Next Article in Journal
Numerical Simulation Analysis of an Offshore Multi-Row Arrangement Longline Aquaculture Facility with Lantern Nets Under Environmental Loads
Previous Article in Journal
Effects of Substituting Fishmeal (FM) Diet with a Diet of FM Plus Soy Protein Concentrate (SPC) Supplemented with Essential Amino Acids on the Growth and Gonadal Development of the Olive Flounder (Paralichthys olivaceus)
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata)

1
College of Biology and Agriculture, Jiamusi University, Jiamusi 154007, China
2
Hainan Provincial Key Laboratory for Functional Components Research and Utilization of Marine Bio-Resources, Institute of Tropical Biosciences and Biotechnology, Chinese Academy of Tropical Agricultural Sciences, Haikou 571101, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2024, 9(12), 522; https://doi.org/10.3390/fishes9120522
Submission received: 2 December 2024 / Revised: 13 December 2024 / Accepted: 17 December 2024 / Published: 20 December 2024
(This article belongs to the Special Issue Nutrition and Immune Responses in Aquatic Animals)

Abstract

Rhodopseudomonas palustris (RP) are known anaerobic bacteria with probiotic properties containing several bioactive compounds and enzymes that benefit aquatic animals. However, studies on the use of RP on aquatic animal species are limited. This study investigated the effects of dietary supplementation with RP formulation on the growth, non-specific immunity, and disease resistance of juvenile ivory shells (Babylonia areolata). The experiment was conducted for 8 weeks, with B. areolata fed a control diet (RP0) and four diets containing four different RP formulations, with doses of 1 (RP1), 5 (RP2), 10 (RP3), and 20 (RP4) g/kg, respectively. Higher levels of R. palustris in the formulation led to increased final weight, weight gain, and specific growth rate in B. areolata. The crude protein content was significantly higher in the RP4 group compared to the RP0 group. However, there was no significant difference in the crude lipid content. Higher levels of R. palustris in the RP4 formulation group increased the trypsin and lipase activities. Dietary supplementation with RP significantly increased the total antioxidant capacity, superoxide dismutase, and catalase activities and decreased the malondialdehyde content in B. areolata. Acid phosphatase and alkaline phosphatase activities were significantly increased in the RP4 group compared to the RP0 group. Dietary RP significantly increased the expression levels of antioxidant-related (superoxide dismutase, Cu/Zn-superoxide dismutase, glutathione S-transferase A-like, ferritin) and immune-related (acid phosphatase, cytochrome c) genes. Higher levels of R. palustris in the formulations RP3 and RP4 increased the survival rate of B. areolata challenged with Vibrio parahaemolyticus. These findings indicate that R. palustris preparation could improve growth performance, muscle composition, and digestive capacity and may act as an immune booster for preventing disease in B. areolata.
Key Contribution: Dietary probiotic R. palustris formulation improved the growth performance, muscle crude protein content and non-specific immunity of B. areolata. Supplementation of 10–20 g/kg R. palustris improved the resistance to V. parahaemolyticus in B. areolate.

1. Introduction

Aquaculture is one of the world’s most significant food production sectors. Production of global aquaculture reached 122.6 million tonnes in 2022 [1]. The ivory shell (B. areolata), a member of the Babyloniidae family, is an important marine gastropod that is widely distributed in tropical and subtropical sea areas of the Indo-Pacific Ocean [2,3]. Recently, the farming area of B. areolata has been developing rapidly in China, and the farming production has maintained growth over the past several years [4,5]. B. areolata is a high-quality seawater culture shellfish with good sales and promotion prospects [6,7]. B. areolata have both a high economic value (100 RMB/kg) and fast-growing features and are considered to be a promising aquaculture candidate with an annual production of more than 12,500 tons/year [8]. B. areolata are usually cultured in a flowing seawater system and fed with waste fish [3,4]. High-density farming produces large amounts of residual feed and more excreta, leading to water pollution and disease. The occurrence of diseases causes B. areolata farming to fail, resulting in huge economic losses [9,10,11]. To prevent losses caused by disease, farmers use a variety of commercially available antibiotics [12]. However, the overuse of these chemicals impacts the environment and human health [13,14,15]. Antibiotics residues in aquaculture systems alter the biological aspects of organisms, making it more difficult to treat aquatic diseases [16]. Therefore, there is an urgent need to find healthy and environmentally friendly feed additives to replace antibiotics and chemicals.
Probiotics, as healthy and environmentally friendly feed additives, can enhance the immune system and improve disease resistance in aquatic animals [17,18,19,20]. Probiotics are recognized as living microorganisms that are beneficial to the host when used to their full potential, and they are considered a suitable choice for disease control [21]. Dietary probiont Phaeobacter sp. S4 could improve the disease resistance of Eastern oyster (Crassostrea virginica) against V. tubiashii [22]. Hesser et al. reported that a dietary probiotic combination (B11, DM14, and D16) increased expression of immune-related genes (IL-7, MyD88) and the survival of Pacific oyster (Crassostrea gigas) larvae infected with V. coralliilyticus [23]. Some studies have demonstrated that probiotics, such as Bifidobacterium spp., Bacillus spp., and Pediococcus spp., are beneficial to the host [24,25,26]. The beneficial effects of probiotics on the host have become a key scientific issue for research, but there is limited literature available on the subject.
R. palustris (RP) are anaerobic bacteria with probiotic properties that contain several bioactive compounds, such as digestible bacterial cell walls, proteins, carotenoids, biological cofactors, and vitamins, which provide benefits to aquatic animals [27,28,29]. For instance, Chewapat et al. have shown that adding RP to the diet of fairy shrimp (Streptocephalus sirindhornae) can result in significant improvements in growth and survival [28]. Moreover, Liu et al. have also demonstrated that supplementing the diet of yellow catfish (Pelteobagrus vachelli) with RP can modulate fish immunity and enhance their disease resistance [30]. Although RP has beneficial effects on fish and shrimp culture, research focused on the supplementation of aquafeed with RP is still limited, and especially in the case of B. areolate, relevant studies have not been reported. This study aimed to determine the dietary RP formulation requirements for B. areolata and investigate the effects of RP supplementation on the growth performance, muscle composition, immunity, gut microbiota, and disease resistance of B. areolata.

2. Materials and Methods

2.1. Diet Preparation

The RP probiotic, sourced from the Institute of Tropical Bioscience and Biotechnology, Chinese Academy of Tropical Agricultural Sciences (Haikou, China), was used to assess the potential impact on B. areolata performance. The composition and formulation of the basal diet are shown in Table 1. A basic diet containing 42.86% crude protein and 13.34% lipid was formulated as the control. The basal diet was used as the control diet (RP0), and 1, 5, 10, and 20 g/kg RP were separately supplemented to formulate four experimental diets (RP1, RP2, RP3, and RP4, respectively). All the ingredients were crushed before the feed was sieved through 80-mesh and mixed with oil. About 30% water of the diet was added, mixed, and kneaded into a dough-like soft pellet feed, divided into small portions according to the estimated daily feeding rate, stored at −20 °C, and thawed at room temperature before feeding.

2.2. Experimental Design and Sample Collection

B. areolata were obtained from a commercial farm in Wenchang, Hainan, China. They were transported to the experimental facility in a plastic tank. Prior to the feeding trial, B. areolata were fed with the basal diet for 2 weeks to acclimate to the experimental diet and conditions. After B. areolata were fasted for 24 h, 600 individuals with an average initial body weight (IBW) of 0.28 ± 0.01 g were randomly divided into five groups, with three replicates in each group. Each sub-group included 40 individuals distributed in 60 cm × 40 cm × 50 cm glass breeding tanks, with the bottom covered with a 4 cm thick layer of sand and filled with 65 L seawater. B. areolata were fed two times daily at 08:00 and 17:00 until apparent satiation based on visual observation for 8 weeks. During the experimental period, the water temperature, pH, and salinity were recorded as 26–28 °C, 7.2–7.8, and 28‰–31‰, respectively.
At the end of the experiment, the final body weight (FBW) of the B. areolata was measured. The B. areolata were then snap-frozen in liquid nitrogen and stored at −80 °C until use. For experimental measurements, the samples were taken out of the refrigerator, thawed properly, and their shells were crushed. The meat and viscera were removed. The hepatopancreas was separated and washed with 0.9% NaCl solution, and immunoenzymatic activity was analyzed. B. areolata muscles were collected and stored at −20 °C for muscle composition analysis.

