Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata)
Abstract
1. Introduction
2. Materials and Methods
2.1. Diet Preparation
2.2. Experimental Design and Sample Collection
2.3. Growth Performance
2.4. Proximate Composition
2.5. Antioxidant and Immune Enzyme Activities Determination
2.6. Digestive Enzyme Activity Assay
2.7. RNA Extraction and Quantitative Real-Time PCR Analysis
2.8. Challenge Trial
2.9. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Proximate Composition
3.3. Digestive Enzyme Activity
3.4. Immune Response
3.5. Gene Expression
3.6. Challenge Trial
3.7. Regression Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- FAO. The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2022. [Google Scholar]
- Zheng, H.; Ke, C.; Zhou, S.; Li, F. Effects of starvation on larval growth, survival and metamorphosis of Ivory shell Babylonia formosae habei Altena et al., 1981 (Neogastropoda: Buccinidae). Aquaculture 2005, 243, 357–366. [Google Scholar] [CrossRef]
- Kritsanapuntu, S.; Chaitanawisuti, N.; Santhaweesuk, W.; Natsukari, Y. Growth, production and economic evaluation of earthen ponds formonoculture and polyculture of juveniles spotted babylon (Babylonia areolata) to marketable sizes using large-scale operation. J. Shellfish Res. 2006, 25, 913–918. [Google Scholar] [CrossRef]
- Lü, W.; Zhong, M.; Fu, J.; Ke, S.; Gan, B.; Zhou, Y.; Shen, M.; Ke, C. Comparison and optimal prediction of goptimal prediction of growth of Babylonia areolata and B. lutosa. Aquacult. Rep. 2020, 18, 100425. [Google Scholar] [CrossRef]
- Zhao, W.; Huang, X.; Deng, Z.; Yang, R.; Fang, W.; Wen, W.; Zheng, Z.; Yu, G. Growth performance, digestive and immune enzyme activities, and the environmental effects of the ivory shell, Babylonia areolata (Link 1807) in integrated Multi-Trophic aquaculture systems. Aquacult. Res. 2022, 53, 4168–4177. [Google Scholar] [CrossRef]
- Noordin, W.N.; Taha, M.S.; Rahim, M.A.; Huda, N. Meat yield and biochemical composition of hatchery reared spotted babylon, Babylonia areolata (Link 1807). Asian Fish. Sci. 2014, 27, 61–74. [Google Scholar] [CrossRef]
- Mai, M.D.; Nguyen, Q.N.; Tran, B.T.T.; Vu, B.D.T. Growth performance of Babylon snails (Babylonia areolata Link, 1807) fed formulated diet in ponds and recirculating aquaculture system. Agric. For. Fish. 2022, 11, 180–185. [Google Scholar] [CrossRef]
- CSY. China Statistical Yearbook; China Statistical Publishing House: Beijing, China, 2021; p. 27. [Google Scholar]
- Dobson, G.T.; Duy, N.D.Q.; Paul, N.A.; Southgate, P.C. Assessing potential for integrating sea grape (Caulerpa lentillifera) culture with sandfish (Holothuria scabra) and Babylon snail (Babylonia areolata) co-culture. Aquaculture 2020, 522, 735153. [Google Scholar] [CrossRef]
- Zhao, W.; Han, Q.; Yang, R.; Wen, W.; Deng, Z.; Li, H.; Zheng, Z.; Ma, Z.; Yu, G. Exposure to cadmium induced gut antibiotic resistance genes (ARGs) and microbiota alternations of Babylonia areolata. Sci. Total Environ. 2023, 865, 161243. [Google Scholar] [CrossRef]
