and a mean length of 8.62 ± 0.41 cm, yielding a stocking density of 1.96 g/L and 0.25 specimens per liter. The fish were fed 2.5 mm commercial pellets (Optiline 1P S, Skretting) at a daily ration of 1–2% of their body weight. Throughout the acclimation period, the photoperiod was 14:10 h light: dark. After two weeks of acclimation, the fish appeared to be well adapted (absence of mortality and agonistic behavior, active food capturing and swimming), thus the experiment was started. All biofilters were fully capable of complete nitrification at the beginning of the study.

2.2. Trial Design

Eight aquaria (Figure 1) were randomly selected for the 4 treatments (with two replicates for each treatment). The different treatments were as follows: two temperatures (17.1 ± 0.5 °C and 21.08 ± 0.25 °C) × two nitrate levels (38 ± 6.1 mg/L NO3− and 112 ± 6.8 mg/L NO3−). The fish subjected to 17.1± 0.5 °C and NO3− of 38 ± 6.1 mg/L were designated the control group. At the 21 °C temperature treatment, the water was kept at a constant temperature using electronic aquarium heaters (Buyo Digital Aquarium Heater DR-9300). At the beginning of the experimental procedure, the water was heated at a rate of 0.1 degrees per hour. TAN and nitrite were measured twice every day during the trial, and their levels were always below 0.25 mg/L, even before water exchanges. The nitrate concentrations were initially adjusted in the high nitrate treatment (rate of 6 mg/L per hour), adding sodium nitrate (Chem-Lab, Zedelgem, Belgium), and a small water change of about 3 liters was performed daily to keep the nitrate concentration inside the desired range. Sodium sulfate (Chem-Lab, Zedelgem, Belgium) was also added at the beginning of the trial to the low nitrate treatments so as to balance the sodium concentration and electric conductivity between treatments. Feces and uneaten feed were siphoned every day in parallel with the water changes. Temperature (HANNA HI98129, HANNA Instruments Inc., Woonsocket, RI, USA) and nitrate concentration (LAQUAtwin-NO3−, Horiba Scientific, Kyoto, Japan) were measured twice daily. LAQUAtwin-NO3− has an accuracy of ± 10% of the actual value [44]. EC, pH (HANNA HI98129, HANNA Instruments Inc., Woonsocket, USA), DO (HANNA HI9142, HANNA Instruments Inc., Woonsocket, RI, USA), TAN, and nitrite levels (Tetra, Melle, Germany) were also measured twice daily; however, along with TAN and nitrite, they were stable and did not vary between treatments. The feeding ration (2.5 mm, Optiline 1P S, Skretting) was set at 1.8% of the total weight of the fish per day and provided manually in three equal rations with two-hour intervals. The feed composition was 44.5% protein, 20% fat, 3% fiber, and 7.5% ash, according to the supplier. The daily ration was set to 1.8% based on standardized feeding charts and on the observations of wasted feed during the acclimation period as well. Every week and also following each sampling, the fish were weighed, and the amount of food was adjusted accordingly.

2.3. Sampling Procedures

Six samplings were performed for gene expression analysis at hour 1, hour 5, hour 24, day 4, day 7, and day 15 after temperature and nitrates reached the selected levels in each experimental group. After 20 days, the last sampling was conducted to calculate the condition, growth rate, and feed conversion. At all samplings, two fish from each aquarium were randomly sampled; therefore, a total of 4 specimens from every treatment were chosen for gene expression and enzymatic activity measurements. Randomly captured fish were placed immediately in a 30 L bucket containing water from their aquarium and an air stone, which kept the oxygen levels high. Εugenol (Sigma, St. Luis, MO, USA, 99% purity) was added to the bucket at a concentration of 100 mg/L until the animals were totally anesthetized and, afterwards, the fish were killed via spinal cord cutting. Then, the fish were anatomized, and their livers were dissected. A small piece of liver (approximately 50 mg) was used directly for RNA extraction, and the remaining tissue was flash-frozen in liquid nitrogen and subsequently stored at −80 °C. For weight and length measurements, the same procedure of anesthetizing was applied.

2.4. Experimental Analysis

2.4.1. Calculation of Condition, Weight Growth and Feed Conversion Ratio

The condition factor was only calculated after 20 days; therefore, the remaining 8 fish in each aquarium were chosen (initial number n = 20, with a survival rate of 100%, 12 fish used for gene expression). The condition factor was expressed as Fulton’s condition factor K = 100 × W/L3, where W is the somatic total weight (g) and L the total length (cm).
Weight-specific growth rate (SGR) and feed conversion ratio (FCR) were calculated as follows:
Specific growth rate (SGR) = 100 × ((lnW2 − lnW1)/t)
Feed conversion ratio (FCR) = 100 × (feed offered)/(W2 − W1),
where W1 and W2 are the initial and final weights (g) of fish, respectively, and t indicates the number of feeding days.

2.4.2. RNA Extraction and cDNA Synthesis

The total RNA from the liver was extracted using NucleoZOL reagent (Macherey-Nagel, Düren, Germany), according to the manufacturer’s protocol, except for the optional phase separation step, which was not performed. Approximately 50 mg of liver (n = 96 samples, 6 samplings × 4 fish × 4 treatments) was hand homogenized via pestling in 500 μL NucleoZOL, and RNAase-free water was added to the homogenate. Afterward, the samples were centrifuged, and isopropanol was added to the supernatant for RNA precipitation. Once more, the samples were centrifuged, and the RNA pellet was washed via two ethanol washes. Afterward, the extracted RNA was diluted in 80 μL nuclease-free water. The RNA concentration and purity were evaluated on a Quawell UV-Vis 5000 spectrophotometer (Quawell Technology, San Jose, CA, USA), and the extracted RNA was kept at −80 °C until reverse transcription. In the reverse transcription step, about 500 ng of total RNA from each sample was used for the reaction along with the PrimeScript kit (Takara, Japan) and the oligodT primers, following the manufacturer’s protocol.

2.4.3. Gene Expression Analysis

The gene expression of the six genes (catalase, Cu/Zn superoxide dismutase, heat shock protein 70, glucokinase, citrate synthase and tumor necrosis factor-alpha) was assessed using quantitative real-time PCR (qPCR). The comparative CT method (2−ΔΔCT method), as described by Livak and Schmittgen [45], was applied to quantify the relative expression of these genes in the livers of rainbow trout. cDNA from 40 mg/L NO3− and 17 °C treatment served as the control samples. The CT values of all of the examined genes were normalized to the CT values of the most stable reference gene, namely EF1-a. For each gene, a total of 96 samples were run in qPCR. PCR reactions were carried out using KAPA SYBR® FAST qPCR Master Mix (2×) kit in a 10 μL volume. All reaction wells contained 10 ng of cDNA as a template, 5 μL of KAPA SYBR® FAST qPCR Master Mix (2×), 2 μΜ of each primer, and PCR-grade water until reaching 10 μL. The runs were performed for 40 cycles in qPCR Thermocycler Eco 48 Real-time PCR (Illumina, San Diego, CA, USA). The primers used are listed in Table 1. Primer efficiency was calculated, and when the value was outside the range of 1.9–2.1 (or 90–110%), the primer pair was rejected and replaced.

2.4.4. Activity of Metabolic Enzymes Measurement

The activities of the metabolic enzymes citrate synthase (CS, EC 4.1.3.7) and 3 hydroxyacylCoA dehydrogenase (HOAD, EC 1.1.1.35) and lactate dehydrogenase (LDH, EC 1.1.1.27) were assessed spectrophotometrically, as described by Thibault et al. [49].

2.4.5. Statistical Analysis

All of the results are expressed as means ± standard deviation. The normality of the data was checked by applying the Shapiro–Wilk test, and Levene’s test (p < 0.05) was used in order to check the homogeneity of variances in the means. When the assumptions for the application of the analysis of variance were not met, the data were subjected to transformation. Afterward, two-way analysis of variance (ANOVA) was performed at p < 0.05 with temperature and nitrate concentration as fixed factors to test for the significance of factor interactions between the experimental groups. Finally, Tukey’s HSD post hoc comparisons were conducted to define the statistically significant differences (p < 0.05) between the means of the different groups. The obtained p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on gene transcription levels and on enzymatic activities were corrected through the Benjamini–Hochberg (BH) method and the FDR-adjusted p-values were used for the interpretation of the results. Statistical analyses and figures were carried out using Microsoft Excel 2017 and Data Analysis Toolpack which is available in Excel Add-Ins.