2.3. Growth Performance

The parameters were calculated as per the following formulas [31]:
Specific growth rate (SGR, %/day) = 100 × [Ln(FBW) − Ln(IBW)]/number of days
Weight gain rate (WGR, %) = 100 × (FBW − IBW)/IBW
Survival (SR, %) = 100 × (final snail number)/(initial snail number)

2.4. Proximate Composition

Proximate compositions of the experimental diets and muscle were analyzed based on the methods of the Association of Official Analytical Chemists Moisture [32], including crude protein, crude lipid, and ash contents.

2.5. Antioxidant and Immune Enzyme Activities Determination

Antioxidant and immunological indicators, such as malondialdehyde (MDA, A003-2-2) content, total antioxidant capacity (T-AOC, A015-2-1), superoxide dismutase (SOD, A001-3-2) activity, catalase (CAT, A007-1-1) activity, acid phosphatase (ACP, A060-2-2) activity, and alkaline phosphatase (AKP, A059-2-2) activity were assessed in the hepatic homogenates using the corresponding concentration test kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.6. Digestive Enzyme Activity Assay

The activities of digestive enzymes were measured using kits, including trypsin (A080-2-2), α-amylase (C016-1-1), and lipase (A054-2-1) kits obtained from the Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

2.7. RNA Extraction and Quantitative Real-Time PCR Analysis

RNA of hepatopancreas was extracted by TRIzol reagent (TaKaRa, Shiga, Japan). RNA integrity was examined using 1% agarose gel electrophoresis, and the absorbance was determined using a NanoDrop One spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA) to determine the purity and concentration of the RNA. The first-strand cDNA was synthesized using the PrimeScript RT Reagent Kit (Takara, Dalian, China).
The specific primer for quantitative real-time PCR (qRT-PCR) was designed using Primer Premier v5 (PREMIER Biosoft International, Palo Alto, CA, USA) according to our transcriptome library (Table 2). A Roche LightCycler® 96 real-time PCR machine (Roche Diagnostics GmbH, Mannheim, Germany) was used to perform real-time qRT-PCR with SYBR® Green qPCR Mix (Takara, Dalian, China). The PCR mixture (20 μL) consisted of 10 μL of 2 × SYBR® Green qPCR Mix, 0.4 μL of each primer (10 μM), 8.2 μL of PCR-grade water, and 1 μL DNA as the template. The mRNA amplification conditions were set as follows: 94 °C for 3 min, pre-denaturation at 94 °C for 15 s, 58 °C for 15 s, and 72 °C for 20 s, and the number of cycles was 40 cycles. 2−ΔΔCt was used to calculate relative gene expression levels.

2.8. Challenge Trial

V. parahaemolyticus was isolated from diseased B. areolata, identified, and stored in 50% glycerol (Solarbio, Beijing, China) at −80 °C for further use. Based on pre-experiments, 1 × 108 CFU/mL (LD50) of V. parahaemolyticus was determined as the exposure concentration. Ten B. areolata were randomly selected and placed in tanks containing V. parahaemolyticus. During the exposure experiment, the number of deaths of B. areolata was recorded. The survival rate was calculated, and V. parahaemolyticus was confirmed after being reisolated from the dead B. areolata.

2.9. Statistical Analysis

All the data presented in this study were expressed as the mean ± standard deviation (SD). Statistical Package for the Social Sciences (SPSS) 18.0 software (SPSS, Chicago, IL, USA) was used for statistical analysis. The Shapiro–Wilk test and Levene’s test were used to evaluate the homogeneity of normality and variance for data, respectively. One-way analysis of variance (ANOVA) was used to compare the differences among groups with Tukey multiple comparisons, and p < 0.05 was considered statistically significant. Broken-line regression and curvilinear regression were applied to evaluate the optimal dosage of dietary RP for B. areolata.

3. Results

3.1. Growth Performance

FBW, WGR, and SGR showed an upward trend in the case of higher concentrations of dietary RP (Table 3). FBW was significantly higher in the RP2, RP3, and RP4 groups compared to the RP0 group (p < 0.05). The SGR and WGR in the RP3 and RP4 groups were significantly higher than those in the R0 group (p < 0.05), and there was no significant difference among the RP1, RP2, RP3, and RP4 groups (p > 0.05). However, supplementation of RP preparation showed no significant difference in the survival of B. areolata (p > 0.05).

3.2. Proximate Composition

The proximate compositions of muscle of B. areolata are shown in Table 4. Eight weeks of dietary supplementation with RP had a significant effect on both muscle crude protein and ash compared to the RP0 group (p < 0.05). The muscle crude protein content tended to increase and stabilize in response to the highest dietary RP levels and was significantly increased in the RP4 group compared to the RP0 group (p < 0.05). The muscle lipid content decreased with increasing dietary RP levels, but no significant difference existed between the experimental groups (p > 0.05). The crude ash content was significantly higher in the RP3 and RP4 groups compared to the RP0 group (p < 0.05). There were no significant differences between the treatment groups, and no significant differences were observed in moisture content among all treatments (p > 0.05).

3.3. Digestive Enzyme Activity

The activities of digestive enzymes (trypsin, lipase, and α-amylase) in B. areolata fed with RP are presented in Figure 1. Trypsin activity was higher in the RP3 and RP4 groups in comparison with the RP0 group (p < 0.05). There were no significant differences in the RP2, RP3 and RP4 groups (p > 0.05) (Figure 1A). There was a significant difference in lipase activity between RP4 and RP0 groups (p < 0.05), and there was no significant difference among the RP2, RP3 and RP4 groups (p > 0.05) (Figure 1B). Additionally, there was no significant difference in α-amylase activity among the experimental groups (p > 0.05) (Figure 1C).

3.4. Immune Response

Effects of dietary RP on MDA content, SOD activity, CAT activity, and T-AOC in the hepatopancreas of B. areolata are shown in Figure 2. The SOD activity in the RP4 group was significantly higher than in other groups (p < 0.05) (Figure 2A). The CAT activity in RP3 and RP4 groups was significantly higher than that in the RP0 group (p < 0.05). There was no significant difference among the RP0, RP1, and RP2 groups (p > 0.05) (Figure 2B). T-AOC showed a trend of gradual increase with the increase in dietary RP levels. The T-AOC in the RP2, RP3, and RP4 groups was significantly higher than in the RP0 group (p < 0.05) (Figure 2C). The MDA content in the RP2, RP3, and RP4 groups was significantly lower than in the RP0 group (p < 0.05) (Figure 2D).
The effects of dietary RP on ACP and AKP activities in the hepatopancreas of B. areolata are shown in Figure 3. The ACP activity was significantly higher in the RP3 group than that in the RP0 group (p < 0.05, Figure 3A). The AKP activity in the RP3 and RP4 groups was significantly higher than in the other groups (p < 0.05) (Figure 3B).

3.5. Gene Expression

A comparison of the mRNA transcription levels of antioxidant-associated genes of B. areolata fed with RP is displayed in Figure 4. The mRNA levels of SOD, Cu/Zn-SOD, GST, and ferritin showed an increasing trend in response to higher dietary RP levels. The expression levels of SOD, Cu/Zn-SOD, and ferritin in the RP2, RP3, and RP4 groups were significantly higher than those in the R0 group (p < 0.05). In addition, the expression levels of SOD and ferritin in the RP3 and RP4 groups were significantly higher than those in the other groups (p < 0.05). The GST expression level in the RP4 group was significantly higher than in the R0 group (p < 0.05), and no significant difference was found among the RP1, RP2, RP3, and RP4 groups (p >0.05). However, there were no significant differences in CYP450 mRNA levels among the groups (p > 0.05).
A comparison of the mRNA transcription levels of immunity-associated genes of B. areolata fed with BP is displayed in Figure 5. The expression levels of ACP in RP2, RP3, and RP4 groups were significantly higher than those in the R0 group (p < 0.05). The mRNA levels of CYC showed an increasing trend with higher dietary RP levels. The mRNA levels of CYC were significantly up-regulated in the RP3 and RP4 groups (p < 0.05). However, there were no significant differences in mucin-5AC mRNA levels among all groups (p > 0.05).

