Next Article in Journal
Pathological Progress of Two Types of Nodules in Micropterus salmoides Infected with Nocardia seriolae
Next Article in Special Issue
Evaluation of Silymarin–L-Carnitine as a Dietary Supplement on Growth Performance, Antioxidants and Immunity, Gut/Liver Health, and Gene Expression in Nile Tilapia (Oreochromis niloticus)
Previous Article in Journal
Age- and Size- Based Reproductive Potential of Gray Snapper (Lutjanus griseus) in the Eastern Gulf of Mexico
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus)

by
Camilla Maria Fontana
1,
Md Afsar Ahmed Sumon
1,
Supreya Wannavijit
1,
Anisa Rilla Lubis
1,
Nuttapon Khongdee
2,
Nguyen Vu Linh
1,3,
Yuthana Phimolsiripol
4,
Seyed Hossein Hoseinifar
5 and
Hien Van Doan
1,3,*
1
Department of Animal and Aquatic Sciences, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
2
Department of Highland Agriculture and Natural Resources, Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
3
Functional Feed Innovation Center (FuncFeed), Faculty of Agriculture, Chiang Mai University, Chiang Mai 50200, Thailand
4
Faculty of Agro-Industry, Chiang Mai University, Chiang Mai 50100, Thailand
5
Department of Fisheries, Faculty of Fisheries and Environmental Sciences, Gorgan University of Agricultural Sciences and Natural Resources, Gorgan 49189-43464, Iran
*
Author to whom correspondence should be addressed.
Fishes 2024, 9(12), 514; https://doi.org/10.3390/fishes9120514
Submission received: 14 November 2024 / Revised: 6 December 2024 / Accepted: 12 December 2024 / Published: 16 December 2024

Abstract

This study explored the effects of mango seed (MS) powder supplementation on the growth, immune response, gene expression, and intestinal morphology of Nile tilapia (Oreochromis niloticus) over an 8-week period. A total of 300 Nile tilapia fingerlings (average weight of 15.29 ± 0.05 g) were divided into five treatment groups and fed either a basal diet or one of four experimental diets containing MS powder at concentrations of 10 (MS10), 20 (MS20), 40 (MS40), and 80 (MS80) g kg−1. The results demonstrated that Nile tilapia fed MS-supplemented diets experienced significant improvements (p < 0.05) in weight gain (WG), specific growth rate (SGR), and survival rate (SR) compared to the control group (0 g kg−1 MS). The MS-treated groups also showed a significant increase (p < 0.05) in the height and branching of intestinal villi along the entire length of the intestine, as well as a significantly higher villus-to-crypt depth ratio (V/C), indicating enhanced intestinal health and functionality. Moreover, although MS supplementation did not increase peroxidase activity, it did lead to a significant increase (p < 0.05) in the activity of skin mucus and serum lysozyme, along with upregulated gene expression of immune-related (IL-1, IL-8, and LBP) and antioxidant genes (GST-α, GPX, and GSR). Polynomial regression analysis identified an optimal MS dosage of 36.43–45 g kg−1 for effectively improving growth, immunity, and immuno-oxidant gene expression in Nile tilapia. These results emphasize mango seed (MS) as a promising natural supplement for improving the diet of Nile tilapia and, potentially, other freshwater fish widely used in aquaculture.
Key Contribution: This study highlights the potential of mango seed powder as a natural feed additive in aquaculture, demonstrating significant improvements in growth performance, immune response, intestinal morphology and gene expression of Nile tilapia. The findings provide valuable insights into the use of agricultural by-products to enhance fish health and support sustainable aquaculture practices.