3. Results

3.1. Growth Performance, Survival Rate and Condition Factor

Condition factor, weight SGR, FCR, and the survival of rainbow trout subjected for 20 days to four treatments are summarized in Table 2. Survival was 100% in all groups. The final condition was significantly affected by both examined factors and by their interaction (p < 0.05, Table 3). The condition was significantly greater in the 17L treatment, while the rest of the groups exhibited equivalent conditions (Table 2). The weight-specific growth rate was only affected by temperature (p < 0.05, Table 3). Growth was significantly lower at 21 °C treatments and equivalent in the same temperature regardless of the nitrate levels (Table 2). According to weight SGR, the feed conversion ratio was only affected by temperature (p < 0.05, Table 3) and was better at 17 °C (Table 2).

3.2. Gene Transcription Profiles in Liver

3.2.1. Metabolic Gene Expression

Citrate synthase expression was significantly affected by temperature, nitrate concentration, and their interaction as well (Table 4, p < 0.05). In all experimental groups, the expression of Citrate synthase was significantly increased in contrast to 17L (control) during the first 5 h (Figure 2A). Under low-temperature and high-nitrate (17H) conditions, a continuously greater expression of Citrate synthase was observed compared to the control. In the 21L group, similar levels of expression were found on hour 24 and day 15, which were depressed on day 4 and elevated on day 7. In 21H, levels lower or similar to the control in terms of expression were detected following the fifth hour of exposure (Figure 2A).
Rainbow trout’s glucokinase expression was also constantly affected by both studied factors with slight exceptions (Table 4, p < 0.05). On hour 5, the 21 °C treatments displayed significantly elevated mRNA levels (Figure 2B). From hour 24 until day 15, the 17H treatment exhibited levels that were decreased or similar to control glucokinase mRNA levels. Animals exposed to 21 °C from hour 24 until day 15 always had a significantly depressed expression of glucokinase compared to the fish reared at 17 °C. In the same time frame, the 21H treatment exhibited similar or lower mRNA levels of glucokinase compared to 21L (Figure 2B).

3.2.2. hsp70 Gene Expression

The expression of hsp70 was, in general, affected by both temperature and nitrate, but the factor interaction did not affect hsp70 expression significantly in three out of the six samplings (Table 4). A clear trend of hsp70 mRNA was observed during the first 5 h and also on day 15, when at 21 °C, mRNA levels that were significantly greater than those in the 17 °C treatment were detected, irrespective of the nitrate concentration (Figure 3). On hour 24, a greater expression of the hsp70 gene was found in warm exposed fish, and the highest expression was met in 21L. On day 4, all treatments exhibited significantly decreased levels of hsp70 compared to the control fish. On day 7, both 17 °C treatments had similar levels of expression, which were significantly lower from 21 °C, while 21H exhibited the greatest quantity of hsp70 mRNA.

3.2.3. Antioxidant Gene Expression

Catalase expression was mainly influenced by nitrate levels, while the factor interactions affected the expression significantly in four out of the six samplings (Table 4). On hour 1, a significantly greater expression was found in the fish subjected to a warm environment, while 17H exhibited lower levels than 17L (Figure 4A). On hour 5, the high nitrate treatments had greater catalase expression compared to the low nitrate treatments. On hour 24, a similar amount of catalase mRNA was detected among 17H, 21L, and 21H. On day 4, treatments 17H, 21L, and 21H again exhibited significantly elevated levels, which were similar to the high-temperature treatments, while 17H displayed an even greater catalase gene expression. On day 7, catalase mRNA levels were depressed in both 21 °C treatments in comparison to the control, while a similar expression to that of the control was found in 17H. On day 15, the amount of catalase mRNA was equivalent in all treatments (Figure 4A).
Temperature significantly influenced Cu/Zn sod expression until day 4, while nitrate levels and factor interactions significantly affected the transcription of this gene (Table 4). On hour 1, all groups had significantly increased levels of expression compared to the control treatment (Figure 4B). On hour 5, only 21H displayed a statistically significant elevated expression of Cu/Zn sod. On hour 24, high nitrate exposure resulted in an equivalent amount of Cu/Zn sod mRNA, which was significantly lower than both low nitrate treatments. On day 4, Cu/Zn sod expression was found to be similar in fish reared at the same temperature and was significantly lower in animals exposed to 21 °C. On day 7, fish reared in 110 mg/L NO3− exhibited significantly lower expression of sod than fish reared in 40 mg/L NO3− irrespective of the temperature and at day 15, the opposite pattern was observed (Figure 4B).

3.2.4. tnf-a Gene Expression

The amount of tnf-a mRNA was significantly affected by temperature and nitrate concentration, while the interaction of the two factors was found to be constantly significant for tnf-a transcription (Table 4). During the first 5 h, tnf-a mRNA levels were significantly elevated in the fish exposed to 110 mg/L NO3− (Figure 5), while from hour 24 until day 7, all of the treatments displayed significantly increased expression of tnf-a compared to the control. On day 15, 21H exhibited an expression equal to the control, while the 17H and 21L treatments displayed higher levels of tnf-a mRNA. Regarding the high nitrate treatments, significantly elevated expression was observed within the first 5 h and on day 7 compared to the low nitrate treatments. Animals from 17H exhibited high levels of tnf-a expression throughout the trial, and the mRNA levels of this group were the highest in three samplings (Figure 5).

3.3. Enzymatic Activities in the Liver

With reference to Table 5, the examined activity of the metabolic enzyme was significantly affected by temperature and nitrate concentration in most cases as well as their interaction.
Citrate synthase enzymatic activity was generally similar or significantly increased compared to the control treatment in 17H. The 21L treatment exhibited minor fluctuations in CS activity compared to the control, while the 21H treatment had significantly reduced activity throughout the trial with slight exceptions (Figure 6A). On day 4, citrate synthase presented statistically significant lower activity in terms of CS in the liver of 21 °C reared trout, while increased activity was detected in 17H compared to the control. On day 7, only 21L treatment exhibited significantly higher activity of CS among all treatments, and on day 15, warm exposure led to significantly decreased CS activity, which was even lower in 21H animals (Figure 6A).
HOAD activity was found to be significantly reduced in high nitrate treatments within the first 24 h, when the 21L treatment basically exhibited similar activity to that of the control fishes. In contrast, on days 4 and 7, the liver of fishes exposed to high nitrates exhibited increased activity of HOAD in comparison to the control fishes, and also, on day 15, similar or significantly higher activities were detected in high nitrates (Figure 6B). The 21L treatment was similar to the control activity of HOAD until day 15.
Concerning LDH activity, minor differences were detected among both low nitrate treatments until day 15 (Figure 6C). On the other hand, high nitrates resulted in a significant decrease in LDH activity after 24 h, and later, increased activity on days 4 and 7 in the 21H treatment (Figure 6C). On day 15, all fish displayed similar activity in terms of LDH.