3.6. Challenge Trial

The SR of B. areolata fed RP-supplemented diets for 8 weeks, experimentally infected with V. parahaemolyticus and observed for 96 h are represented in Figure 6. Dietary supplementation with RP could significantly increase SR (p < 0.05) compared to that observed in the RP0 group. The SR of the RP3 and RP4 groups was significantly higher than that of the RP0 group (p < 0.05). There was no significant difference in SRs among the RP-supplemented groups (p > 0.05).

3.7. Regression Analysis

Representative and significant parameters were selected to conduct the regression curve (Figure 7). The broken-line regression curve of WGR and SGR indicates that the suitable additional dosage of RP was above 16.67 g/kg. The antioxidant indicators show that the optimum range of RP addition is 15.19–16.67 g/kg. The ACP and trypsin activity could reach a peak at the level of 12.15 g/kg and 13.80 g/kg, respectively. Above all, correlating the parameter significance analyses with the regression analyses, we recommend that the optimal level of addition of dietary RP is between 12.11 and 16.67 g/kg.

4. Discussion

Bacterial diseases cause huge economic losses within the aquaculture industry and have become the one of the biggest bottlenecks restricting the sustainable development of aquaculture [33,34]. Probiotics are considered biotherapeutic agents because they can provide the host with various health benefits [35]. Increasing evidence suggests that probiotics represent a safer and more sustainable alternative to antimicrobial agents in farming [36,37]. In this study, RP showed satisfactory growth improvement in B. areolata. After 8 weeks of feeding, dietary supplementation with RP significantly improved the weight gain and specific growth rates of B. areolata. A previous study suggested that dietary RP increased the growth and survival of fairy shrimp (Streptocephalus sirindhornae) [38]. The promotion of the growth performance of shrimp was observed in the Rhodopseudomonas faecalis PA2-supplemented diet, which could significantly increase the survival and growth performance of S. sirindhornae [28]. A similar improvement in the growth of RP was found in L. vannamei [39]. Growth involves multiple physiological processes and is influenced by the organism’s digestive and absorptive physiology [40]. Dietary use in the digestive tract of aquatic animals relies strongly on digestive enzymes to ensure the availability of intake nutrients [41]. Functional probiotics could produce a wide range of exoenzymes and enhance the activities of endogenous digestive enzymes in the digestive system of aquatic animals [42]. The potential for extracellular enzyme production by probiotics has been reported in previous studies [42,43,44,45]. Dietary probiotics affect the composition of the microbiota in the intestinal tract, leading to the proliferation of beneficial microorganisms in the intestinal tract and increasing the activities of digestive enzymes [46].
In this study, dietary supplementation of RP increased the muscle crude protein content and decreased the muscle crude lipid content of B. areolata. RP is rich in amino acids and fatty acids, and high concentrations of RP provide more nutrients for B. areolata feed nutrition, which alters the protein and lipid metabolism. RP contains a variety of B vitamins and pantothenic acid, which act as coenzymes in body metabolism and promote the growth and development of animals [28]. Hence, it could conceivably be hypothesized that these components may promote the metabolism of B. areolata and increase protein deposition in the muscle. However, studies on the effects of feed probiotics on the nutrient composition of shellfish muscle are limited, and the underlying mechanisms responsible for this phenomenon are unclear and require further studies.
The antioxidant system of aquatic animals consists of a variety of enzymes, such as SOD and CAT, which play an important protective role in the organism by scavenging excess reactive oxygen species (ROS) from the body [47]. T-AOC is an important comprehensive indicator of antioxidant capacity in aquatic animals [48]. MDA is an indicator of lipid peroxidation, reflecting the degree of damage and antioxidant capacity of lipid peroxidation [49]. In this study, the levels of SOD and CAT activities and T-AOC in the hepatopancreas were elevated following administration of RP, and MDA content significantly decreased, suggesting an enhancement in the antioxidant capabilities of B. areolata. Dietary supplementation with Pediococcus acidilactici [50], Bacillus subtilis [51], and Bacillus coagulans [52] can significantly improve the antioxidant capacity of aquatic animals. Dietary RP significantly increased the relative expression levels of SOD, Cu/Zn-SOD, GST, and ferritin genes in the hepatopancreas of B. areolata. According to the different metal repair groups in SOD, it can be classified into four types, among which Cu/Zn-SOD is the most widely distributed and common, which plays an important role in the antioxidant host response [53]. GST is associated with detoxification and antioxidant processes in crustaceans [54]. Ferritin has an iron storage function and can reduce ROS generated by the Fenton reaction by decreasing the concentration of Fe2+ in cells [55]. Our results showed similar trends in antioxidant enzyme activity and antioxidant-related gene expression levels in the hepatopancreas of B. areolata after being fed diets supplemented with RP. The secondary metabolites of the bacteria contain antioxidants, which are characteristics of antioxidant enzymes that become more prevalent as the culture time increases [56]. Further experiments to explore the function of bacterial secondary metabolites to verify our hypothesis are crucial.
Most of the aquatic invertebrates lack adaptive immunity and rely on the innate immune system to defend themselves against invading pathogenic microorganisms [57,58]. Although several studies have demonstrated the effects of probiotic supplementation on the immune response of aquatic animals [59,60,61], information on how these strains affect the regulatory mechanisms of the innate immune system is still limited. ACP and AKP are two lysosomal esterases that play an active role in the innate immune response and can be used as biomarkers of aquatic animal health [62,63]. ACP is a lysosomal enzyme involved in the intracellular breakdown of phagocytosed antigens and is used as a macrophage activation marker in invertebrates and mammals [62,64]. AKP is a phosphomonoesterase that detoxifies toxins in aquatic animals [65]. Modulation of the immune system is one of the most common benefits of probiotics supplementation in aquatic animals [66,67,68]. Wu et al. reported that dietary administration of Clostridium autoethanogenum increased ACP and AKP activities in abalone (Haliotis discus hannai) [59]. Dietary supplementation with Bacillus stratosphericus A3440 improved serum ACP and AKP activities in H. diversicolor [66]. Similar results were found in our study. Dietary supplementation of RP significantly increased the activities of AKP and ACP of B. areolata. Therefore, the immunity enhancement effect of probiotic RP in B. areolata has been demonstrated.
Apoptosis is considered to be an important part of the defence system of aquatic animals [69]. Regarding apoptotic mechanisms, oxidative/nitrosative modification of cytochrome c (CYC) is a key biological process that activates the caspase pathway during apoptosis in many cells [69,70]. In this study, CYC and ACP expression levels were significantly up-regulated compared to the R0 group. The up-regulation of immune and apoptosis-related genes expression by feed-added probiotics has been demonstrated in several aquatic animals, such as H. discus hannai [71], Sea cucumber (Apostichopus japonicuslarge) [72], and Manila clam (Ruditapes philippinarum) [73]. Cadangin et al. reported dietary administration of probiotic Bacillus sp. KRF-7 up-regulated the levels of immune-related genes (NF-kB, TNF-α, and β-defensin) in hepatopancreas of H. discus hannai [71]. In the present study, the transcriptional response of the studied genes was consistent with the response of hepatopancreatic immune parameters. Increased expression levels of ACP and CYC genes in organs of B. areolata supplemented with RP were observed in this study. Stress tests with V. parahaemolyticus revealed that the addition of RP increased the survival rate of B. areolata, which demonstrates that RP influences the immune system against bacterial challenge. These results also suggest that RP can enhance the immune response of the host. The cell wall components of probiotics contain peptidoglycans, lipopolysaccharides, phospholipid wall acids and glucans, which act as immunostimulants that bind to pattern recognition proteins of the host to form complexes. The formation of these complexes activates the immune response, leading to the up-regulation of immune genes and thereby improving immune function [74].
A diet supplemented with Lactiplantibacillus plantarum E2 [20], Bacillus amyloliquefaciens COFCAU_P1 [75], Bacillus amyloliquefaciens, and Lactococcus lactis [76] was shown to enhance the survival of aquatic animals after bacterial challenge. In this study, dietary RP supplementation significantly increased the survival of B. areolata challenged against V. parahaemolyticus. Probiotics can activate the host’s immune system, maximizing its defensive capabilities. Therefore, when a pathogen invades, the host can elicit an immediate defence to clear the pathogen [74]. Thus, RP has a positive preventive effect on B. areolata against V. parahaemolyticus infection. RP has been used as an additive in shellfish farming to improve immunity and survival under the V. parahaemolyticus challenge.