Graphical Abstract

1. Introduction

Aquaculture is the fastest-growing sector in global food production [1,2], playing a vital role in feeding the world’s increasing population, improving health, reducing poverty, and generating employment and economic opportunities [3]. Nile tilapia (Oreochromis niloticus), one of the most farmed freshwater fish, is appreciated for its high nutritional content, which includes proteins, lipids, vitamins, and minerals [4]. Its popularity is further enhanced by its rapid growth, resilience, omnivorous diet, tolerance to low oxygen levels, and ease of farming [5]. However, the rising costs of fish feed and farming systems are becoming significant barriers to its expansion [1]. As global demand for seafood and fish increases, feed has become the most expensive component of aquaculture operations [6]. To address these challenges, aquaculture practices increasingly include the supplementation of animal feeds with plant-derived compounds to enhance the health and productivity of farmed species [1]. This has led to extensive research into natural feed additives, especially for species commonly farmed in aquaculture, such as fish and crustaceans [7]. Among these, agricultural by-products have shown great promise in improving growth performance and health [8]. Fruit by-products have demonstrated significant potential in enhancing fish growth and immunity [9]. Fruit seeds are especially rich in bioactive compounds such as flavonoids, phenols, fatty acids, saponins, sterols, tannins, and carotenoids, all of which are essential for promoting animal health [10].
Mango (Mangifera indica L.) is one of the world’s most widely grown and consumed tropical fruits, with significant producers including India, China, Thailand, and Mexico [11]. It is consumed in 85 countries, making it the world’s second most farmed tropical fruit, with a projected production of 59 million tons in 2022 [12]. Known for its sweet taste and aroma, mango is popular for producing juices, nectars, jams, jellies, and other products [13]. However, processing these foods to extract the pulp generates significant by-products, particularly the peel and seeds, which are often considered waste. The seeds alone make up 10% to 25% of the total fruit weight, with 45% to 85% of the seed composed of the core, depending on the variety [13]. Nutritionally, mango seeds are rich in dietary fiber, vitamins, fatty acids, minerals, and bioactive compounds [14]. These bioactive chemicals, which are secondary metabolites produced by plants in response to stress, work as protective agents because of their antioxidant, antibacterial, and antiviral capabilities [15]. Bioactive chemicals have long been linked to a variety of health advantages, including the prevention and treatment of chronic diseases [16]. Antioxidants have garnered attention for their potential to combat diseases such as cancer, due to their antioxidative effects [17]. Mango by-products from different varieties have been found to contain a range of bioactive compounds, including mangiferin, quercetin, kaempferol, and anthocyanins in the seeds [18], as well as tocopherols like β-carotene, β-cryptoxanthin, and lutein in the peel and paste [19]. Phenolic acids, such as gallic, ellagic, and vanillic acids, are also present in the peel and pulp [20], with gallic acid showing notable antioxidant, anti-inflammatory [21], and hypoglycemic properties [22].
Biofloc technology (BFT) is recognized as one of the most effective aquaculture systems for promoting sustainable development and maintaining a clean environment [23]. BFT systems offer multiple benefits, including enhanced biosecurity, improved feed conversion, better water quality, and more efficient land use [24]. One of the key advantages of BFT is its ability to increase protein utilization efficiency, which improves the feed conversion ratio (FCR) and promotes fish growth, even when dietary protein levels are reduced [25]. This makes BFT particularly suitable for species like tilapia and carps, as well as shrimps such as pink, brine, and Pacific white leg shrimp, which possess digestive systems adapted to efficiently utilize the microbial protein generated within the biofloc [23,26,27]. Although previous research has explored various natural feed additives, there is a lack of studies specifically investigating the use of mango seed powder in fish diets, particularly in Nile tilapia. This knowledge gap highlights the need for novel approaches to integrate agricultural by-products into BFT systems to enhance fish health and productivity [28]. The current study addresses this need by investigating the impact of mango seed powder as a dietary supplement on the growth, intestinal health, innate immunity, and gene expression of Nile tilapia cultured in a BFT system. This approach not only aligns with the principles of sustainable aquaculture, but also seeks to leverage the bioactive compounds found in mango seeds to enhance the overall resilience and well-being of the fish. By integrating agricultural by-products like mango seed powder into BFT systems, this study aims to evaluate the effects of mango seed (Mangifera indica) powder on the growth performance, immune response, gut morphology, and gene expression of Nile tilapia (Oreochromis niloticus).

2. Materials and Methods

2.1. Mango Seed Powder Production

Mature mango fruits were procured from a local market in Mueang Chiang Mai, Chiang Mai Province, Thailand. The fruits were peeled, and the pulp was removed to separate the seeds from the kernels. The seeds were then thoroughly washed under tap water to ensure cleanliness. Afterward, the cleaned seeds were chopped into small pieces and dried in a hot air oven at 60 °C for three days, reducing their moisture content to approximately 10%. The dried seeds were finely ground into mango seed (MS) powder and stored at 4 °C for future use. The composition and bioactive compound analysis of the mango seed powder were conducted at the Food Innovation and Packaging Center, Faculty of Agro-Industry, Chiang Mai University, with the results detailed in Table 1 and Table 2.