4. Discussion

In aquaponic systems, elevated temperatures are often encountered due to climate conditions. Persistent high temperatures have induced great losses to aquaculture [50]. When cooling is applied, this involves higher production costs, largely affecting the sustainability of the system. In the present vertical arrangement of the aquaponic system, placing the fish tanks beneath the greenhouse helped to minimize the cooling energy. The main system, as with the majority of aquaponic systems, was a decoupled aquaponic system where water is recirculated within the RAS and the hydroponic system, and the water loss due to plant evapotranspiration is replaced from the fish tanks [15]. The decoupled method is more energy and capital-intensive. During summer, the temperature in the basement area reached 22 °C, leading to the necessity of testing the response of rainbow trout under heat stress. It should be noted that for rainbow trout aquaculture in new areas, especially those facing warm summers, could be established using genetically selected thermal-resistant trout, which are able to endure higher water temperatures [51].
Greater condition after 20 days was observed in fish reared at 17 °C and low nitrate, while the final condition in 17H did not vary significantly from the condition of the animals reared at 21 °C. Weight growth and feed conversion ratios were found to be greater at 17 °C, while no impact was derived from different nitrate levels at the same temperature. No mortality was recorded during the 20-day trial. Similar to these results, Jiang et al. [52] found a greater growth rate in terms of weight and better FCR in juvenile O. mykiss at 17 °C rather than at 21 °C. The absence of mortalities observed in the high nitrate treatments was not surprising, as Davidson et al. [53,54], when exposing rainbow trout to chronic NO3-N concentrations of 13 and 99 mg/L (or about 58 and 440 mg/L NO3−, respectively), reported similar survival rates. Furthermore, Pedersen et al. [55] found no differences in survival, growth, and feed conversion at NO3-N levels of 50–200 mg/L. Other studies have also reported equivalent growth rates of rainbow trout at various nitrate levels [14,53,54]. A temperature of 21 °C constitutes a hindering factor for rainbow trout feed utilization and growth, while growth is not altered by nitrate levels of up to 110 mg/L. The condition was worse due to nitrate exposure and due to high temperature, but factor interactions did not yield even lower conditions for warm-reared fishes. Treatment 21H displayed results similar to the 17H and 21L conditions as well as zero mortality, indicating that juvenile rainbow trout can tolerate nitrate levels of 110 mg/L at 21 °C; however, their growth rate is reduced.
Citrate synthase (CS) is a metabolic enzyme involved in the first step of the citric acid (Krebs) cycle. This enzyme’s activity is related to the utilization of the citric acid cycle for energy production and to the aerobic capacity of the cell [56] and, along with 3-hydroxyacyl-CoA dehydrogenase (HOAD), citrate synthase is a good indicator of the overall aerobic potential of organisms [57]. HOAD is another metabolic enzyme participating in the beta-oxidation of fatty acids within the mitochondria [58]. The activity of HOAD is indicative of the breakdown of fatty acids for energy as well as amino acid catabolism [59]. Lactate dehydrogenase (LDH) is an enzyme involved in anaerobic metabolism, and its activity is a measure of the anaerobic capacity of a cell [56] as LDH sustains the continued process of glycolysis under anaerobic conditions [60]. CS and LDH have been implemented as indicators of aerobic and anaerobic metabolic capacity, respectively [61]. Changes in the activities of the aforementioned enzymes can happen due to various physiological and environmental circumstances, helping an organism meet its energy demands efficiently. The differential activities of citrate synthase (CS), 3-hydroxyacyl CoA dehydrogenase (HOAD), and lactate dehydrogenase (LDH) can reveal shifts in the energy production process [62].
High nitrate concentrations combined with low temperatures (17H) led to similar or increased activities of CS and HOAD that were equivalent to the control activity of LDH. Citrate synthase’s gene expression was also found to be increased compared to the control throughout the experimental procedure, while glucokinase mRNA exhibited the lowest reduction among all treatments compared to the control. The observed increase in glycolytic potential in 17H is a common mechanism employed by organisms to promote their tolerance under harsh conditions [63], but it can be unsustainable for large periods. The exposure of Onchorhynchs mykiss to 21 °C at NO3− concentrations of 40 mg/L generated no significant alterations in L-LDH, HOAD and CS enzymatic activities compared to the control treatment, even after prolonged exposure. Subsequently, the anaerobic and aerobic components of metabolism and the utilization of lipid oxidation for ATP synthesis were possibly not stimulated. It is possible that the high acclimation temperature at low nitrate levels does not require the reorganization of the metabolic machinery. The LDH activity was also not increased in Psalidodon bifasciatus liver after 12 h of heat shock [64]. CS gene expression levels of 21L also had little difference relative to the control fish. On the contrary, warm acclimation led to elevated activities in CS and HOAD in the perch Perca fluviatilis [65] and also of HOAD and LDH in Sparus aurata larvae [66].
Fish reared simultaneously at both high temperature and high nitrate levels (21H) exhibited a generally decreased CS enzymatic activity, while the mRNA levels of glucokinase and citrate synthase genes were downregulated or were similar to the control after hour 5. Depressed metabolism often permits organisms to increase their endurance to stressful conditions [63]. Nevertheless, this strategy, which seemed to continue until day 15 (as indicated by the significantly decreased activity of CS), is accompanied by the interruption of other highly demanding physiological procedures and also limits aerobic scope and organism fitness [63]. However, long-term exposure at 21 °C and 110 mg/L NO3− sustained or increased the glycolitic pathways, as witnessed by L-LDH levels that were increased or similar to the control in most samplings, paralleling an increase in lipid oxidation pathways (increased HOAD). Therefore, both anaerobic glycolysis and β-oxidation probably contribute to energy turnover in the 21H treatment, reflecting an enhanced ATP synthesis to compensate for reduced energy production due to anaerobiosis, which is demonstrated by the reduced CS activity. Interestingly, 17H presented occasionally greater increases in β-oxidation compared to 21H, and thus exposure to high nitrates yields greater lipid oxidation rates, possibly to cover the energetic demands arising from decreased ATP synthesis from the aerobic glycolysis, although CS activity was not depressed in this treatment. Elevated LDH suggests that the anaerobic respiration pathways had to be activated both in the 17H and 21H treatments because the aerobic metabolism was not able to fully satisfy the energy demands, maybe due to reductions in aerobic oxidative capacity. High nitrate levels may reduce blood oxygen carrying capacity and subsequently lead to elevated energetic costs, as has been previously reported in blueclaw crayfish, Cherax destructor [67], and silver perch Bidyanus bidyanus [68].
The livers of rainbow trout are capable of fully regulating the utilization of glucose [69]. Between 24 h and 15 days, warm-subjected fish displayed a great reduction in glucokinase (GK) expression, which was even greater in the high nitrate treatment at 24 h and 15 days. Soengas et al. [70] recorded decreased GK gene expression in the livers of rainbow trout under food deprivation while after re-feeding, GK expression increased. Moreover, mRNA changes were found in accordance with enzymatic activity changes and tissue glycogen levels as well [70]. Other authors have also reported similar results for the GK of O. mykiss [71,72]. In Sparus aurata, decreased hepatic GK was also observed under starvation and energy restriction [73]. In accordance with our results, Jiang et al. [59], comparing 17 °C and 21 °C, found decreased intestinal digestive enzyme activities, serum glucose, and triglyceride contents, all indicating impaired digestion and growth of juvenile O. mykiss exposed to 21 °C.
Elevated temperatures are accompanied by increased metabolism and, thus, higher oxygen demand, which generates more reactive oxygen species (ROS). Oxygen free radicals can harm the cell membrane and lipoproteins through lipid peroxidation [74]. Antioxidant defense mechanisms can help fish cope with heat stress. High nitrate-reared fish at 21 °C may have increased methemoglobin concentrations compared to 17 °C, considering that they possibly had higher respiration rates to meet oxygen demands [34], which subsequently may result in greater nitrate absorbance. In our study, a relatively similar pattern of antioxidant gene expression at 17 °C and 21 °C was observed among rainbow trout exposed to 110 mg/L NO3−.
Increased temperature alone led to antioxidant gene expressions that were enhanced or similar to the control. Similar to these results, Jiang et al. [52] observed the increased antioxidant enzyme activities of O. mykiss at 21 °C compared to 17 °C in well-oxygenated water, while the fish failed to trigger the antioxidant response in poorly oxygenated water. Ekström et al. [75] reported that sufficient oxygen supply may relieve the thermal stress of European perch, and inadequate oxygen levels could sharpen heat stress via drastic changes in the antioxidant system. Considering the similarity in terms of antioxidant gene expression and LDH activity patterns in high nitrate-exposed fish at both temperatures, high temperature possibly did not yield significant alterations in oxygen supply under high nitrate concentrations. Gomez Isaza et al. [76] observed that warm-acclimated silver perch were protected from nitrate toxicity despite their poor aerobic performance. Protection arose from the remodeling of the cardiorespiratory system in response to high temperatures. The cardiorespiratory system of rainbow trout [77] and Atlantic salmon [78] has also demonstrated plasticity in terms of response to elevated temperatures, indicating that such modifications may help different fish endure elevated temperatures and, possibly, nitrate toxicity.
The antioxidant system can regulate the inflammatory response by scavenging ROS, thereby reducing the activation of pro-inflammatory pathways. Increased ROS activate several transcription factors implicated in the expression of pro-inflammatory genes, such as tnf-a [79]. Interestingly, on day 7, both antioxidant genes displayed a generally reduced expression in all treatments, which was accompanied by the highest detected levels of tnf-a mRNA throughout the trial. In this study, 21L was the only treatment that kept the Cu/Zn sod levels similar to the control, and this treatment displayed the lowest increase in tnf-a. The decreased expression of antioxidant genes might have emerged from the reduced oxygen supply mainly due to high NO3−, since both high nitrate treatments displayed decreased sod mRNA, which led to the highest levels of tnf-a mRNA. However, on day 15, the catalase levels were similar among all treatments and high nitrate-exposed fish had increased sod mRNA at both temperatures. Thus tnf-a mRNA was reduced in all treatments, while 21H exhibited levels similar to those of the control.
The mRNA levels of hsp70 were constantly increased at 21 °C relative to 17 °C (except for day 4), regardless of the nitrate levels. At low temperatures, high nitrates did not alter hsp70 mRNA, while at high temperatures, the same pattern was observed with slight exceptions. Our results indicate protein damage mainly owing to high temperatures. In line with our results, Yu et al. [80] recorded non-statistically significant hsp70 mRNA levels in Scophthalmus maximus exposed to much higher nitrates (50, 200, and 400 mg/L NO3-N) after 60 days of exposure. The significantly elevated expression of tnf-α revealed an inflammatory response among all treatments relative to the control. The 17H treatment showed constant overexpression of tnf-a compared to the control, revealing a strong inflammatory response against high nitrates at 17 °C. Yu et al. [80] also observed increased inflammatory response in turbot’s (Scophthalmus maximus) intestine due to high nitrate exposure but at much higher nitrates. Concerning the warm-exposed fish, high nitrate did not generally result in enhanced tnf-a expression. Instead, 21H fish always exhibited similar or decreased expressions compared to 17H. Thus, high nitrate exposure resulted in a milder inflammatory response at 21 °C. Moreover, high temperature and high nitrate exposure led to comparable inflammation relative to warm-subjected fish at low nitrate levels.
Interestingly, studies on silver perch Bidyanus bidyanus [68] and European grayling Thymallus thymallus [36] have reported a synergistic tolerance in fish when reared simultaneously in terms of nitrate and elevated temperature. An explanation for this phenomenon may be that the physiological trade-offs taking place in order to increase oxygen transportation in response to high temperatures may yield mutual protection for fish facing nitrate-induced anemia [77]. Similarly, rainbow trout might have undergone modifications in terms of their cardiorespiratory system in an effort to increase blood oxygen carrying capacity when exposed to both high nitrates and a temperature of 21 °C. Similar patterns of 17H and 21H in antioxidant gene expression, as well as in the activity of LDH, support this assumption. In European carp, Cyprinus carpio, elevated temperature increased the aerobic scope, which was even greater at higher nitrate concentrations [37]. Rodgers et al. [30] found increased susceptibility to hypoxia in nitrate-exposed Thymallus thymallus both at 18 °C and at 22 °C subjected fish, while at 22 °C, nitrate exposure expanded heat tolerance by 1 °C.