5. Conclusions

According to this study, eight weeks of dietary supplementation of B. areolata significantly improved growth performance, digestive enzyme activity, immune response, and disease resistance. B. areolata fed with 20 g/kg of R. palustris increases muscle crude protein content. Supplementing R. palustris preparation increases tolerance to V. parahaemolyticus and leads to a higher survival rate. Our study demonstrated the optimal dosage of dietary R. palustris for B. areolata between 12.11 and 16.67 g/kg according to the analysis of a regression curve. These results indicate that R. palustris has potential application as a probiotic in aquaculture.

Author Contributions

Conceptualization, X.W., H.-M.W. and J.-A.X.; Methodology, Y.-P.L., Z.-L.Z. and H.-M.W.; Software, X.W., Y.-P.L., Z.-L.Z. and J.-T.L.; Validation, P.-H.Z.; Investigation, X.W., Y.-P.L., P.-H.Z., J.-T.L. and J.-J.L.; Data curation, X.W., Y.-P.L., Z.-L.Z., P.-H.Z. and X.-X.Z.; Writing—original draft, X.W. and Y.-P.L.; Writing—review and editing, H.-M.W. and J.-A.X.; Visualization, X.W., Y.-P.L. and Z.-L.Z.; Supervision, H.-M.W. and J.-A.X.; Funding acquisition, J.-A.X. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by Central Public-Interest Scientific Institution Basal Research Fund for Chinese Academy of Tropical Agricultural Sciences (No. 1630052024007), Science and Technology Special Fund of Hainan Province (No. ZDYF2022XDNY351), and Chinese Academy of Tropical Agricultural Sciences for Science and Technology Innovation Team of National Tropical Agricultural Science Center (No. CATASCXTD202416).