2.2. Dietary Treatments

The control diet was formulated following the protocols established in our previous study [31]. The inclusion levels of mango seed (MS) powder used in this study were based on the recommendations from a previous study [32]: 10 g kg−1 (MS10), 20 g kg−1 (MS20), 40 g kg−1 (MS40), and 80 g kg−1 (MS80). The detailed composition and ingredient proportions for these experimental diets are presented in Table 3. To prepare the feed, all ingredients were thoroughly mixed, and oil and distilled water were added to form a cohesive dough. The dough was extruded into pellets, which were subsequently dried at 60 °C to achieve a moisture content of 10% and then stored in sealed bags at 4 °C until use.

2.3. Proximate Analysis of Experimental Diets

The nutritional composition of each diet was analyzed using standardized procedures as described by the Association of Official Analytical Chemists (AOAC) [33]. The dry matter (DM) content was determined by oven-drying the samples at 105 °C for six hours (AOAC 2001.12). The nitrogen content was measured using the Kjeldahl digestion and titration method, and crude protein was calculated by multiplying the nitrogen content by 6.25 (AOAC 954.01). Ash content was assessed by incinerating the samples in a muffle furnace at 550 °C (AOAC 923.03). Fiber content was determined through the enzymatic–gravimetric method (AOAC 978.10). Lipid content was analyzed using the acid hydrolysis method, followed by Soxhlet extraction (AOAC 920.85). The gross energy (GE) was estimated using the formula 5.72 × CP + 9.50 × EE + 4.79 × CF + 4.17 × NFE, based on the analyzed concentrations (g/kg DM) of CP (crude protein), EE (ether extract), CF (crude fiber), and NFE (nitrogen-free extract) [34].

2.4. Biofloc (BF) Water Formation and Regulation

Three weeks prior to the experiment, tanks were prepared to cultivate biofloc (BF) as the inoculum source. To establish the biofloc water, each tank was supplemented with 2 g of fish feed, 400 g of salt, 5 g of dolomite, and 5 g of molasses (local market, Chiang Mai, Thailand). The carbon-to-nitrogen (C: N) ratio was maintained at 15:1 throughout the experiment by adding molasses (containing 40% carbon) as the carbon source, in accordance with protocols from a previous study [35]. Molasses were added once daily, two hours after feeding. The C: N ratio was calculated based on the residual nitrogen levels in each tank and the nitrogen contribution from the diet.
Water parameters, including temperature, pH, and dissolved oxygen, were monitored using the HI98196 m (Hanna Instruments, Strada Hanna NUSFALAU, Salaj, Romania). The observed values were 27.50 ± 0.55 °C for temperature, 7.97 ± 0.06 for pH, and 5.05 ± 0.04 mg L−1 for dissolved oxygen. To maintain floc levels below 10 mL per tank, molasses and probiotics (PondPlus, Bayer, Bayer AG, Leverkusen, Germany) were periodically added. Ammonia (NH3) concentrations were measured with an HI96733 m (Hanna Instruments, Romania) and controlled to remain below 0.10 mg L−1. To sustain optimal water quality, 5% of the water in each tank was replaced weekly with fresh, clean water.

2.5. Study Setup

Male Nile tilapia fingerlings were sourced from Chiang Mai Pattana Farm and acclimated on a commercial diet for 30 days, followed by a control diet for an additional two weeks. Before initiating the feeding trial, the health status of 20 fish was assessed by examining their external bodies, gills, and internal organs. A total of 300 fish, with an average weight of 15.29 ± 0.05 g, were evenly distributed into 15 aerated tanks (150 L capacity each) at a stocking density of 20 fish per tank. The experiment was conducted using a completely randomized design (CRD) with three replicates per treatment. During the eight-week trial, the fish were fed the experimental diets to apparent satiation twice daily, at 8:30 a.m. and 4:30 p.m.

2.6. Growth Performance

The growth performance and survival rate of Nile tilapia were determined using formulas outlined in a previous study [36].

2.7. Innate Immune Parameter Analyses

2.7.1. Skin Mucus and Serum Collection

Skin mucus samples were obtained from Nile tilapia (two fish per replication) using a modified method from [31]. In brief, three fish were randomly selected from each tank, anesthetized with clove oil, and gently massaged to extract mucus, which was transferred into sterile tubes using 10 mL of NaCl solution. The samples were centrifuged at 1500× g for 10 min at 4 °C, and 1 mL of supernatant was stored at −20 °C for later analysis. Blood serum was collected following the procedure outlined by Van Doan et al. [37].
A 1 mL blood sample was collected from the caudal vein using a syringe and transferred to 1.5 mL Eppendorf tubes (Eppendorf, Hamburg, Germany) without anticoagulant. After coagulating at room temperature for one hour, the samples were centrifuged at 1500× g for 5 min at 4 °C. The serum was then extracted with a micropipette, stored in Eppendorf tubes, and frozen at −80 °C for later analysis.