5. Conclusions

Exposure to 110 mg/L NO3− at low temperatures increased glycolytic potential and upregulated citrate synthase gene expression. In 17H, increased β-oxidation indicates a greater reliance on lipid oxidation, possibly compensating for reduced ATP synthesis from aerobic glycolysis. The liver’s regulation of glucose utilization was affected, with reduced glucokinase expression in warm-subjected trout. Prolonged exposure to 21 °C under 110 mg/L NO3− appears to enhance glycolytic and lipid oxidation pathways in Onchorhynchus mykiss. High temperatures, combined with high nitrates, led to metabolic and possibly cardiorespiratory system readjustments to sufficiently cover the increased energetic and oxygen supply demands of the trout. The aforementioned modifications did not lead to worse growth or fitness compared to 21L. Interestingly, exposure at 21 °C at low nitrate levels shows no significant metabolic alterations, suggesting that high temperatures in low nitrate conditions may not necessitate metabolic reorganization. Elevated temperature induced antioxidant defense mechanisms, and similar patterns were observed under high nitrate levels at both 17 °C and 21 °C. Furthermore, warm-subjected fish at high nitrate levels (21H) displayed a comparable inflammatory response with 17H and 21L fish: 100 % survival and slight differences in heat shock response from 21L. These observations provide evidence of a tolerance to the tested factors and their synergies in rainbow trout, although feed utilization and growth were depressed at 21 °C. We should point out that although our work is based on a three-week trial, the results clearly suggest that temperatures of 21 °C, when partially present in a RAS system containing nitrate of up to 110 mg/L, will not threaten the survival of fingerling rainbow trout but can yield to remarkably lower biomass. Recent studies on Oncorhynchus mykiss juveniles have shown that temperature acclimation of fish can increase survival under heat stress [81] and increase the upper limit of heat tolerance [82]. Therefore, a more gradual temperature increase rate could have led to better growth and/or health responses of fish exposed to 21 °C.

Author Contributions

Conceptualization, D.K.P. and I.A.G.; methodology, D.K.P.; software, D.K.P.; validation, A.T., I.C. and G.K.N.; formal analysis, A.L.; investigation, D.K.P.; resources, G.K.N.; data curation, I.C. and A.L.; writing—original draft preparation, D.K.P.; writing—review and editing, I.A.G.; visualization, A.L.; supervision, I.A.G. and G.K.N.; project administration, G.K.N.; funding acquisition, G.K.N. All authors have read and agreed to the published version of the manuscript.

Funding

This research was co-financed by the European Regional Development Fund of the European Union and Greek national funds through the Operational Program Competitiveness, Entrepreneurship and Innovation, under the call RESEARCH-CREATE-INNOVATE (project code: T1EDK-00756).

Institutional Review Board Statement

All animal handling were carried out in accordance with the EU Directive on the protection of the use of animals for scientific purposes (2010/63/EU), minimizing the stress induced to the experimental fish. Ethics approval for the experimental use of study animal (Oncorhynchus mykiss) was granted by the University of Western Macedonia local ethics committee given the protocol code 101, whereas fish receipt was confirmed by the Department of Aquaculture Development, Greek Ministry of Rural Development and Food, Decision number 167/41275/02-06-2022.

Data Availability Statement

All data generated or analyzed during this study are included within this article.