- Wang, R.; Liu, X.; Wang, J.; Huizhu; Lin, X.; Sun, J.; Mou, H.; Zhang, T.; Ma, X. Proteomic differences between Vibrio tubiashii strains with high- or low-virulence levels isolated from diseased ivory snail Babylonia areolata. Aquacult. Int. 2022, 30, 2579–2591. [Google Scholar] [CrossRef]
- Tan, X.; Sun, Z.; Chen, S.; Chen, S.; Huang, Z.; Zhou, C.; Zou, C.; Liu, Q.; Ye, H.; Lin, H.; et al. Effects of dietary dandelion extracts on growth performance, body composition, plasma biochemical parameters, immune responses and disease resistance of juvenile golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 2017, 66, 198–206. [Google Scholar] [CrossRef]
- Assane, I.M.; Gozi, K.S.; Valladão, G.M.R.; Pilarski, F. Combination of antimicrobials as an approach to reduce their application in aquaculture: Emphasis on the use of thiamphenicol/florfenicol against Aeromonas hydrophila. Aquaculture 2019, 507, 238–245. [Google Scholar] [CrossRef]
- Liu, X.; Lu, S.; Meng, W.; Zheng, B. Residues and health risk assessment of typical antibiotics in aquatic products from the Dongting Lake, China—“Did you eat “Antibiotics” today?”. Environ. Sci. Pollut. Res. 2018, 25, 3913–3921. [Google Scholar] [CrossRef]
- Shao, Y.; Wang, Y.; Yuan, Y.; Xie, Y. A systematic review on antibiotics misuse in livestock and aquaculture and regulation implications in China. Sci. Total Environ. 2021, 798, 149205. [Google Scholar] [CrossRef]
- Livingstone, D.R. The fate of organic xenobiotics in aquatic ecosystems: Quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 1998, 120, 43–49. [Google Scholar] [CrossRef]
- Kumar, S.; Verma, A.K.; Singh, S.P.; Awasthi, A. Immunostimulants for shrimp aquaculture: Paving pathway towards shrimp sustainability. Environ. Sci. Pollut. Res. 2023, 30, 25325–25343. [Google Scholar] [CrossRef]
- Prabawati, E.; Hu, S.Y.; Chiu, S.T.; Balantyne, R.; Risjani, Y.; Liu, C.H. A synbiotic containing prebiotic prepared from a by-product of king oyster mushroom, Pleurotus eryngii and probiotic, Lactobacillus plantarum incorporated in diet to improve the growth performance and health status of white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2022, 120, 155–165. [Google Scholar] [CrossRef]
- Cheng, A.C.; Peng, X.F.; Chen, W.Z.; Tseng, D.Y.; Tan, Z.G.; Liu, H.J.; Qin, Z.H.; Ballantyne, R.; Liu, C.H. Dietary probiotic Aspergillus niger preparation improves the growth performance, health status, and gut microbiota of white shrimp, Penaeus vannamei. Aquaculture 2023, 577, 739988. [Google Scholar] [CrossRef]
- Liu, R.; Wang, S.; Huang, D.; Huang, Y.; He, T.; Chen, X. The probiotic roles of Lactiplantibacillus plantarum E2 as a dietary supplement in growth promotion and disease resistance of juvenile large yellow croaker (Larimichthys crocea). Aquaculture 2024, 578, 740082. [Google Scholar] [CrossRef]
- Chauhan, A.; Singh, R. Probiotics in aquaculture: A promising emerging alternative approach. Symbiosis 2019, 77, 99–113. [Google Scholar] [CrossRef]