2.7.2. Lysozyme and Peroxidase Activities

Serum and mucus lysozyme levels were determined following the method of Parry Jr, Chandan and Shahani [38], with modifications from a previous study [39].
The methodology of Quade and Roth [40] was slightly modified to assess peroxidase levels in serum and skin mucus [41].

2.8. Relative Immune- and Antioxidant-Gene Expression Study

Collection of Tissues, RNA Isolation, cDNA Synthesis and qRT-PCR Analysis
To assess immune and antioxidant gene expression, six fish per tank were sampled. After anesthesia, 0.5 g of liver and intestinal tissues were collected, preserved in TRIzol Reagent (Life Technologies, Carlsbad, CA, USA), and homogenized with pellet pestles (Sigma-Aldrich: St. Louis, MO, USA). The homogenates were incubated at room temperature for 5 min, followed by the addition of 100 μL chloroform and a 2 min incubation. Samples were centrifuged at 12,000× g for 15 min at 4 °C, and the RNA-rich aqueous phase was purified using the PureLink™ RNA Mini Kit (Invitrogen, Waltham, MA, USA), as per the manufacturer’s instructions. RNA quantity and purity were checked using a NanoDrop™ One spectrophotometer (Thermo Scientific, Waltham, MA, USA). A total of 1000 ng of RNA was reverse-transcribed into cDNA with the iScript™ cDNA Synthesis Kit (Bio-Rad, Hercules, CA, USA). Primer sequences for target genes are listed in Table 4. Quantitative real-time PCR (qRT-PCR) was performed in triplicate on a CFX96 Touch Real-Time PCR System (Bio-Rad, USA) using 100 ng of cDNA, primers, and iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA). Thermal cycling followed a previously described protocol [39], and gene expression was analyzed using the 2−ΔΔCt method [42].

2.9. Histological Screening of Intestinal Samples

Intestinal tissue samples from three fish per group were fixed in 10% neutral buffered formalin, dehydrated through graded ethanol, cleared with xylene, and embedded in paraffin. Sections 5 µm thick were cut using a rotary microtome (Leica 2025, Wetzlar, Germany) and stained with Hematoxylin and Eosin (H&E) for histological analysis [43]. Microscopic examination was performed using a CX 43 light microscope (Olympus, Hachioji-shi, Tokyo, Japan) equipped with an E620 digital camera (Olympus, Hachioji-shi, Tokyo, Japan) for imaging.

2.10. Statistical Analysis

Data normality was evaluated using the Shapiro–Wilk test. ANOVA was conducted to analyze differences among treatments, followed by the Least Significant Difference (LSD) test at a 95% confidence level. Statistical analysis was performed with the “agricolae” package (version 1.3-7) in R and JMP Pro Version 15.1.0 (SAS Institute Inc., Cary, NC, USA). The optimal MS level was identified using polynomial regression analysis [44], with a significance threshold of p ≤ 0.05.

3. Results

3.1. Growth Performance

The growth performance and feed utilization of Nile tilapia fed with mango seed (MS)-supplemented diets were evaluated over 4 and 8 weeks (Table 5). Initial weights were consistent across all groups, with no significant differences at the start. After 4 weeks, fish in the MS10 and MS20 groups exhibited significantly higher FW, WG, and SGR compared to the control group (p < 0.05). By the end of the 8-week period, all MS-supplemented groups maintained superior growth performance, though the differences were not statistically significant. The FCR also improved in the MS-supplemented groups, with the MS10 group showing a significantly better FCR after 4 weeks (p < 0.05) and the MS40 group optimizing FCR by 8 weeks. Survival rates (SRs) were high across all groups, with the MS20 and MS40 groups achieving 100% survival after 8 weeks, significantly higher than the MS80 group (p < 0.05). Polynomial regression analysis determined the optimal dietary inclusion level of mango seed powder to be approximately 39 g kg−1 for FW, WG, SGR, and FCR (Figure 1).