Acknowledgments

Authors would like to thank company D. Doumas Sons (official representative of Skretting fish feed for Greece) for kindly providing fish feed and valuable advice during the planning and organization of the nutritional protocols.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Willer, D.F.; Aldridge, D.C. Microencapsulated diets to improve bivalve shellfish aquaculture for global food security. Glob. Food Secur. 2019, 23, 64–73. [Google Scholar] [CrossRef]
  2. Lennard, W.; Goddek, S. Aquaponics: The basics. In Aquaponics Food Production Systems, 1st ed.; Goddek, S., Joyce, A., Kotzen, B., Burnell, G.M., Eds.; Springer International Publishing: Cham, Switzerland, 2019; pp. 113–143. [Google Scholar] [CrossRef]
  3. Palm, H.W.; Knaus, U.; Appelbaum, S.; Goddek, S.; Strauch, S.M.; Vermeulen, T.; HaїssamJijakli, M.; Kotzen, B. Towards commercial aquaponics: A review of systems, designs, scales and nomenclature. Aquac. Int. 2018, 26, 813–842. [Google Scholar] [CrossRef]
  4. Goddek, S.; Delaide, B.; Mankasingh, U.; Ragnarsdottir, K.V.; Jijakli, H.; Thorarinsdottir, R. Challenges of sustainable and commercial aquaponics. Sustainability 2015, 7, 4199–4224. [Google Scholar] [CrossRef]
  5. Vasdravanidis, C.; Alvanou, M.V.; Lattos, A.; Papadopoulos, D.K.; Chatzigeorgiou, I.; Ravani, M.; Ntinas, G.K.; Giantsis, I.A. Aquaponics as a promising strategy to mitigate impacts of climate change on rainbow trout culture. Animals 2022, 12, 2523. [Google Scholar] [CrossRef] [PubMed]
  6. Van Woensel, L.; Archer, G.; Panades-Estruch, L.; Vrscaj, D. Ten Technologies Which Could Change Our Lives: Potential Impacts and Policy Implications. European Parliamentary Research Service Scientific Foresight Unit. 2019. Available online: http://www.europarl.europa.eu/EPRS/EPRS_IDAN_527417_ten_trends_to_change_your_life.pdf (accessed on 21 July 2022).
  7. Love, D.C.; Fry, J.P.; Li, X.; Hill, E.S.; Genello, L.; Semmens, K.; Thompson, R.E. Commercial aquaponics production and profitability: Findings from an international survey. Aquaculture 2015, 435, 67–74. [Google Scholar] [CrossRef]
  8. FAO. The State of World Fisheries and Aquaculture 2022; Towards Blue Transformation; FAO: Rome, Italy, 2022. [Google Scholar] [CrossRef]
  9. Pulkkinen, J.T.; Kiuru, T.; Aalto, S.L.; Koskela, J.; Vielma, J. Startup and effects of relative water renewal rate on water quality and growth of rainbow trout (Oncorhynchus mykiss) in a unique RAS research platform. Aquac. Eng. 2018, 82, 38–45. [Google Scholar] [CrossRef]
  10. Samuel-Fitwi, B.; Nagel, F.; Meyer, S.; Schroeder, J.P.; Schulz, C. Comparative life cycle assessment (LCA) of raising rainbow trout (Oncorhynchus mykiss) in different production systems. Aquac. Eng. 2013, 54, 85–92. [Google Scholar] [CrossRef]
  11. Somerville, C.; Cohen, M.; Pantanella, E.; Stankus, A.; Lovatelli, A. Small-Scale Aquaponic Food Production: Integrated Fish and Plant Farming; Food and Agriculture Organization of the United Nations: Rome, Italy, 2014; Available online: https://www.fao.org/3/i4021e/i4021e.pdf (accessed on 21 July 2022).
  12. Birolo, M.; Bordignon, F.; Trocino, A.; Fasolato, L.; Pascual, A.; Godoy, S.; Nicoletto, C.; Maucieri, C.; Xiccato, G. Effects of stocking density on the growth and flesh quality of rainbow trout (Oncorhynchus mykiss) reared in a low-tech aquaponic system. Aquaculture 2020, 529, 735653. [Google Scholar] [CrossRef]
  13. Deviller, G.; Palluel, O.; Aliaume, C.; Asanthi, H.; Sanchez, W.; Franco Nava, M.A.; Blancheton, J.P.; Casellas, C. Impact assessment of various rearing systems on fish health using multibiomarker response and metal accumulation. Ecotoxicol. Environ. Saf. 2015, 61, 89–97. [Google Scholar] [CrossRef]
  14. Davidson, J.; Good, C.; Welsh, C.; Summerfelt, S.T. Comparing the effects of high vs. low nitrate on the health, performance, and welfare of juvenile rainbow trout Oncorhynchus mykiss within water recirculating aquaculture systems. Aquac. Eng. 2014, 59, 30–40. [Google Scholar] [CrossRef]
  15. Monsees, H.; Kloas, W.; Wuertz, S. Decoupled systems on trial: Eliminating bottlenecks to improve aquaponic processes. PLoS ONE 2017, 12, e0183056. [Google Scholar] [CrossRef] [PubMed]
  16. Camargo, J.A.; Alonso, Á. Ecological and toxicological effects of inorganic nitrogen pollution in aquatic ecosystems: A global assessment. Environ. Int. 2006, 32, 831–849. [Google Scholar] [CrossRef] [PubMed]
  17. Cheng, S.Y.; Tsai, S.J.; Chen, J.C. Accumulation of nitrate in the tissues of Penaeus monodon following elevated ambient nitrate exposure after different time periods. Aquat. Toxicol. 2002, 56, 133–146. [Google Scholar] [CrossRef] [PubMed]
  18. Gomez Isaza, D.F.; Cramp, R.L.; Franklin, C.E. Simultaneous exposure to nitrate and low pH reduces the blood oxygen-carrying capacity and functional performance of a freshwater fish. Conserv. Physiol. 2020, 8, coz092. [Google Scholar] [CrossRef]
  19. Schram, E.; Roques, J.A.; van Kuijk, T.; Abbink, W.; van de Heul, J.; van de Vries, P.; Bierman, S.; van de Vis, H.; Flik, G. The impact of elevated water ammonia and nitrate concentrations on physiology, growth and feed intake of pikeperch (Sander lucioperca). Aquaculture 2014, 420, 95–104. [Google Scholar] [CrossRef]
  20. van Bussel, C.G.; Schroeder, J.P.; Wuertz, S.; Schulz, C. The chronic effect of nitrate on production performance and health status of juvenile turbot (Psetta maxima). Aquaculture 2012, 326, 163–167. [Google Scholar] [CrossRef]
  21. Luo, S.; Wu, B.; Xiong, X.; Wang, J. Short-term toxicity of ammonia, nitrite, and nitrate to early life stages of the rare minnow (Gobiocyprisrarus). Environ. Toxicol. Chem. 2016, 35, 1422–1427. [Google Scholar] [CrossRef]
  22. Timmons, M.B.; Ebeling, J.M. Recirculating Aquaculture, 3rd ed.; Ithaca Publishing Company LLC: New York, NY, USA, 2013. [Google Scholar]
  23. Jobling, M. Bioenergetics: Feed Intake and Energy Partitioning, in Fish Ecophysiology; Rankin, J.C., Jense, F.B., Eds.; Chapman & Hall: London, UK, 1993. [Google Scholar] [CrossRef]
  24. Jiang, X.; Dong, S.; Liu, C.; Zhou, Y. Temperature tolerance of juvenile rainbow trout and steelhead trout (Oncorhynchus mykiss). J. Ocean. Univ. China 2019, 49, 57–62. [Google Scholar] [CrossRef]
  25. Akhtar, M.S.; Pal, A.K.; Sahu, N.P.; Ciji, A.; Mahanta, P.C. Thermal tolerance, oxygen consumption and haemato-biochemical variables of Tor putitora juveniles acclimated to five temperatures. Fish Physiol. Biochem. 2013, 39, 1387–1398. [Google Scholar] [CrossRef]
  26. Kaufman, R.C.; Coalter, R.; Nordman, N.L.; Cocherell, D.; Cech, J.J.; Thompson, L.C.; Fangue, N.A. Effects of temperature on hardhead minnow (Mylopharodonconocephalus) blood-oxygen equilibria. Environ. Biol. Fishes 2013, 96, 1389–1397. [Google Scholar] [CrossRef]
  27. Pörtner, H.O.; Bock, C.; Mark, F.C. Oxygen-and capacity-limited thermal tolerance: Bridging ecology and physiology. J. Exp. Biol. 2017, 220, 2685–2696. [Google Scholar] [CrossRef]
  28. Wang, T.; Lefevre, S.; Iversen, N.K.; Findorf, I.; Buchanan, R.; McKenzie, D.J. Anaemia only causes a small reduction in the upper critical temperature of sea bass: Is oxygen delivery the limiting factor for tolerance of acute warming in fishes? J. Exp. Biol. 2014, 217, 4275–4278. [Google Scholar] [CrossRef]
  29. Muñoz, N.J.; Farrell, A.P.; Heath, J.W.; Neff, B.D. Hematocrit is associated with thermal tolerance and modulated by developmental temperature in juvenile Chinook salmon. Physiol. Biochem. Zool. 2018, 91, 757–762. [Google Scholar] [CrossRef]
  30. Rodgers, E.M.; Opinion, A.G.R.; Gomez Isaza, D.F.; Rašković, B.; Poleksić, V.; De Boeck, G. Double whammy: Nitrate pollution heightens susceptibility to both hypoxia and heat in a freshwater salmonid. Sci. Total Environ. 2021, 765, 142777. [Google Scholar] [CrossRef]
  31. Ficke, A.D.; Myrick, C.A.; Hansen, L.J. Potential impacts of global climate change on freshwater fisheries. Rev. Fish Biol. Fish. 2007, 17, 581–613. [Google Scholar] [CrossRef]
  32. Little, A.G.; Seebacher, F. Temperature determines toxicity: Bisphenol A reduces thermal tolerance in fish. Environ. Pollut. 2015, 197, 84–89. [Google Scholar] [CrossRef] [PubMed]
  33. Patra, R.W.; Chapman, J.C.; Lim, R.P.; Gehrke, P.C.; Sunderam, R.M. Interactions between water temperature and contaminant toxicity to freshwater fish. Environ. Toxicol. Chem. 2015, 34, 1809–1817. [Google Scholar] [CrossRef] [PubMed]
  34. Noyes, P.D.; McElwee, M.K.; Miller, H.D.; Clark, B.W.; Van Tiem, L.A.; Walcott, K.C.; Erwin, K.N.; Levin, E.D. The toxicology of climate change: Environmental contaminants in a warming world. Environ. Int. 2009, 35, 971–986. [Google Scholar] [CrossRef] [PubMed]
  35. Egea-Serrano, A.; Van Buskirk, J. Responses to nitrate pollution, warming and density in common frog tadpoles (Rana temporaria). Amphib. Reptil. 2016, 37, 45–54. [Google Scholar] [CrossRef]
  36. Opinion, A.G.R.; De Boeck, G.; Rodgers, E.M. Synergism between elevated temperature and nitrate: Impact on aerobic capacity of European grayling, Thymallusthymallus in warm, eutrophic waters. Aquat. Toxicol. 2020, 226, 105563. [Google Scholar] [CrossRef] [PubMed]
  37. Opinion, A.G.R.; Çakir, R.; De Boeck, G. Better together: Cross-tolerance induced by warm acclimation and nitrate exposure improved the aerobic capacity and stress tolerance of common carp Cyprinus carpio. Ecotoxicol. Environ. Saf. 2021, 225, 112777. [Google Scholar] [CrossRef]