Institutional Review Board Statement

The procedures and protocols for this study have been ethically reviewed and approved according to the guidelines of the relevant institutional committees (Application for Animal Welfare and Ethical Review of ITBB) and granted an Aquaculture Research Permit (ITBB20230306).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. The State of World Fisheries and Aquaculture; FAO: Rome, Italy, 2022. [Google Scholar]
  2. Zheng, H.; Ke, C.; Zhou, S.; Li, F. Effects of starvation on larval growth, survival and metamorphosis of Ivory shell Babylonia formosae habei Altena et al., 1981 (Neogastropoda: Buccinidae). Aquaculture 2005, 243, 357–366. [Google Scholar] [CrossRef]
  3. Kritsanapuntu, S.; Chaitanawisuti, N.; Santhaweesuk, W.; Natsukari, Y. Growth, production and economic evaluation of earthen ponds formonoculture and polyculture of juveniles spotted babylon (Babylonia areolata) to marketable sizes using large-scale operation. J. Shellfish Res. 2006, 25, 913–918. [Google Scholar] [CrossRef]
  4. Lü, W.; Zhong, M.; Fu, J.; Ke, S.; Gan, B.; Zhou, Y.; Shen, M.; Ke, C. Comparison and optimal prediction of goptimal prediction of growth of Babylonia areolata and B. lutosa. Aquacult. Rep. 2020, 18, 100425. [Google Scholar] [CrossRef]
  5. Zhao, W.; Huang, X.; Deng, Z.; Yang, R.; Fang, W.; Wen, W.; Zheng, Z.; Yu, G. Growth performance, digestive and immune enzyme activities, and the environmental effects of the ivory shell, Babylonia areolata (Link 1807) in integrated Multi-Trophic aquaculture systems. Aquacult. Res. 2022, 53, 4168–4177. [Google Scholar] [CrossRef]
  6. Noordin, W.N.; Taha, M.S.; Rahim, M.A.; Huda, N. Meat yield and biochemical composition of hatchery reared spotted babylon, Babylonia areolata (Link 1807). Asian Fish. Sci. 2014, 27, 61–74. [Google Scholar] [CrossRef]
  7. Mai, M.D.; Nguyen, Q.N.; Tran, B.T.T.; Vu, B.D.T. Growth performance of Babylon snails (Babylonia areolata Link, 1807) fed formulated diet in ponds and recirculating aquaculture system. Agric. For. Fish. 2022, 11, 180–185. [Google Scholar] [CrossRef]
  8. CSY. China Statistical Yearbook; China Statistical Publishing House: Beijing, China, 2021; p. 27. [Google Scholar]
  9. Dobson, G.T.; Duy, N.D.Q.; Paul, N.A.; Southgate, P.C. Assessing potential for integrating sea grape (Caulerpa lentillifera) culture with sandfish (Holothuria scabra) and Babylon snail (Babylonia areolata) co-culture. Aquaculture 2020, 522, 735153. [Google Scholar] [CrossRef]
  10. Zhao, W.; Han, Q.; Yang, R.; Wen, W.; Deng, Z.; Li, H.; Zheng, Z.; Ma, Z.; Yu, G. Exposure to cadmium induced gut antibiotic resistance genes (ARGs) and microbiota alternations of Babylonia areolata. Sci. Total Environ. 2023, 865, 161243. [Google Scholar] [CrossRef]
  11. Wang, R.; Liu, X.; Wang, J.; Huizhu; Lin, X.; Sun, J.; Mou, H.; Zhang, T.; Ma, X. Proteomic differences between Vibrio tubiashii strains with high- or low-virulence levels isolated from diseased ivory snail Babylonia areolata. Aquacult. Int. 2022, 30, 2579–2591. [Google Scholar] [CrossRef]
  12. Tan, X.; Sun, Z.; Chen, S.; Chen, S.; Huang, Z.; Zhou, C.; Zou, C.; Liu, Q.; Ye, H.; Lin, H.; et al. Effects of dietary dandelion extracts on growth performance, body composition, plasma biochemical parameters, immune responses and disease resistance of juvenile golden pompano Trachinotus ovatus. Fish Shellfish Immunol. 2017, 66, 198–206. [Google Scholar] [CrossRef]
  13. Assane, I.M.; Gozi, K.S.; Valladão, G.M.R.; Pilarski, F. Combination of antimicrobials as an approach to reduce their application in aquaculture: Emphasis on the use of thiamphenicol/florfenicol against Aeromonas hydrophila. Aquaculture 2019, 507, 238–245. [Google Scholar] [CrossRef]
  14. Liu, X.; Lu, S.; Meng, W.; Zheng, B. Residues and health risk assessment of typical antibiotics in aquatic products from the Dongting Lake, China—“Did you eat “Antibiotics” today?”. Environ. Sci. Pollut. Res. 2018, 25, 3913–3921. [Google Scholar] [CrossRef]
  15. Shao, Y.; Wang, Y.; Yuan, Y.; Xie, Y. A systematic review on antibiotics misuse in livestock and aquaculture and regulation implications in China. Sci. Total Environ. 2021, 798, 149205. [Google Scholar] [CrossRef]
  16. Livingstone, D.R. The fate of organic xenobiotics in aquatic ecosystems: Quantitative and qualitative differences in biotransformation by invertebrates and fish. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 1998, 120, 43–49. [Google Scholar] [CrossRef]
  17. Kumar, S.; Verma, A.K.; Singh, S.P.; Awasthi, A. Immunostimulants for shrimp aquaculture: Paving pathway towards shrimp sustainability. Environ. Sci. Pollut. Res. 2023, 30, 25325–25343. [Google Scholar] [CrossRef]
  18. Prabawati, E.; Hu, S.Y.; Chiu, S.T.; Balantyne, R.; Risjani, Y.; Liu, C.H. A synbiotic containing prebiotic prepared from a by-product of king oyster mushroom, Pleurotus eryngii and probiotic, Lactobacillus plantarum incorporated in diet to improve the growth performance and health status of white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2022, 120, 155–165. [Google Scholar] [CrossRef]
  19. Cheng, A.C.; Peng, X.F.; Chen, W.Z.; Tseng, D.Y.; Tan, Z.G.; Liu, H.J.; Qin, Z.H.; Ballantyne, R.; Liu, C.H. Dietary probiotic Aspergillus niger preparation improves the growth performance, health status, and gut microbiota of white shrimp, Penaeus vannamei. Aquaculture 2023, 577, 739988. [Google Scholar] [CrossRef]
  20. Liu, R.; Wang, S.; Huang, D.; Huang, Y.; He, T.; Chen, X. The probiotic roles of Lactiplantibacillus plantarum E2 as a dietary supplement in growth promotion and disease resistance of juvenile large yellow croaker (Larimichthys crocea). Aquaculture 2024, 578, 740082. [Google Scholar] [CrossRef]
  21. Chauhan, A.; Singh, R. Probiotics in aquaculture: A promising emerging alternative approach. Symbiosis 2019, 77, 99–113. [Google Scholar] [CrossRef]
  22. Murni, K.; Wenjing, Z.; David, R.; David, N.; Marta, G.C. Probiotic strains for shellfish aquaculture: Protection of Eastern oyster, Crassostrea virginica, larvae and juveniles againsl bacterial challenge. J. Shellfish Res. 2013, 32, 401–408. [Google Scholar] [CrossRef]
  23. Hesser, J.; Mueller, R.S.; Langdon, C.; Schubiger, C.B. Immunomodulatory effects of a probiotic combination treatment to improve the survival of Pacific oyster (Crassostrea gigas) larvae against infection by Vibrio coralliilyticus. Front. Immunol. 2024, 15, 1–12. [Google Scholar] [CrossRef]
  24. Arunachalam, K.; Gill, H.S.; Chandra, R.K. Enhancement of natural immune function by dietary consumption of Bifidobacterium lactis (HN019). Eur. J. Clin. Nutr. 2000, 54, 263–267. [Google Scholar] [CrossRef] [PubMed]
  25. Xiaolong, G.; Caihuan, K.; Fucun, W.; Xian, L.; Ying, L. Effects of Bacillus lincheniformis feeding frequency on the growth, digestion and immunity of Haliotis discus hannai. Fish Shellfish Immunol. 2020, 96, 1–12. [Google Scholar] [CrossRef]
  26. Iehata, S.; Nakano, M.; Tanaka, R.; Maeda, H. Modulation of gut microbiota associated with abalone Haliotis gigantea by dietary administration of host-derived Pediococcus sp. Ab1. Fish. Sci. 2014, 80, 323–331. [Google Scholar] [CrossRef]
  27. Kobayashi, M. Massculture and cell utilization of photosynthetic bacteria. Process Biochem. 1978, 13, 27–30. [Google Scholar]
  28. Saejung, C.; Chaiyarat, A.; Sanoamuang, L.O. Optimization of three anoxygenic photosynthetic bacteria as feed to enhance growth, survival, and water quality in fairy shrimp (Streptocephalus sirindhornae) cultivation. Aquaculture 2021, 534, 736288. [Google Scholar] [CrossRef]
  29. George, D.M.; Vincent, A.S.; Mackey, H.R. An overview of anoxygenic phototrophic bacteria and their applications in environmental biotechnology for sustainable resource recovery. Biotechnol. Rep. 2020, 28, e00563. [Google Scholar] [CrossRef] [PubMed]