- Murni, K.; Wenjing, Z.; David, R.; David, N.; Marta, G.C. Probiotic strains for shellfish aquaculture: Protection of Eastern oyster, Crassostrea virginica, larvae and juveniles againsl bacterial challenge. J. Shellfish Res. 2013, 32, 401–408. [Google Scholar] [CrossRef]
- Hesser, J.; Mueller, R.S.; Langdon, C.; Schubiger, C.B. Immunomodulatory effects of a probiotic combination treatment to improve the survival of Pacific oyster (Crassostrea gigas) larvae against infection by Vibrio coralliilyticus. Front. Immunol. 2024, 15, 1–12. [Google Scholar] [CrossRef]
- Arunachalam, K.; Gill, H.S.; Chandra, R.K. Enhancement of natural immune function by dietary consumption of Bifidobacterium lactis (HN019). Eur. J. Clin. Nutr. 2000, 54, 263–267. [Google Scholar] [CrossRef] [PubMed]
- Xiaolong, G.; Caihuan, K.; Fucun, W.; Xian, L.; Ying, L. Effects of Bacillus lincheniformis feeding frequency on the growth, digestion and immunity of Haliotis discus hannai. Fish Shellfish Immunol. 2020, 96, 1–12. [Google Scholar] [CrossRef]
- Iehata, S.; Nakano, M.; Tanaka, R.; Maeda, H. Modulation of gut microbiota associated with abalone Haliotis gigantea by dietary administration of host-derived Pediococcus sp. Ab1. Fish. Sci. 2014, 80, 323–331. [Google Scholar] [CrossRef]
- Kobayashi, M. Massculture and cell utilization of photosynthetic bacteria. Process Biochem. 1978, 13, 27–30. [Google Scholar]
- Saejung, C.; Chaiyarat, A.; Sanoamuang, L.O. Optimization of three anoxygenic photosynthetic bacteria as feed to enhance growth, survival, and water quality in fairy shrimp (Streptocephalus sirindhornae) cultivation. Aquaculture 2021, 534, 736288. [Google Scholar] [CrossRef]
- George, D.M.; Vincent, A.S.; Mackey, H.R. An overview of anoxygenic phototrophic bacteria and their applications in environmental biotechnology for sustainable resource recovery. Biotechnol. Rep. 2020, 28, e00563. [Google Scholar] [CrossRef] [PubMed]
- Liu, R.; Wu, W.; Xu, X.; Wang, Y.; Yu, T.; Wang, J.; Zheng, Q.; Changru, X.; Wu, P. Rhodopseudomonas palustris in effluent enhances the disease resistance, TOR and NF-κB signalling pathway, intestinal microbiota and aquaculture water quality of Pelteobagrus vachelli. Aquacult. Res. 2020, 51, 3959–3971. [Google Scholar] [CrossRef]
- Wu, L.; Wang, Y.; Wang, H.; Liang, P.; Qin, Z.; Lai, M.; Lin, J.; Shao, J.; Zhang, D. Integrative unveiling of optimum dietary protein requirement for Siniperca scherzeri: Growth performance, feed utilization, serum biochemical and immune parameters and hepatic health maintenance. Aquaculture 2025, 598, 742004. [Google Scholar] [CrossRef]
- AOAC. Official Methods of Analysis, 13th ed.; Association of Analytical Chemists: Washington, DC, USA, 2012; p. 1018. [Google Scholar]
- Lin, Y.J.; Yang, S.Z.; Wang, X.H.; Xie, R.Y.; Cheng, J.; He, T.L.; Chen, X.H.; Zhang, X.Y. A synthetic peptide based on large yellow croaker (Larimichthys crocea) IFNG1R protein sequence has potential antimicrobial activity against Pseudomonas plecoglossicida. Front. Mar. Sci. 2022, 9, 1038013. [Google Scholar] [CrossRef]
- Rodger, H.D. Fish disease causing economic impact in global aquaculture. In Fish Vaccines; Adams, A., Ed.; Springer: Basel, Switzerland, 2016; pp. 1–34. [Google Scholar]