  38. Endut, A.; Jusoh, A.; Ali, N.; Wan Nik, W.B. Nutrient removal from aquaculture wastewater by vegetable production in aquaponics recirculation system. Desalination Water Treat. 2011, 32, 422–430. [Google Scholar] [CrossRef]
  39. Zou, Y.; Hu, Z.; Zhang, J.; Xie, H.; Guimbaud, C.; Fang, Y. Effects of pH on nitrogen transformations in media-based aquaponics. Bioresour. Technol. 2016, 210, 81–87. [Google Scholar] [CrossRef]
  40. Westin, D.T. Nitrate and nitrite toxicity to salmonoid fishes. Progress. Fish Cult. 1974, 36, 86–89. [Google Scholar] [CrossRef]
  41. McGurk, M.D.; Landry, F.; Tang, A.; Hanks, C.C. Acute and chronic toxicity of nitrate to early life stages of lake trout (Salvelinus namaycush) and lake whitefish (Coregonus clupeaformis). Environ. Toxicol. Chem. 2006, 25, 2187–2196. [Google Scholar] [CrossRef] [PubMed]
  42. Colt, J.; Tchobanoglous, G. Chronic exposure of channel catfish, Ictalurus punctatus, to ammonia: Effects on growth and survival. Aquaculture 1978, 15, 353–372. [Google Scholar] [CrossRef]
  43. Bolger, T.; Connolly, P.L. The selection of suitable indices for the measurement and analysis of fish condition. J. Fish Biol. 1989, 34, 171–182. [Google Scholar] [CrossRef]
  44. Horiba Scientific. Laqua. Waterproof Pocket Water Quality Meters; Brochure PBT-02-2017A. 2017. Available online: https://static.horiba.com/fileadmin/Horiba/Water_Quality/04_Support/Brochures/Pocket_Meters/Brochure_-_PBT-02-2017A_LAQUAtwin_Pocket_Water_Quality_Meter_-_LOWRES.pdf (accessed on 25 October 2022).
  45. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  46. Teimouri, M.; Yeganeh, S.; Mianji, G.R.; Najafi, M.; Mahjoub, S. The effect of Spirulina platensis meal on antioxidant gene expression, total antioxidant capacity, and lipid peroxidation of rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 2019, 45, 977–986. [Google Scholar] [CrossRef]
  47. Blair, S.D.; Glover, C.N. Acute exposure of larval rainbow trout (Oncorhynchus mykiss) to elevated temperature limits hsp70b expression and influences future thermotolerance. Hydrobiologia 2019, 836, 155–167. [Google Scholar] [CrossRef]
  48. Moltesen, M.; Laursen, D.C.; Thörnqvist, P.O.; Andersson, M.Å.; Winberg, S.; Höglund, E. Effects of acute and chronic stress on telencephalic neurochemistry and gene expression in rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 2016, 219, 3907–3914. [Google Scholar] [CrossRef] [PubMed]
  49. Thibault, M.; Blier, P.U.; Guderley, H. Seasonal variation of muscle metabolic organization in rainbow trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 1997, 16, 139–155. [Google Scholar] [CrossRef]
  50. Sun, J.L.; Zhao, L.L.; Liao, L.; Tang, X.H.; Cui, C.; Liu, Q.; He, K.; Ma, J.-D.; Jin, L.; Yan, T.; et al. Interactive effect of thermal and hypoxia on largemouth bass (Micropterus salmoides) gill and liver: Aggravation of oxidative stress, inhibition of immunity and promotion of cell apoptosis. Fish Shellfish. Immunol. 2020, 98, 923–936. [Google Scholar] [CrossRef] [PubMed]
  51. Ineno, T.; Tamaki, K.; Yamada, K.; Kodama, R.; Tan, E.; Kinoshita, S.; Muto, K.; Yada, T.; Kitamura, S.; Asakawa, S.; et al. Evaluation of the thermal tolerances of different strains of rainbow trout Oncorhynchus mykiss by measuring the effective time required for loss of equilibrium at an approximate upper lethal temperature. Fish. Sci. 2019, 85, 839–845. [Google Scholar] [CrossRef]
  52. Jiang, X.; Dong, S.; Liu, R.; Huang, M.; Dong, K.; Ge, J.; Gao, Q.; Zhou, Y. Effects of temperature, dissolved oxygen, and their interaction on the growth performance and condition of rainbow trout (Oncorhynchus mykiss). J. Therm. Biol. 2021, 98, 102928. [Google Scholar] [CrossRef] [PubMed]
  53. Davidson, J.; Good, C.; Welsh, C.; Summerfelt, S.T. The effects of ozone and water exchange rates on water quality and rainbow trout Oncorhynchus mykiss performance in replicated water recirculating systems. Aquac. Eng. 2011, 44, 80–96. [Google Scholar] [CrossRef]
  54. Davidson, J.; Good, C.; Welsh, C.; Summerfelt, S.T. Abnormal swimming behavior and increased deformities in rainbow trout Oncorhynchus mykiss cultured in low exchange water recirculating aquaculture systems. Aquac. Eng. 2011, 45, 109–117. [Google Scholar] [CrossRef]
  55. Pedersen, L.F.; Suhr, K.I.; Dalsgaard, J.; Pedersen, P.B.; Arvin, E. Effects of feed loading on nitrogen balances and fish performance in replicated recirculating aquaculture systems. Aquaculture 2012, 338, 237–245. [Google Scholar] [CrossRef]
  56. Gagnon, M.M.; Holdway, D.A. Metabolic enzyme activities in fish gills as biomarkers of exposure to petroleum hydrocarbons. Ecotoxicol. Environ. Saf. 1999, 44, 92–99. [Google Scholar] [CrossRef]
  57. Somero, G.N.; Childress, J.J. A violation of the metabolism-size scaling paradigm: Activities of glycolytic enzymes in muscle increase in larger-size fish. Physiol. Zool. 1980, 53, 322–337. [Google Scholar] [CrossRef]
  58. Guerreiro, I.; Magalhães, R.; Coutinho, F.; Couto, A.; Sousa, S.; Delerue-Matos, C.; Domingues, V.F.; Oliva-Teles, A.; Peres, H. Evaluation of the seaweeds Chondrus crispus and Ulva lactuca as functional ingredients in gilthead seabream (Sparus aurata). J. Appl. Phycol. 2019, 31, 2115–2124. [Google Scholar] [CrossRef]
  59. Hochachka, P.W.; Stanley, C.; Merkt, J.; Sumar-Kalinowski, J. Metabolic meaning of elevated levels of oxidative enzymes in high altitude adapted animals: An interpretive hypothesis. Respir. Physiol. 1983, 52, 303–313. [Google Scholar] [CrossRef]
  60. Dewes, L.J.; Sandrini, J.Z.; Monserrat, J.M.; Yunes, J.S. Biochemical and physiological responses after exposure to microcystins in the crab Chasmagnathusgranulatus (Decapoda, Brachyura). Ecotoxicol. Environ. Saf. 2006, 65, 201–208. [Google Scholar] [CrossRef]
  61. Brijs, J.; Sandblom, E.; Sundh, H.; Gräns, A.; Hinchcliffe, J.; Ekström, A.; Sundell, K.; Olsson, C.; Axelsson, M.; Pichaud, N. Increased mitochondrial coupling and anaerobic capacity minimizes aerobic costs of trout in the sea. Sci. Rep. 2017, 7, 45778. [Google Scholar] [CrossRef]
  62. McClelland, G.B.; Craig, P.M.; Dhekney, K.; Dipardo, S. Temperature-and exercise-induced gene expression and metabolic enzyme changes in skeletal muscle of adult zebrafish (Danio rerio). J. Physiol. 2006, 577, 739–751. [Google Scholar] [CrossRef] [PubMed]
  63. Hochachka, P.W.; Somero, G.N. Biochemical Adaptation: Mechanism and Process in Physiological Evolution; Oxford University Press: Oxford, UK, 2002. [Google Scholar]
  64. Resende, A.C.; Pereira, D.M.C.; Schleger, I.C.; de Souza, M.R.D.P.; Neundorf, A.K.A.; Romão, S.; Herrerias, T.; Donatti, L. Effects of heat shock on energy metabolism and antioxidant defence in a tropical fish species Psalidodon bifasciatus. J. Fish Biol. 2002, 100, 1245–1263. [Google Scholar] [CrossRef] [PubMed]
  65. Pichaud, N.; Ekström, A.; Breton, S.; Sundström, F.; Rowinski, P.; Blier, P.U.; Sandblom, E. Cardiac mitochondrial plasticity and thermal sensitivity in a fish inhabiting an artificially heated ecosystem. Sci. Rep. 2019, 9, 17832. [Google Scholar] [CrossRef]
  66. Pimentel, M.S.; Faleiro, F.; Machado, J.; Pousão-Ferreira, P.; Rosa, R. Seabream larval physiology under ocean warming and acidification. Fishes 2019, 5, 1. [Google Scholar] [CrossRef]
  67. Gomez Isaza, D.F.; Cramp, R.L.; Franklin, C.E. Negative impacts of elevated nitrate on physiological performance are not exacerbated by low pH. Aquat. Toxicol. 2018, 200, 217–225. [Google Scholar] [CrossRef]
  68. Gomez Isaza, D.F.; Cramp, R.L.; Franklin, C.E. Thermal acclimation offsets the negative effects of nitrate on aerobic scope and performance. J. Exp. Biol. 2020, 223, jeb224444. [Google Scholar] [CrossRef]
  69. Panserat, S.; Plagnes-Juan, E.; Kaushik, S. Nutritional regulation and tissue specificity of gene expression for proteins involved in hepatic glucose metabolism in rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 2001, 204, 2351–2360. [Google Scholar] [CrossRef]
  70. Soengas, J.L.; Polakof, S.; Chen, X.; Sangiao-Alvarellos, S.; Moon, T.W. Glucokinase and hexokinase expression and activities in rainbow trout tissues: Changes with food deprivation and refeeding. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2006, 291, R810–R821. [Google Scholar] [CrossRef] [PubMed]
  71. Panserat, S.; Capilla, E.; Gutierrez, J.; Frappart, P.O.; Vachot, C.; Plagnes-Juan, E.; Aguirre, P.; Brèque, J.; Kaushik, S. Glucokinase is highly induced and glucose-6-phosphatase poorly repressed in liver of rainbow trout (Oncorhynchus mykiss) by a single meal with glucose. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2001, 128, 275–283. [Google Scholar] [CrossRef] [PubMed]
  72. Plagnes-Juan, E.; Lansard, M.; Seiliez, I.; Médale, F.; Corraze, G.; Kaushik, S.; Panserat, S.; Skiba-Cassy, S. Insulin regulates the expression of several metabolism-related genes in the liver and primary hepatocytes of rainbow trout (Oncorhynchus mykiss). J. Exp. Biol. 2008, 211, 2510–2518. [Google Scholar] [CrossRef]
  73. Caseras, A.; Metón, I.; Fernández, F.; Baanante, I.V. Glucokinase gene expression is nutritionally regulated in liver of gilthead sea bream (Sparus aurata). Biochim. Biophys. Acta 2000, 1493, 135–141. [Google Scholar] [CrossRef]
  74. Martinez-Cayuela, M. Oxygen free radicals and human disease. Biochimie 1995, 77, 147–161. [Google Scholar] [CrossRef]