  30. Liu, R.; Wu, W.; Xu, X.; Wang, Y.; Yu, T.; Wang, J.; Zheng, Q.; Changru, X.; Wu, P. Rhodopseudomonas palustris in effluent enhances the disease resistance, TOR and NF-κB signalling pathway, intestinal microbiota and aquaculture water quality of Pelteobagrus vachelli. Aquacult. Res. 2020, 51, 3959–3971. [Google Scholar] [CrossRef]
  31. Wu, L.; Wang, Y.; Wang, H.; Liang, P.; Qin, Z.; Lai, M.; Lin, J.; Shao, J.; Zhang, D. Integrative unveiling of optimum dietary protein requirement for Siniperca scherzeri: Growth performance, feed utilization, serum biochemical and immune parameters and hepatic health maintenance. Aquaculture 2025, 598, 742004. [Google Scholar] [CrossRef]
  32. AOAC. Official Methods of Analysis, 13th ed.; Association of Analytical Chemists: Washington, DC, USA, 2012; p. 1018. [Google Scholar]
  33. Lin, Y.J.; Yang, S.Z.; Wang, X.H.; Xie, R.Y.; Cheng, J.; He, T.L.; Chen, X.H.; Zhang, X.Y. A synthetic peptide based on large yellow croaker (Larimichthys crocea) IFNG1R protein sequence has potential antimicrobial activity against Pseudomonas plecoglossicida. Front. Mar. Sci. 2022, 9, 1038013. [Google Scholar] [CrossRef]
  34. Rodger, H.D. Fish disease causing economic impact in global aquaculture. In Fish Vaccines; Adams, A., Ed.; Springer: Basel, Switzerland, 2016; pp. 1–34. [Google Scholar]
  35. Jiang, Y.H.; Yang, R.S.; Lin, Y.C.; Xin, W.G.; Zhou, H.Y.; Wang, F.; Zhang, Q.L.; Lin, L.B. Assessment of the safety and probiotic characteristics of Lactobacillus salivarius CGMCC20700 based on whole-genome sequencing and phenotypic analysis. Front. Microbiol. 2023, 14, 1120263. [Google Scholar] [CrossRef] [PubMed]
  36. Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z.G. Probiotics as means of diseases control in aquaculture, a review of current knowledge and future perspectives. Front. Microbiol. 2018, 9, 2429. [Google Scholar] [CrossRef] [PubMed]
  37. Jamal, M.T.; Abdulrahman, I.A.; Harbi, M.A.; Chithambaran, S. Probiotics as alternative control measures in shrimp aquaculture: A review. J. Appl. Biol. Biotechnol. 2019, 7, 69–77. [Google Scholar] [CrossRef]
  38. Saejung, C.; Chaiyarat, A.; Sanoamuang, L.O. Effects of algae, yeast and photosynthetic bacteria diets on survival and growth performance in the fairy shrimp, Streptocephalus sirindhornae (Branchiopoda, Anostraca). Crustaceana 2018, 91, 1505–1522. [Google Scholar] [CrossRef]
  39. Barba, E.; Melgar, C.; Hernández, C.; Alvarez, A. Efecto de microorganismos con potencial probiótico en la calidad del agua y el crecimiento de camarón Litopenaeus vannamei (Decapoda: Penaeidae) en cultivo intensivo. Rev. Biol. Trop. 2012, 61, 1215–1228. [Google Scholar]
  40. Sagada, G.; Chen, J.; Shen, B.; Huang, A.; Sun, L.; Jiang, J.; Jin, C. Optimizing protein and lipid levels in practical diet for juvenile northern snakehead fish (Channa argus). Anim. Nutr. 2017, 3, 156–163. [Google Scholar] [CrossRef]
  41. Meng, Y.; Qian, K.; Ma, R.; Liu, X.; Han, B.; Wu, J.; Zhang, L.; Zhan, T.; Hu, X.; Tian, H.; et al. Effects of dietary lipid levels on sub-adult triploid rainbow trout (Oncorhynchus mykiss): 1. Growth performance, digestive ability, health status and expression of growth-related genes. Aquaculture 2019, 513, 734394. [Google Scholar] [CrossRef]
  42. Yanbo, W.; Zirong, X. Effect of probiotics for common carp (Cyprinus carpio) based on growth performance and digestive enzyme activities. Anim. Feed Sci. Technol. 2006, 127, 283–292. [Google Scholar] [CrossRef]
  43. MacFarlane, G.T.; Cummings, J.H. The colonic flora, fermentation and large bowel digestive function. In The Large Intestine: Physiology, Pathophysiology and Disease; Phillips, S.F., Pemberton, J.H., Shorter, R.G., Eds.; Mayo Clinic: Rochester, MM, USA, 1991. [Google Scholar]
  44. Son, V.M.; Chang, C.C.; Wu, M.C.; Guu, Y.K.; Chiu, C.H.; Cheng, W. Dietary administration of the probiotic, Lactobacillus plantarum, enhanced the growth, innate immune responses, and disease resistance of the grouper Epinephelus coioides. Fish Shellfish Immunol. 2009, 26, 691–698. [Google Scholar] [CrossRef] [PubMed]
  45. Suzer, C.; Çoban, D.; Kamaci, H.O.; Saka, Ş.; Firat, K.; Otgucuoğlu, Ö.; Küçüksari, H. Lactobacillus spp. bacteria as probiotics in gilthead sea bream (Sparus aurata, L.) larvae: Effects on growth performance and digestive enzyme activities. Aquaculture 2008, 280, 140–145. [Google Scholar] [CrossRef]
  46. Bolasina, S.; Pérez, A.; Yamashita, Y. Digestive enzymes activity during ontogenetic development and effect of starvation in Japanese flounder, Paralichthys olivaceus. Aquaculture 2006, 252, 503–515. [Google Scholar] [CrossRef]
  47. Martínez-Álvarez, R.M.; Morales, A.E.; Sanz, A. Antioxidant defenses in fish: Biotic and abiotic factors. Rev. Fish Biol. Fish. 2005, 15, 75–88. [Google Scholar] [CrossRef]
  48. Li, X.; Sun, J.; Wang, L.; Song, K.; Lu, K.; Zhang, L.; Ma, X.; Zhang, C. Effects of dietary vitamin E levels on growth, antioxidant capacity and immune response of spotted seabass (Lateolabrax maculatus) reared at different water temperatures. Aquaculture 2023, 565, 739141. [Google Scholar] [CrossRef]
  49. Oakes, K.D.; Van Der Kraak, G.J. Utility of the TBARS assay in detecting oxidative stress in white sucker (Catostomus commersoni) populations exposed to pulp mill effluent. Aquat. Toxicol. 2003, 63, 447–463. [Google Scholar] [CrossRef] [PubMed]
  50. Eissa, M.E.H.; Alaryani, F.S.; Elbahnaswy, S.; Khattab, M.S.; Elfeky, A.; AbouelFadl, K.Y.; Eissa, E.-S.H.; Ahmed, R.A.; Van Doan, H.; El-Haroun, E. Dietary inclusion of Pediococcus acidilactici probiotic promoted the growth indices, hemato-biochemical indices, enzymatic profile, intestinal and liver histomorphology, and resistance of Nile Tilapia against Aspergillus flavus. Anim. Feed Sci. Technol. 2023, 306, 115814. [Google Scholar] [CrossRef]
  51. He, X.; Abakari, G.; Tan, H.; Liu, W.; Luo, G. Effects of different probiotics (Bacillus subtilis) addition strategies on a culture of Litopenaeus vannamei in biofloc technology (BFT) aquaculture system. Aquaculture 2023, 566, 739216. [Google Scholar] [CrossRef]
  52. Amoah, K.; Huang, Q.C.; Tan, B.P.; Zhang, S.; Chi, S.Y.; Yang, Q.H.; Liu, H.Y.; Dong, X.H. Dietary supplementation of probiotic Bacillus coagulans ATCC 7050, improves the growth performance, intestinal morphology, microflora, immune response, and disease confrontation of Pacific white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 2019, 87, 796–808. [Google Scholar] [CrossRef]
  53. Mansour, A.T.; Ashour, M.; Abbas, E.M.; Alsaqufi, A.S.; Kelany, M.S.; El-Sawy, M.A.; Sharawy, Z.Z. Growth performance, immune-related and antioxidant genes expression, and gut bacterial abundance of Pacific white leg shrimp, Litopenaeus vannamei, dietary supplemented with natural astaxanthin. Front. Physiol. 2022, 13, 874172. [Google Scholar] [CrossRef]
  54. Yu, Q.; Fu, Z.; Huang, M.; Xu, C.; Wang, X.; Qin, J.G.; Chen, L.; Han, F.; Li, E. Growth, physiological, biochemical, and molecular responses of Pacific white shrimp Litopenaeus vannamei fed different levels of dietary selenium. Aquaculture 2021, 535, 736393. [Google Scholar] [CrossRef]
  55. Han, J.; Lu, Y.; Zheng, H.; Liu, H.; Deng, H.; Zhang, B. Differential expression of CuZnSOD gene under low temperature stress in noble scallop Chlamys nobilis with different carotenoid content. Fish Shellfish Immunol. 2016, 54, 30–39. [Google Scholar] [CrossRef]
  56. Morohoshi, T.; Ebata, A.; Nakazawa, S.; Kato, N.; Ikeda, T. N-acyl homoserine lactone-producing or degrading bacteria isolated from the intestinal microbial flora of ayu fish (Plecoglossus altivelis). Microbes Environ. 2005, 20, 264–268. [Google Scholar] [CrossRef]