- Jiang, Y.H.; Yang, R.S.; Lin, Y.C.; Xin, W.G.; Zhou, H.Y.; Wang, F.; Zhang, Q.L.; Lin, L.B. Assessment of the safety and probiotic characteristics of Lactobacillus salivarius CGMCC20700 based on whole-genome sequencing and phenotypic analysis. Front. Microbiol. 2023, 14, 1120263. [Google Scholar] [CrossRef] [PubMed]
- Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z.G. Probiotics as means of diseases control in aquaculture, a review of current knowledge and future perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef] [PubMed]
- Jamal, M.T.; Abdulrahman, I.A.; Harbi, M.A.; Chithambaran, S. Probiotics as alternative control measures in shrimp aquaculture: A review. J. Appl. Biol. Biotechnol. 2019, 7, 69–77. [Google Scholar] [CrossRef]
- Saejung, C.; Chaiyarat, A.; Sanoamuang, L.O. Effects of algae, yeast and photosynthetic bacteria diets on survival and growth performance in the fairy shrimp, Streptocephalus sirindhornae (Branchiopoda, Anostraca). Crustaceana 2018, 91, 1505–1522. [Google Scholar] [CrossRef]
- Barba, E.; Melgar, C.; Hernández, C.; Alvarez, A. Efecto de microorganismos con potencial probiótico en la calidad del agua y el crecimiento de camarón Litopenaeus vannamei (Decapoda: Penaeidae) en cultivo intensivo. Rev. Biol. Trop. 2012, 61, 1215–1228. [Google Scholar]
- Sagada, G.; Chen, J.; Shen, B.; Huang, A.; Sun, L.; Jiang, J.; Jin, C. Optimizing protein and lipid levels in practical diet for juvenile northern snakehead fish (Channa argus). Anim. Nutr. 2017, 3, 156–163. [Google Scholar] [CrossRef]
- Meng, Y.; Qian, K.; Ma, R.; Liu, X.; Han, B.; Wu, J.; Zhang, L.; Zhan, T.; Hu, X.; Tian, H.; et al. Effects of dietary lipid levels on sub-adult triploid rainbow trout (Oncorhynchus mykiss): 1. Growth performance, digestive ability, health status and expression of growth-related genes. Aquaculture 2019, 513, 734394. [Google Scholar] [CrossRef]
- Yanbo, W.; Zirong, X. Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Technol. 2006, 127, 283–292. [Google Scholar] [CrossRef]
- MacFarlane, G.T.; Cummings, J.H. The colonic flora, fermentation and large bowel digestive function. In The Large Intestine: Physiology, Pathophysiology and Disease; Phillips, S.F., Pemberton, J.H., Shorter, R.G., Eds.; Mayo Clinic: Rochester, MM, USA, 1991. [Google Scholar]
- Son, V.M.; Chang, C.C.; Wu, M.C.; Guu, Y.K.; Chiu, C.H.; Cheng, W. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish Shellfish Immunol. 2009, 26, 691–698. [Google Scholar] [CrossRef] [PubMed]
- Suzer, C.; Çoban, D.; Kamaci, H.O.; Saka, Ş.; Firat, K.; Otgucuoğlu, Ö.; Küçüksari, H. Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: Effects on growth performance and digestive enzyme activities. Aquaculture 2008, 280, 140–145. [Google Scholar] [CrossRef]
- Bolasina, S.; Pérez, A.; Yamashita, Y. Digestive enzymes activity during ontogenetic development and effect of starvation in Japanese flounder, Paralichthys olivaceus. Aquaculture 2006, 252, 503–515. [Google Scholar] [CrossRef]