  75. Ekström, A.; Brijs, J.; Clark, T.D.; Gräns, A.; Jutfelt, F.; Sandblom, E. Cardiac oxygen limitation during an acute thermal challenge in the European perch: Effects of chronic environmental warming and experimental hyperoxia. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2016, 311, R440–R449. [Google Scholar] [CrossRef]
  76. Gomez Isaza, D.F.; Cramp, R.L.; Franklin, C.E. Thermal plasticity of the cardiorespiratory system provides cross-tolerance protection to fish exposed to elevated nitrate. Comp. Biochem. Physiol. Part C Toxicol. Pharmacol. 2021, 240, 108920. [Google Scholar] [CrossRef]
  77. Klaiman, J.M.; Fenna, A.J.; Shiels, H.A.; Macri, J.; Gillis, T.E. Cardiac remodeling in fish: Strategies to maintain heart function during temperature change. PLoS ONE 2011, 6, e24464. [Google Scholar] [CrossRef] [PubMed]
  78. Anttila, K.; Dhillon, R.S.; Boulding, E.G.; Farrell, A.P.; Glebe, B.D.; Elliott, J.A.K.; Wolters, W.R.; Schulte, P.M. Variation in temperature tolerance among families of Atlantic salmon (Salmo salar) is associated with hypoxia tolerance, ventricle size and myoglobin level. J. Exp. Biol. 2013, 216, 1183–1190. [Google Scholar] [CrossRef] [PubMed]
  79. Hussain, T.; Tan, B.; Yin, Y.; Blachier, F.; Tossou, M.C.; Rahu, N. Oxidative stress and inflammation: What polyphenols can do for us? Oxidative Med. Cell. Longev. 2016, 2016, 7432797. [Google Scholar] [CrossRef] [PubMed]
  80. Yu, J.; Wang, Y.; Xiao, Y.; Li, X.; Xu, X.; Zhao, H.; Wu, L.; Li, J. Effects of chronic nitrate exposure on the intestinal morphology, immune status, barrier function, and microbiota of juvenile turbot (Scophthalmus maximus). Ecotoxicol. Environ. Saf. 2021, 207, 111287. [Google Scholar] [CrossRef]
  81. Adams, O.A.; Zhang, Y.; Gilbert, M.H.; Lawrence, C.S.; Snow, M.; Farrell, A.P. An unusually high upper thermal acclimation potential for rainbow trout. Conserv. Physiol. 2022, 10, coab101. [Google Scholar] [CrossRef] [PubMed]
  82. Li, H.; Yu, H.; Zhang, X.; Huang, W.; Zhang, C.; Wang, C.; Gao, Q.; Dong, S. Temperature acclimation improves high temperature tolerance of rainbow trout (Oncorhynchus mykiss) by improving mitochondrial quality and inhibiting apoptosis in liver. Sci. Total Environ. 2023, 912, 169452. [Google Scholar] [CrossRef] [PubMed]
Fishes 09 00074 g001
Figure 1. The aquaria and the supplementary aquaponic system’s tanks utilized in the experimental system.
Figure 1. The aquaria and the supplementary aquaponic system’s tanks utilized in the experimental system.
Fishes 09 00074 g001
Fishes 09 00074 g002
Figure 2. Relative mRNA levels of Citrate synthase (A) and glucokinase (B) in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated compared to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Figure 2. Relative mRNA levels of Citrate synthase (A) and glucokinase (B) in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated compared to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Fishes 09 00074 g002
Fishes 09 00074 g003
Figure 3. Relative mRNA levels of hsp70 in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated comparing to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Figure 3. Relative mRNA levels of hsp70 in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated comparing to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Fishes 09 00074 g003
Fishes 09 00074 g004
Figure 4. Relative mRNA levels of catalase (A) and Cu/Zn superoxide dismutase (B) in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated compared to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Figure 4. Relative mRNA levels of catalase (A) and Cu/Zn superoxide dismutase (B) in the livers of rainbow trout in the different groups during the trial. Relative expression was calculated compared to controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Fishes 09 00074 g004
Fishes 09 00074 g005
Figure 5. Relative mRNA levels of tumor necrosis factor-alpha in the livers of rainbow trout in the different groups during the trial. The relative expression was calculated compared to the controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Figure 5. Relative mRNA levels of tumor necrosis factor-alpha in the livers of rainbow trout in the different groups during the trial. The relative expression was calculated compared to the controls (17 °C, 40 mg/L NO3−) within each sampling time. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) between treatments.
Fishes 09 00074 g005
Fishes 09 00074 g006aFishes 09 00074 g006b
Figure 6. Activity of citrate synthase (A), 3 hydroxyacylCoA dehydrogenase (B) and lactate dehydrogenase (C) in the livers of rainbow trout. Dark blue indicates the control treatment. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) within each sampling time.
Figure 6. Activity of citrate synthase (A), 3 hydroxyacylCoA dehydrogenase (B) and lactate dehydrogenase (C) in the livers of rainbow trout. Dark blue indicates the control treatment. Values are means ± SD, n = 4 replications from different animals. Lowercase letters indicate statistically significant differences (p < 0.05) within each sampling time.
Fishes 09 00074 g006aFishes 09 00074 g006b
Table 1. Gene-specific primers, amplicon size, efficiency, and Genbank accession number of target genes.
Table 1. Gene-specific primers, amplicon size, efficiency, and Genbank accession number of target genes.
Target GeneForward Primer (5′–3′)
Reverse Primer (5′–3′)		Amplicon (bp)Primer EfficiencyGenBank Accession
No.		Reference
catalaseGAGGGCAACTGGGACCTTACT
GGACGAAGGACGGGAACAG		791.95BE669040.1[46]
Cu/Zn sodAGGACCCACTGATGCTGTT
GTTGCCTCCTTTTCCCAGA		1781.94AF469663.1This study
hsp70AGGACATCAGCCAGAACAAG
TGGTGATGGAGGTGTAGAAG		1441.95AB062281.1This study
glucokinaseCTACTGAACTGGACCAAAGG
CCATGTAGCAAGCGTTACAC		2171.98AF053331.2This study
citrate synthaseGATAACTTCCCTACCAACCT
CGGTAGATCTTAGCAGCAAC		1881.92XM_021616545.2This study
tnf-aCTACAAGGGAACCAAATCCT
GCCAAATAACGTGACTCAGA		1241.94AJ401377.1This study
EF-1αCTGTTGCCTTTGTGCCCATC
CATCCCTTGAACCAGCCCAT		821.97AF498320.1[47]
b-actinAGAGCTACGAGCTGCCTGAC
GTGTTGGCGTACAGGTCCTT		1791.98NM_001124235.1[48]
Table 2. Growth and condition of rainbow trout in the different treatments after 20 days. Values are means ± SD.
Table 2. Growth and condition of rainbow trout in the different treatments after 20 days. Values are means ± SD.
TreatmentFinal Weight (g)Condition FactorSGRw (%)FCRSurvival (%)
17 °C and 40 mg/L (17L)14.37 ± 0.41 a1.28 ± 0.13 a1.91 ± 0.08 a0.87 ± 0.05 a100
17 °C and 110 mg/L (17H)14.23 ± 0.31 a1.17 ± 0.14 b1.89 ± 0.08 a0.88 ± 0.06 a100
21 °C and 40 mg/L (21L)12.84 ± 0.29 b1.11 ± 0.12 b1.36 ± 0.16 b1.25 ± 0.08 b100
21 °C and 110 mg/L (21H)12.89 ± 0.32 b1.13 ± 0.12 b1.38 ± 0.19 b1.25 ± 0.12 b100
a, b Within a column, means with different superscripts differ in terms of ANOVA (p < 0.05).
Table 3. p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on growth and condition of rainbow trout from measurements on day 20.
Table 3. p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on growth and condition of rainbow trout from measurements on day 20.
Condition FactorFCRSGRw
temperature 0.00002 0.000010.00003
NO3−0.0190.94020.9612
temperature × NO3−0.00080.83330.577
Table 4. FDR-adjusted p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on gene transcription levels.
Table 4. FDR-adjusted p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on gene transcription levels.
citrate synthase
1 h5 h24 h4 d7 d15 d
Temperature0.00020.00180.00020.00020.00020.0016
NO3−0.00130.00210.00190.41340.00790.003
temperature × NO3−0.00030.00540.00030.00010.01960.0092
glucokinase
1 h5 h24 h4 d7 d15 d
Temperature0.41820.000060.000050.000080.000050.00007
NO3−0.40880.00250.00010.000050.48140.00007
temperature × NO3−0.42210.72160.00240.000050.01310.00002
hsp70
1 h5 h24 h4 d7 d15 d
Temperature0.000050.000050.000050.41980.000040.00004
NO3−0.2020.02070.000040.000050.000060.0797
temperature × NO3−0.12470.59850.000050.000070.000040.5677
catalase
1 h5 h24 h4 d7 d15 d
Temperature0.00010.42110.00020.2060.00020.8399
NO3−0.00220.00020.00050.00030.02880.8350
temperature × NO3−0.00060.35210.00030.00010.00040.2455
Cu/Zn sod
1 h5 h24 h4 d7 d15 d
Temperature0.000050.000040.000090.000040.24740.1383
NO3−0.00130.000030.000050.77940.000050.00006
temperature × NO3−0.000040.000030.000030.09920.01240.0191
tnf-a
1 h5 h24 h4 d7 d15 d
Temperature0.000050.01640.02020.06630.000050.00004
NO3−0.000050.000050.10130.000080.000050.00006
temperature × NO3−0.00020.000070.01990.00010.000030.00005
Table 5. FDR-adjusted p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on enzymatic activities.
Table 5. FDR-adjusted p-values of two-way ANOVA for the effects of temperature, NO3−, and their interaction on enzymatic activities.
Citrate synthase
1 h5 h24 h4 d7 d15 d
Temperature0.51760.00060.00010.00010.00150.0001
NO3−0.00140.00690.09580.00010.00090.0001
temperature × NO3−0.00010.5340.00010.00010.00420.0001
HOAD
1 h5 h24 h4 d7 d15 d
Temperature0.00050.00570.055010.04290.21040.0013
NO3−0.00020.00030.00030.00030.00040.0286
temperature × NO3−0.20920.00040.00020.00110.00030.0284
LDH
1 h5 h24 h4 d7 d15 d
Temperature0.3950.00040.00130.2030.00220.0415
NO3−0.34850.00030.00020.00030.00050.8459
temperature × NO3−0.37030.00010.07140.00340.00040.0712
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Papadopoulos, D.K.; Lattos, A.; Chatzigeorgiou, I.; Tsaballa, A.; Ntinas, G.K.; Giantsis, I.A. The Influence of Water Nitrate Concentration Combined with Elevated Temperature on Rainbow Trout Oncorhynchus mykiss in an Experimental Aquaponic Setup. Fishes 2024, 9, 74. https://doi.org/10.3390/fishes9020074