3.2. Skin Mucus and Serum Immunities

The effects of mango seed (MS) powder supplementation on lysozyme and peroxidase activity in Nile tilapia were assessed in both skin mucus and serum after four and eight weeks of feeding (Figure 2). In skin mucus, lysozyme activity significantly increased in the MS10, MS20, and MS40 groups compared to the control (MS0) after four weeks (p < 0.05), with the MS10 group maintaining this elevated activity after eight weeks. However, the MS80 group showed a significant decrease in lysozyme activity by the end of the study. In serum, lysozyme activity was significantly higher in the MS10 and MS40 groups at four weeks, but no significant differences were observed at eight weeks. Peroxidase activity in both skin mucus and serum remained consistent across all treatment groups, with no significant differences at either time point (p > 0.05).

3.3. Immune-Related and Antioxidant Gene Expression

The relative gene expression of immune-related (IL-1, IL-8, LBP) and antioxidant-related (GPX, GST-α, GSR) genes in Nile tilapia was analyzed in both liver and intestinal tissues after feeding with diets containing varying concentrations of mango seed (MS) powder (Figure 3). In liver tissue, the MS10 diet resulted in the highest expression levels of all measured genes, with significant upregulation compared to the control group (MS0). As the concentration of MS increased to MS20 and MS40, gene expression levels remained elevated, but were lower than in the MS10 group. The MS80 group exhibited significantly reduced gene expression, with some genes showing no difference from the control. A similar pattern was observed in the intestinal tissue, where the MS10 diet again led to the highest gene expression levels, followed by a gradual decline in the MS20 and MS40 groups, and the lowest expression levels were found in the MS80 group.

3.4. Intestinal Morphology

The histological analysis of Nile tilapia intestines after 8 weeks of mango seed (MS) supplementation revealed significant improvements in several key parameters (Table 6). Villus height (VH) and villus width (VW) were markedly increased in the MS-supplemented groups, with the MS20 and MS40 groups showing the most substantial enhancements. Crypt depth (CD) was significantly reduced across all MS groups, with the MS80 group exhibiting the lowest CD. Consequently, the villus ratio (VH:CD) was significantly elevated in all MS-supplemented groups, with the highest ratios observed in the MS40 and MS80 groups (Figure 4). These histological improvements suggest that MS supplementation positively impacts intestinal structure, with the most pronounced effects seen at the 20 g kg−1 and 40 g kg−11 supplementation levels.