- Martínez-Álvarez, R.M.; Morales, A.E.; Sanz, A. Antioxidant defenses in fish: Biotic and abiotic factors. Rev. Fish Biol. Fish. 2005, 15, 75–88. [Google Scholar] [CrossRef]
- Li, X.; Sun, J.; Wang, L.; Song, K.; Lu, K.; Zhang, L.; Ma, X.; Zhang, C. Effects of dietary vitamin E levels on growth, antioxidant capacity and immune response of spotted seabass (Lateolabrax maculatus) reared at different water temperatures. Aquaculture 2023, 565, 739141. [Google Scholar] [CrossRef]
- Oakes, K.D.; Van Der Kraak, G.J. Utility of the TBARS assay in detecting oxidative stress in white sucker (Catostomus commersoni) populations exposed to pulp mill effluent. Aquat. Toxicol. 2003, 63, 447–463. [Google Scholar] [CrossRef] [PubMed]
- Eissa, M.E.H.; Alaryani, F.S.; Elbahnaswy, S.; Khattab, M.S.; Elfeky, A.; AbouelFadl, K.Y.; Eissa, E.-S.H.; Ahmed, R.A.; Van Doan, H.; El-Haroun, E. Dietary inclusion of Pediococcus acidilactici probiotic promoted the growth indices, hemato-biochemical indices, enzymatic profile, intestinal and liver histomorphology, and resistance of Nile Tilapia against Aspergillus flavus. Anim. Feed Sci. Technol. 2023, 306, 115814. [Google Scholar] [CrossRef]
- He, X.; Abakari, G.; Tan, H.; Liu, W.; Luo, G. Effects of different probiotics (Bacillus subtilis) addition strategies on a culture of Litopenaeus vannamei in biofloc technology (BFT) aquaculture system. Aquaculture 2023, 566, 739216. [Google Scholar] [CrossRef]
- Amoah, K.; Huang, Q.C.; Tan, B.P.; Zhang, S.; Chi, S.Y.; Yang, Q.H.; Liu, H.Y.; Dong, X.H. Dietary supplementation of probiotic Bacillus coagulans ATCC 7050, improves the growth performance, intestinal morphology, microflora, immune response, and disease confrontation of Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2019, 87, 796–808. [Google Scholar] [CrossRef]
- Mansour, A.T.; Ashour, M.; Abbas, E.M.; Alsaqufi, A.S.; Kelany, M.S.; El-Sawy, M.A.; Sharawy, Z.Z. Growth performance, immune-related and antioxidant genes expression, and gut bacterial abundance of Pacific white leg shrimp, Litopenaeus vannamei, dietary supplemented with natural astaxanthin. Front. Physiol. 2022, 13, 874172. [Google Scholar] [CrossRef]
- Yu, Q.; Fu, Z.; Huang, M.; Xu, C.; Wang, X.; Qin, J.G.; Chen, L.; Han, F.; Li, E. Growth, physiological, biochemical, and molecular responses of Pacific white shrimp Litopenaeus vannamei fed different levels of dietary selenium. Aquaculture 2021, 535, 736393. [Google Scholar] [CrossRef]
- Han, J.; Lu, Y.; Zheng, H.; Liu, H.; Deng, H.; Zhang, B. Differential expression of CuZnSOD gene under low temperature stress in noble scallop Chlamys nobilis with different carotenoid content. Fish Shellfish Immunol. 2016, 54, 30–39. [Google Scholar] [CrossRef]
- Morohoshi, T.; Ebata, A.; Nakazawa, S.; Kato, N.; Ikeda, T. N-acyl homoserine lactone-producing or degrading bacteria isolated from the intestinal microbial flora of ayu fish (Plecoglossus altivelis). Microbes Environ. 2005, 20, 264–268. [Google Scholar] [CrossRef]