  57. Duan, Y.; Liu, P.; Li, J.; Wang, Y.; Li, J.; Chen, P. Molecular responses of calreticulin gene to Vibrio anguillarum and WSSV challenge in the ridgetail white prawn Exopalaemon carinicauda. Fish Shellfish Immunol. 2014, 36, 164–171. [Google Scholar] [CrossRef] [PubMed]
  58. Zhang, Q.; Li, F.; Zhang, X.; Dong, B.; Zhang, J.; Xie, Y.; Xiang, J. cDNA cloning, characterization and expression analysis of the antioxidant enzyme gene, catalase, of Chinese shrimp Fenneropenaeus chinensis. Fish Shellfish Immunol. 2008, 24, 584–591. [Google Scholar] [CrossRef] [PubMed]
  59. Wu, Z.; Yu, X.; Chen, P.; Pan, M.; Liu, J.; Sahandi, J.; Zhou, W.; Mai, K.; Zhang, W. Dietary Clostridium autoethanogenum protein has dose-dependent influence on the gut microbiota, immunity, inflammation and disease resistance of abalone Haliotis discus hannai. Fish Shellfish Immunol. 2024, 151, 109737. [Google Scholar] [CrossRef] [PubMed]
  60. Tang, X.; Wang, T.; Yang, Q.; Zheng, S.; Ma, S.; Yao, W.; Li, Y.; Wu, Z. Potential benefits of Bacillus subtilis-mediated bioflocs in supplementary feeding on triangle sail mussels Hyriopsis cumingii: A pilot study of fluorescence-labeled floc-forming bacteria. Aquacult. Rep. 2024, 34, 101904. [Google Scholar] [CrossRef]
  61. Tarnecki, A.M.; Burgos, F. Shellfish Microbiome and Probiotics: A Decade in Review. In Microbiome of Finfish and Shellfish; Diwan, A., Harke, S.N., Panche, A., Eds.; Springer Nature: Singapore, 2023; pp. 225–254. [Google Scholar] [CrossRef]
  62. Suzuki, T.; Mori, K. Hemolymph lectin of the pearl oyster, Pinctada fucata martensii: A possible non-self recognition system. Dev. Comp. Immunol. 1990, 14, 161–173. [Google Scholar] [CrossRef]
  63. Yang, C.; Du, X.; Hao, R.; Wang, Q.; Deng, Y.; Sun, R. Effect of vitamin D3 on immunity and antioxidant capacity of pearl oyster Pinctada fucata martensii after transplantation: Insights from LC–MS-based metabolomics analysis. Fish Shellfish Immunol. 2019, 94, 271–279. [Google Scholar] [CrossRef]
  64. Yang, C.; Hao, R.; Deng, Y.; Liao, Y.; Wang, Q.; Sun, R.; Jiao, Y.; Du, X. Effects of protein sources on growth, immunity and antioxidant capacity of juvenile pearl oyster Pinctada fucata martensii. Fish Shellfish Immunol. 2017, 67, 411–418. [Google Scholar] [CrossRef]
  65. Rajalakshmi, S.; Mohandas, A. Copper-induced changes in tissue enzyme activity in a freshwater mussel. Ecotoxicol. Environ. Saf. 2005, 62, 140–143. [Google Scholar] [CrossRef] [PubMed]
  66. Zhao, J.; Ling, Y.; Zhang, R.; Ke, C.; Hong, G. Effects of dietary supplementation of probiotics on growth, immune responses, and gut microbiome of the abalone Haliotis diversicolor. Aquaculture 2018, 493, 289–295. [Google Scholar] [CrossRef]
  67. Grandiosa, R.; Mérien, F.; Young, T.; Van Nguyen, T.; Gutierrez, N.; Kitundu, E.; Alfaro, A.C. Multi-strain probiotics enhance immune responsiveness and alters metabolic profiles in the New Zealand black-footed abalone (Haliotis iris). Fish Shellfish Immunol. 2018, 82, 330–338. [Google Scholar] [CrossRef]
  68. Jiang, H.F.; Liu, X.L.; Chang, Y.Q.; Liu, M.T.; Wang, G.X. Effects of dietary supplementation of probiotic Shewanella colwelliana WA64, Shewanella olleyana WA65 on the innate immunity and disease resistance of abalone, Haliotis discus hannai Ino. Fish Shellfish Immunol. 2013, 35, 86–91. [Google Scholar] [CrossRef] [PubMed]
  69. Li, Y.; Zhang, L.; Qu, T.; Tang, X.; Li, L.; Zhang, G. Conservation and divergence of mitochondrial apoptosis pathway in the Pacific oyster, Crassostrea gigas. Cell Death Dis. 2017, 8, e2915. [Google Scholar] [CrossRef] [PubMed]
  70. Achard-Joris, M.; Gonzalez, P.; Marie, V.; Baudrimont, M.; Bourdineaud, J.-P. Cytochrome c oxydase subunit I gene is up-regulated by cadmium in freshwater and marine bivalves. Biometals 2006, 19, 237–244. [Google Scholar] [CrossRef]
  71. Cadangin, J.; Lee, J.H.; Jeon, C.Y.; Lee, E.S.; Moon, J.S.; Park, S.J.; Hur, S.W.; Jang, W.J.; Choi, Y.H. Effects of dietary supplementation of Bacillus, β-glucooligosaccharide and their synbiotic on the growth, digestion, immunity, and gut microbiota profile of abalone, Haliotis discus hannai. Aquacult. Rep. 2024, 35, 102027. [Google Scholar] [CrossRef]
  72. Feng, Z.; Song, X.; Zhao, L.; Zhu, W. Isolation of probiotics and their effects on growth, antioxidant and non-specific immunity of sea cucumber Apostichopus japonicus. Fish Shellfish Immunol. 2020, 106, 1087–1094. [Google Scholar] [CrossRef]
  73. Liu, L.; Zhuang, H.; Tian, X.; Zhou, Y.; Wang, F.; Liu, Z.; Li, J.; Jiao, M.; Xue, S.; Li, J.; et al. Understanding the probiotic potential of Lactobacillus plantarum: Antioxidant capacity, non-specific immunity and intestinal microbiota improvement effects on Manila clam Ruditapes philippinarum. Fish Shellfish Immunol. 2024, 154, 109971. [Google Scholar] [CrossRef]
  74. Goh, J.X.H.; Tan, L.T.H.; Law, J.W.F.; Khaw, K.Y.; Zengin, G.; Chan, K.G.; Letchumanan, V.; Lee, L.H.; Goh, B.H. Probiotics: Comprehensive exploration of the growth promotion mechanisms in shrimps. Prog. Microbes Mol. Biol. 2023, 6, a0000324. [Google Scholar] [CrossRef]
  75. Khan, M.I.R.; Kamilya, D.; Choudhury, T.G.; Rathore, G. Dietary administration of a host-gut derived probiotic Bacillus amyloliquefaciens COFCAU_P1 modulates immune-biochemical response, immune-related gene expression, and resistance of Labeo rohita to Aeromonas hydrophila infection. Aquaculture 2022, 546, 737390. [Google Scholar] [CrossRef]
  76. Zhu, L.; Kong, Y.; Chang, X.; Feng, J.; Wang, X.; Hou, L.; Zhao, X.; Pei, C.; Kong, X. Effects of two fish-derived probiotics on growth performance, innate immune response, intestinal health, and disease resistance of Procambarus clarkii. Aquaculture 2023, 562, 738765. [Google Scholar] [CrossRef]
Figure 1. The effects of diets supplemented with various levels of RP for 8 weeks on the digestive enzyme activities of B. areolata, including trypsin (A), lipase (B), and α-amylase (C). Values that do not share a common superscript are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Figure 1. The effects of diets supplemented with various levels of RP for 8 weeks on the digestive enzyme activities of B. areolata, including trypsin (A), lipase (B), and α-amylase (C). Values that do not share a common superscript are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Fishes 09 00522 g001
Figure 2. Hepatopancreas oxidative stress biomarkers, including SOD (A), CAT (B), T-AOC (C), and MDA (D) of B. areolata-fed diets supplemented with various levels of RP for 8 weeks. Values that do not share a common superscript are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Figure 2. Hepatopancreas oxidative stress biomarkers, including SOD (A), CAT (B), T-AOC (C), and MDA (D) of B. areolata-fed diets supplemented with various levels of RP for 8 weeks. Values that do not share a common superscript are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Fishes 09 00522 g002
Figure 3. Hepatopancreas immunological parameters, including ACP (A) and AKP (B) of B. areolata fed diets supplemented with various levels of RP for 8 weeks. Values that do not share a common letter are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Figure 3. Hepatopancreas immunological parameters, including ACP (A) and AKP (B) of B. areolata fed diets supplemented with various levels of RP for 8 weeks. Values that do not share a common letter are significantly different (p < 0.05). Levene’s test/Shapiro–Wilk test: the homogeneity of variance and normality for data. Linear/quadratic/cubic: orthogonal polynomial contrasts.
Fishes 09 00522 g003
Figure 4. The effects of diets supplemented with various concentration levels of RP for 8 weeks on the relative expression levels of antioxidant-related genes in the hepatopancreas of B. areolata. The different letters above each bar denote the significant difference between treatments (p < 0.05).