AMA Style

Papadopoulos DK, Lattos A, Chatzigeorgiou I, Tsaballa A, Ntinas GK, Giantsis IA. The Influence of Water Nitrate Concentration Combined with Elevated Temperature on Rainbow Trout Oncorhynchus mykiss in an Experimental Aquaponic Setup. Fishes. 2024; 9(2):74. https://doi.org/10.3390/fishes9020074

Chicago/Turabian Style

Papadopoulos, Dimitrios K., Athanasios Lattos, Ioanna Chatzigeorgiou, Aphrodite Tsaballa, Georgios K. Ntinas, and Ioannis A. Giantsis. 2024. "The Influence of Water Nitrate Concentration Combined with Elevated Temperature on Rainbow Trout Oncorhynchus mykiss in an Experimental Aquaponic Setup" Fishes 9, no. 2: 74. https://doi.org/10.3390/fishes9020074

APA Style

Papadopoulos, D. K., Lattos, A., Chatzigeorgiou, I., Tsaballa, A., Ntinas, G. K., & Giantsis, I. A. (2024). The Influence of Water Nitrate Concentration Combined with Elevated Temperature on Rainbow Trout Oncorhynchus mykiss in an Experimental Aquaponic Setup. Fishes, 9(2), 74. https://doi.org/10.3390/fishes9020074

Article Metrics

Back to TopTop