- Duan, Y.; Liu, P.; Li, J.; Wang, Y.; Li, J.; Chen, P. Molecular responses of calreticulin gene to Vibrio anguillarum and WSSV challenge in the ridgetail white prawn Exopalaemon carinicauda. Fish Shellfish Immunol. 2014, 36, 164–171. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; Li, F.; Zhang, X.; Dong, B.; Zhang, J.; Xie, Y.; Xiang, J. cDNA cloning, characterization and expression analysis of the antioxidant enzyme gene, catalase, of Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol. 2008, 24, 584–591. [Google Scholar] [CrossRef] [PubMed]
- Wu, Z.; Yu, X.; Chen, P.; Pan, M.; Liu, J.; Sahandi, J.; Zhou, W.; Mai, K.; Zhang, W. Dietary Clostridium autoethanogenum protein has dose-dependent influence on the gut microbiota, immunity, inflammation and disease resistance of abalone Haliotis discus hannai. Fish Shellfish Immunol. 2024, 151, 109737. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Wang, T.; Yang, Q.; Zheng, S.; Ma, S.; Yao, W.; Li, Y.; Wu, Z. Potential benefits of Bacillus subtilis-mediated bioflocs in supplementary feeding on triangle sail mussels Hyriopsis cumingii: A pilot study of fluorescence-labeled floc-forming bacteria. Aquacult. Rep. 2024, 34, 101904. [Google Scholar] [CrossRef]
- Tarnecki, A.M.; Burgos, F. Shellfish Microbiome and Probiotics: A Decade in Review. In Microbiome of Finfish and Shellfish; Diwan, A., Harke, S.N., Panche, A., Eds.; Springer Nature: Singapore, 2023; pp. 225–254. [Google Scholar] [CrossRef]
- Suzuki, T.; Mori, K. Hemolymph lectin of the pearl oyster, Pinctada fucata martensii: A possible non-self recognition system. Dev. Comp. Immunol. 1990, 14, 161–173. [Google Scholar] [CrossRef]
- Yang, C.; Du, X.; Hao, R.; Wang, Q.; Deng, Y.; Sun, R. Effect of vitamin D3 on immunity and antioxidant capacity of pearl oyster Pinctada fucata martensii after transplantation: Insights from LC–MS-based metabolomics analysis. Fish Shellfish Immunol. 2019, 94, 271–279. [Google Scholar] [CrossRef]
- Yang, C.; Hao, R.; Deng, Y.; Liao, Y.; Wang, Q.; Sun, R.; Jiao, Y.; Du, X. Effects of protein sources on growth, immunity and antioxidant capacity of juvenile pearl oyster Pinctada fucata martensii. Fish Shellfish Immunol. 2017, 67, 411–418. [Google Scholar] [CrossRef]
- Rajalakshmi, S.; Mohandas, A. Copper-induced changes in tissue enzyme activity in a freshwater mussel. Ecotoxicol. Environ. Saf. 2005, 62, 140–143. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Ling, Y.; Zhang, R.; Ke, C.; Hong, G. Effects of dietary supplementation of probiotics on growth, immune responses, and gut microbiome of the abalone Haliotis diversicolor. Aquaculture 2018, 493, 289–295. [Google Scholar] [CrossRef]
- Grandiosa, R.; Mérien, F.; Young, T.; Van Nguyen, T.; Gutierrez, N.; Kitundu, E.; Alfaro, A.C. Multi-strain probiotics enhance immune responsiveness and alters metabolic profiles in the New Zealand black-footed abalone (Haliotis iris). Fish Shellfish Immunol. 2018, 82, 330–338. [Google Scholar] [CrossRef]