Figure 4. The effects of diets supplemented with various concentration levels of RP for 8 weeks on the relative expression levels of antioxidant-related genes in the hepatopancreas of B. areolata. The different letters above each bar denote the significant difference between treatments (p < 0.05).
Fishes 09 00522 g004
Figure 5. The effects of 8 weeks of dietary supplementation with various concentration levels of RP on the relative expression levels of immune-related genes in the hepatopancreas of B. areolata. The different letters above each bar denote the significant differences between treatments (p < 0.05).
Figure 5. The effects of 8 weeks of dietary supplementation with various concentration levels of RP on the relative expression levels of immune-related genes in the hepatopancreas of B. areolata. The different letters above each bar denote the significant differences between treatments (p < 0.05).
Fishes 09 00522 g005
Figure 6. The effects of dietary RP concentration levels on the survival after V. parahaemolyticus infection of B. areolata at 96 h. Values that do not share a common letter are significantly different (p < 0.05).
Figure 6. The effects of dietary RP concentration levels on the survival after V. parahaemolyticus infection of B. areolata at 96 h. Values that do not share a common letter are significantly different (p < 0.05).
Fishes 09 00522 g006
Figure 7. The analytical results of regression curve for some representative and significant parameters. (A): The regression analysis between WGR and dietary RP level; (B): The regression analysis between SGR and dietary RP level; (C): The regression analysis between T-AOC and dietary RP level; (D): The regression analysis between CAT and dietary RP level; (E): The regression analysis between ACP and dietary RP level; (F): The regression analysis between trypsin and dietary RP level. Values that do not share a common letter are significantly different (p < 0.05).
Figure 7. The analytical results of regression curve for some representative and significant parameters. (A): The regression analysis between WGR and dietary RP level; (B): The regression analysis between SGR and dietary RP level; (C): The regression analysis between T-AOC and dietary RP level; (D): The regression analysis between CAT and dietary RP level; (E): The regression analysis between ACP and dietary RP level; (F): The regression analysis between trypsin and dietary RP level. Values that do not share a common letter are significantly different (p < 0.05).
Fishes 09 00522 g007
Table 1. Composition and nutrient level of the base diet.
Table 1. Composition and nutrient level of the base diet.
IngredientsContent (%)Nutrient LevelsContent (%)
Fish Meal46.0Crude protein42.86
Soybean meal24.0Crude lipid13.34
α-Starch24.1Ash9.84
Vitamin premix a0.4Moisture8.22
Mineral premix b1.0
Fish oil3.0
Monocalcium phosphate1.5
a Vitamin premix: 100 g premix contains vitamin A 200,000 IU, vitamin C 3000 mg vitamin D 20,000 IU, vitamin B1 15 mg, vitamin B2 300 mg, vitamin B6 200 mg, vitamin B12 0.3 mg, vitamin K 15 mg, folic acid 15 mg, biotin 0.75 mg, vitamin E 2000 IU, inositol 5000 mg, pantothenic acid 500 mg, niacin 1500 mg. b Mineral premix: 100 g premix contains ZnSO4·7H2O 1377.5 mg, Na2SeO3 13.5 mg, CuSO4·5H2O 416.5 mg, FeSO4·7H2O 4909.5 mg, MnSO4·H2O 728.5 mg, CoSO4·7H2O 5.9 mg, Ca(IO3)2·7H2O 5.9 mg.
Table 2. Primers used in the quantitative real-time PCR.
Table 2. Primers used in the quantitative real-time PCR.
PrimersSequence (5′–3′)Product Size (bp)
ACP-FCAACTTCACCAAGAACACGG87
ACP-RTGAGTGCTGTTGTGGATGGT
ferritin-FCAACGGTCACAACGATGCT90
ferritin-RTGGTCGCCGATTTCCTT
CYC-FGCAGGAAATGCCGAGAAG123
CYC-RAGTCTTGCGTCCAATCAGG
mucin-5AC-FCAACAGGTTCCTCATCTTCG163
mucin-5AC-RAAGGAGGATGCGGGAGA
CYP450-FAACCCTCGCCATTTATCG133
CYP450-RGTTGTCAGCAGCATCGGA
Cu/Zn-SOD-FGACACTTCAACCCCTTCGG108
Cu/Zn-SOD-RTCACTACAGCCTTGCCACTG
GST-FTCTTCTGGGGTTCTGGTAGC190
GST-RCCTGATTCATTGACAATGGTG
SOD-FAGCACGGAAGTCAAAGGAGA 118
SOD-RCAAACTGATGGATGTGGAAGC
β-actin-FCGTCCTTTGGTGACTCTGG184
β-actin-RTGGATGTGGTAGCCGTTTC
ACP: iron/zinc purple acid phosphatase-like protein; CYC: cytochrome c; CYP450: cytochrome P450 3A21-like; Cu/Zn-SOD: Cu/Zn-superoxide dismutase; GST: glutathione S-transferase A-like; SOD: superoxide dismutase.
Table 3. Growth performance of B. areolata fed with different RP supplements for 8 weeks.
Table 3. Growth performance of B. areolata fed with different RP supplements for 8 weeks.
Diets g/kgRP0RP1RP2RP3RP4Orthogonal Contrast a (p)p Value bp Value c
0151020LinearQuadraticCubic
IBW, g0.28 ± 0.01 a0.28 ± 0.01 a0.28 ± 0.01 a0.28 ± 0.02 a0.28 ± 0.01 a0.7760.9150.8890.6340.700
FBW, g0.95 ± 0.01 c1.05 ± 0.02 bc1.04 ± 0.05 b1.15 ± 0.04 a1.16 ± 0.04 a0.9080.4320.5660.0010.000
WGR, %243.97 ± 17.66 b270.76 ± 15.11 ab273.41 ± 13.01 ab318.80 ± 34.48 a318.67 ± 31.11 a0.0000.0030.0090.3210.479
SGR, %/d2.06 ± 0.08 b2.18 ± 0.07 ab2.20 ± 0.06 ab2.38 ± 0.13 a2.38 ± 0.13 a0.0000.0020.0060.4300.660
SR, %83.33 ± 3.82 a84.17 ± 6.29 a84.17 ± 1.44 a86.67 ± 6.29 a85.00 ± 5.00 a0.4800.7620.8790.4940.706
Means in the same row with different superscripts are significantly different (p < 0.05). IBW: initial body weight; FBW: final body weight; WGR: weight gain rate; SGR: specific growth rate; SR: survival. a If statistical significance (p < 0.05) was detected, the model that fit best with the data was selected. b p value: the p value of Levene’s test. c p value: the p value of the Shapiro–Wilk test.
Table 4. Effects of dietary RP levels on muscle proximate composition of B. areolata.
Table 4. Effects of dietary RP levels on muscle proximate composition of B. areolata.
Diets g/kgRP0RP1RP2RP3RP4Orthogonal Contrast a (p)p Value bp Value c
0151020LinearQuadraticCubic
Moisture %74.67 ± 1.12 a73.30 ± 0.35 a72.13 ± 0.92 a74.99 ± 1.81 a74.23 ± 0.82 a0.7220.2380.1540.1070.650
Crude protein %59.26 ± 1.93 b61.46 ± 2.50 ab61.61 ± 2.70 ab64.77 ± 1.35 ab64.97 ± 1.44 a0.0010.0060.0190.6580.294
Crude lipid %9.15 ± 0.33 a9.10 ± 0.71 a9.08 ± 1.05 a8.82 ± 0.65 a8.80 ± 0.98 a0.4500.0.7560.9050.6480.782
Ash %3.48 ± 0.28 b3.79 ± 0.30 ab3.87 ± 0.47 ab4.52 ± 0.16 a4.34 ± 0.19 a0.0010.0040.0090.1570.405
Means in the same row with different superscripts are significantly different (p < 0.05). a If statistical significance (p < 0.05) was detected, the model that fits best with the data was selected. b p value: the p value of Levene’s test. c p value: the p value of the Shapiro–Wilk test.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Wang, X.; Lu, Y.-P.; Zhang, Z.-L.; Zheng, P.-H.; Li, J.-T.; Zhang, X.-X.; Li, J.-J.; Wu, H.-M.; Xian, J.-A. Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes 2024, 9, 522. https://doi.org/10.3390/fishes9120522

AMA Style

Wang X, Lu Y-P, Zhang Z-L, Zheng P-H, Li J-T, Zhang X-X, Li J-J, Wu H-M, Xian J-A. Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes. 2024; 9(12):522. https://doi.org/10.3390/fishes9120522

Chicago/Turabian Style

Wang, Xiao, Yao-Peng Lu, Ze-Long Zhang, Pei-Hua Zheng, Jun-Tao Li, Xiu-Xia Zhang, Jia-Jun Li, Heng-Mei Wu, and Jian-An Xian. 2024. "Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata)" Fishes 9, no. 12: 522. https://doi.org/10.3390/fishes9120522

APA Style

Wang, X., Lu, Y.-P., Zhang, Z.-L., Zheng, P.-H., Li, J.-T., Zhang, X.-X., Li, J.-J., Wu, H.-M., & Xian, J.-A. (2024). Dietary Probiotic Rhodopseudomonas palustris Formulation Improves Growth Performance, Muscle Composition, Digestive Enzyme Activity, Non-Specific Immunity and Disease Resistance of Juvenile Ivory Shell (Babylonia areolata). Fishes, 9(12), 522. https://doi.org/10.3390/fishes9120522

Article Metrics

Back to TopTop