- Jiang, H.F.; Liu, X.L.; Chang, Y.Q.; Liu, M.T.; Wang, G.X. Effects of dietary supplementation of probiotic Shewanella colwelliana WA64, Shewanella olleyana WA65 on the innate immunity and disease resistance of abalone, Haliotis discus hannai Ino. Fish Shellfish Immunol. 2013, 35, 86–91. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Zhang, L.; Qu, T.; Tang, X.; Li, L.; Zhang, G. Conservation and divergence of mitochondrial apoptosis pathway in the Pacific oyster, Crassostrea gigas. Cell Death Dis. 2017, 8, e2915. [Google Scholar] [CrossRef] [PubMed]
- Achard-Joris, M.; Gonzalez, P.; Marie, V.; Baudrimont, M.; Bourdineaud, J.-P. Cytochrome c oxydase subunit I gene is up-regulated by cadmium in freshwater and marine bivalves. Biometals 2006, 19, 237–244. [Google Scholar] [CrossRef]
- Cadangin, J.; Lee, J.H.; Jeon, C.Y.; Lee, E.S.; Moon, J.S.; Park, S.J.; Hur, S.W.; Jang, W.J.; Choi, Y.H. Effects of dietary supplementation of Bacillus, β-glucooligosaccharide and their synbiotic on the growth, digestion, immunity, and gut microbiota profile of abalone, Haliotis discus hannai. Aquacult. Rep. 2024, 35, 102027. [Google Scholar] [CrossRef]
- Feng, Z.; Song, X.; Zhao, L.; Zhu, W. Isolation of probiotics and their effects on growth, antioxidant and non-specific immunity of sea cucumber Apostichopus japonicus. Fish Shellfish Immunol. 2020, 106, 1087–1094. [Google Scholar] [CrossRef]
- Liu, L.; Zhuang, H.; Tian, X.; Zhou, Y.; Wang, F.; Liu, Z.; Li, J.; Jiao, M.; Xue, S.; Li, J.; et al. Understanding the probiotic potential of Lactobacillus plantarum: Antioxidant capacity, non-specific immunity and intestinal microbiota improvement effects on Manila clam Ruditapes philippinarum. Fish Shellfish Immunol. 2024, 154, 109971. [Google Scholar] [CrossRef]
- Goh, J.X.H.; Tan, L.T.H.; Law, J.W.F.; Khaw, K.Y.; Zengin, G.; Chan, K.G.; Letchumanan, V.; Lee, L.H.; Goh, B.H. Probiotics: Comprehensive exploration of the growth promotion mechanisms in shrimps. Prog. Microbes Mol. Biol. 2023, 6, a0000324. [Google Scholar] [CrossRef]
- Khan, M.I.R.; Kamilya, D.; Choudhury, T.G.; Rathore, G. Dietary administration of a host-gut derived probiotic Bacillus amyloliquefaciens COFCAU_P1 modulates immune-biochemical response, immune-related gene expression, and resistance of Labeo rohita to Aeromonas hydrophila infection. Aquaculture 2022, 546, 737390. [Google Scholar] [CrossRef]
- Zhu, L.; Kong, Y.; Chang, X.; Feng, J.; Wang, X.; Hou, L.; Zhao, X.; Pei, C.; Kong, X. Effects of two fish-derived probiotics on growth performance, innate immune response, intestinal health, and disease resistance of Procambarus clarkii. Aquaculture 2023, 562, 738765. [Google Scholar] [CrossRef]
Ingredients | Content (%) | Nutrient Levels | Content (%) |
---|---|---|---|
Fish Meal | 46.0 | Crude protein | 42.86 |
Soybean meal | 24.0 | Crude lipid | 13.34 |
α-Starch | 24.1 | Ash | 9.84 |
Vitamin premix a | 0.4 | Moisture | 8.22 |
Mineral premix b | 1.0 | ||
Fish oil | 3.0 | ||
Monocalcium phosphate | 1.5 |
Primers | Sequence (5′–3′) | Product Size (bp) |
---|---|---|
ACP-F | CAACTTCACCAAGAACACGG | 87 |
ACP-R | TGAGTGCTGTTGTGGATGGT | |
ferritin-F | CAACGGTCACAACGATGCT | 90 |
ferritin-R | TGGTCGCCGATTTCCTT | |
CYC-F | GCAGGAAATGCCGAGAAG | 123 |
CYC-R | AGTCTTGCGTCCAATCAGG | |
mucin-5AC-F | CAACAGGTTCCTCATCTTCG | 163 |
mucin-5AC-R | AAGGAGGATGCGGGAGA | |
CYP450-F | AACCCTCGCCATTTATCG | 133 |
CYP450-R | GTTGTCAGCAGCATCGGA | |
Cu/Zn-SOD-F | GACACTTCAACCCCTTCGG | 108 |
Cu/Zn-SOD-R | TCACTACAGCCTTGCCACTG | |
GST-F | TCTTCTGGGGTTCTGGTAGC | 190 |
GST-R | CCTGATTCATTGACAATGGTG | |
SOD-F | AGCACGGAAGTCAAAGGAGA | 118 |
SOD-R | CAAACTGATGGATGTGGAAGC | |
β-actin-F | CGTCCTTTGGTGACTCTGG | 184 |
β-actin-R | TGGATGTGGTAGCCGTTTC |
Diets g/kg | RP0 | RP1 | RP2 | RP3 | RP4 | Orthogonal Contrast a (p) | p Value b | p Value c | ||
---|---|---|---|---|---|---|---|---|---|---|
0 | 1 | 5 | 10 | 20 | Linear | Quadratic | Cubic | |||
IBW, g | 0.28 ± 0.01 a | 0.28 ± 0.01 a | 0.28 ± 0.01 a | 0.28 ± 0.02 a | 0.28 ± 0.01 a | 0.776 | 0.915 | 0.889 | 0.634 | 0.700 |
FBW, g | 0.95 ± 0.01 c | 1.05 ± 0.02 bc | 1.04 ± 0.05 b | 1.15 ± 0.04 a | 1.16 ± 0.04 a | 0.908 | 0.432 | 0.566 | 0.001 | 0.000 |
WGR, % | 243.97 ± 17.66 b | 270.76 ± 15.11 ab | 273.41 ± 13.01 ab | 318.80 ± 34.48 a | 318.67 ± 31.11 a | 0.000 | 0.003 | 0.009 | 0.321 | 0.479 |
SGR, %/d | 2.06 ± 0.08 b | 2.18 ± 0.07 ab | 2.20 ± 0.06 ab | 2.38 ± 0.13 a | 2.38 ± 0.13 a | 0.000 | 0.002 | 0.006 | 0.430 | 0.660 |
SR, % | 83.33 ± 3.82 a | 84.17 ± 6.29 a | 84.17 ± 1.44 a | 86.67 ± 6.29 a | 85.00 ± 5.00 a | 0.480 | 0.762 | 0.879 | 0.494 | 0.706 |
Diets g/kg | RP0 | RP1 | RP2 | RP3 | RP4 | Orthogonal Contrast a (p) | p Value b | p Value c | ||
---|---|---|---|---|---|---|---|---|---|---|
0 | 1 | 5 | 10 | 20 | Linear | Quadratic | Cubic | |||
Moisture % | 74.67 ± 1.12 a | 73.30 ± 0.35 a | 72.13 ± 0.92 a | 74.99 ± 1.81 a | 74.23 ± 0.82 a | 0.722 | 0.238 | 0.154 | 0.107 | 0.650 |
Crude protein % | 59.26 ± 1.93 b | 61.46 ± 2.50 ab | 61.61 ± 2.70 ab | 64.77 ± 1.35 ab | 64.97 ± 1.44 a | 0.001 | 0.006 | 0.019 | 0.658 | 0.294 |
Crude lipid % | 9.15 ± 0.33 a | 9.10 ± 0.71 a | 9.08 ± 1.05 a | 8.82 ± 0.65 a | 8.80 ± 0.98 a | 0.450 | 0.0.756 | 0.905 | 0.648 | 0.782 |
Ash % | 3.48 ± 0.28 b | 3.79 ± 0.30 ab | 3.87 ± 0.47 ab | 4.52 ± 0.16 a | 4.34 ± 0.19 a | 0.001 | 0.004 | 0.009 | 0.157 | 0.405 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, X.; Lu, Y.-P.; Zhang, Z.-L.; Zheng, P.-H.; Li, J.-T.; Zhang, X.-X.; Li, J.-J.; Wu, H.-M.; Xian, J.-A. Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes 2024, 9, 522. https://doi.org/10.3390/fishes9120522
Wang X, Lu Y-P, Zhang Z-L, Zheng P-H, Li J-T, Zhang X-X, Li J-J, Wu H-M, Xian J-A. Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes. 2024; 9(12):522. https://doi.org/10.3390/fishes9120522
Chicago/Turabian StyleWang, Xiao, Yao-Peng Lu, Ze-Long Zhang, Pei-Hua Zheng, Jun-Tao Li, Xiu-Xia Zhang, Jia-Jun Li, Heng-Mei Wu, and Jian-An Xian. 2024. "Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata)" Fishes 9, no. 12: 522. https://doi.org/10.3390/fishes9120522
APA StyleWang, X., Lu, Y.-P., Zhang, Z.-L., Zheng, P.-H., Li, J.-T., Zhang, X.-X., Li, J.-J., Wu, H.-M., & Xian, J.-A. (2024). Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes, 9(12), 522. https://doi.org/10.3390/fishes9120522