4. Discussion

As the demand for aquaculture continues to rise, there is an increasing need to enhance the growth and immune system of farmed aquatic species [45]. Traditionally, antibiotics have been used to address these challenges. However, the overuse of antibiotics has led to concerns about antibacterial resistance and residual contamination, which not only jeopardize fish health, but also pose significant food safety risks [46]. In response, the use of agricultural by-products as feed additives has gained attention as a sustainable alternative [47]. These by-products can reduce the reliance on antibiotics while simultaneously improving growth and nutrient utilization in farmed species, which are critical factors for the success of aquaculture production [48].
Growth performance is a critical parameter for farmers and aquaculture practices, making it one of the most important factors to measure in feeding studies. Our results demonstrated that mango seed (MS) supplementation positively influenced growth performance in Nile tilapia, leading to significant improvements in FBW, WG, and SGR. Regression analysis suggests that the optimal amount of mango seed powder to supplement the basal diet ranges from 36.43 to 45 g kg−1. This finding is consistent with the study [32], which showed that red hybrid tilapia (O. niloticus × O. mossambicus) exhibited improved growth performance when fed a diet containing 10% mango seed meal (MSM), though higher doses above 25% reduced growth. Similarly, Falaye, Shakiru Okanlawon, Salimata and Martha [49] reported that optimal growth and feed conversion ratio (FCR) in Nile tilapia were achieved when 25% of their diet was replaced with mango seed kernel meal at a rate of 7.67 g kg−1. Recent studies have further confirmed that the dietary inclusion of seed powders can enhance growth performance in various fish species, including Nile tilapia [41,50,51,52], rainbow trout [53,54], and European sea bass [55]. The improvement in growth can be attributed to the high polyphenol content in mango seeds. These bioactive compounds may enhance feed palatability and stimulate the secretion of digestive enzymes, leading to increased feed intake [52]. Polyphenols from mango seeds have been recognized as effective growth promoters in various animals [56,57]. Furthermore, mango seeds are a rich source of fatty acids, including oleic, palmitic, and stearic acids, which together account for approximately 15% of the total seed weight [58]. These fatty acids have been shown to enhance growth performance in fish by providing essential energy sources and supporting various physiological functions critical for growth and development [59]. However, it is noteworthy that the MS80 group experienced a significant decline in growth performance after 8 weeks of feeding. Similar findings have been observed in Nile tilapia fed chia seed [52] and makiang seed [41], as well as in rainbow trout fed lupin seed meal [54]. Beriso and Tesfaye [60] have highlighted the fact that although mango seeds are inexpensive and provide high metabolizable energy, they also contain anti-nutritional factors such as tannins, which can be challenging for animals to digest, potentially explaining the reduced growth observed at higher supplementation levels. The initial significant improvement in the growth performance of Nile tilapia with mango seed powder supplementation at 4 weeks, followed by a lack of significant differences at 8 weeks, can be explained by several factors. Firstly, fish may exhibit an early positive response to the new dietary additive due to enhanced palatability, but this effect may diminish as they adapt to the diet, leading to a plateau in growth [61]. Additionally, the prolonged use of higher doses of mango seed powder may have introduced anti-nutritional factors such as tannins, phytates, and saponins, which can interfere with nutrient absorption and digestion [62]. Over time, these compounds might inhibit digestive enzyme activity, reducing the overall growth benefits. Furthermore, compensatory growth by the control group could also contribute to this, as the fish may have experienced a period of rapid catch-up growth, minimizing the differences between groups by the 8-week mark. Finally, while bioactive compounds in mango seed powder initially enhanced digestive and immune functions, prolonged supplementation may have shifted energy allocation towards immune maintenance or detoxification processes, rather than growth [63]. Collectively, these factors suggest that while mango seed powder can boost short-term growth, its long-term efficacy may be influenced by the dosage and duration of supplementation.
The study revealed that mango seed (MS) powder supplementation had a significant impact on the lysozyme activity in the skin mucus and serum of Nile tilapia, particularly at moderate inclusion levels (MS10, MS20, and MS40). The observed increase in lysozyme activity, a key component of the fish’s innate immune system, suggests that mango seed powder can enhance the fish’s ability to ward off pathogens. Notably, the MS10 group maintained elevated lysozyme activity even after eight weeks, indicating the sustained immunomodulatory benefits of mango seed at this concentration. Mango seed powder has already been shown to be able to increase the presence of lysozyme in the blood serum of Nile tilapia [64], as well as the blood serum of rohu [65], and a similar effect was detected in the blood serum and skin mucus of Nile tilapia fed makiang and garden cress seeds [41,50], and rainbow trout fed medicinal plant seeds [53]. However, the significant decrease in lysozyme activity in the MS80 group by the end of the study suggests that excessive supplementation may have a detrimental effect, possibly due to the presence of anti-nutritional factors such as tannins, which are known to be present in mango seeds [66]. In terms of peroxidase activity, the consistent peroxidase activity observed across all treatment groups suggests that while mango seed supplementation may enhance lysozyme activity, it does not significantly influence peroxidase activity. Peroxidase activity, which plays a role in the oxidative burst response, may not be as sensitive to dietary changes as lysozyme activity, or it may require different types or concentrations of bioactive compounds to be significantly affected. This finding is consistent with previous studies reported in European sea bass (Dicentrarchus labrax) fed okra leaves [67], Nile tilapia (Oreochromis niloticus) fed makiang seed [41], and rainbow trout (Oncorhynchus mykiss) fed tributyrin [68]. Regarding gene expression, this study demonstrated that mango seed (MS) powder supplementation had a significant impact on the expression of immune-related (IL-1, IL-8, LBP) and antioxidant-related (GPX, GST-α, GSR) genes in the liver and intestinal tissues of Nile tilapia. The highest gene expression levels were observed in fish fed with the MS10 diet, indicating that moderate supplementation with mango seed powder most effectively enhances both immune and antioxidant responses in these tissues. As the concentration of MS increased to MS20 and MS40, gene expression levels remained elevated but were lower than those observed in the MS10 group, suggesting a dose-dependent response. In the MS80 group, gene expression was significantly reduced, with some genes showing no difference from the control, indicating that excessive supplementation may have a suppressive effect on these important physiological processes. On the other hand, the antioxidant properties of these compounds can stimulate the expression of genes involved in the detoxification of reactive oxygen species (ROS), such as GPX, GST-α, and GSR, providing cellular protection against oxidative stress. These findings are consistent with previous studies reported in Nile tilapia fed neem and makiang seeds [41,51]. The enhancement of immune response may also be attributed to several possible mechanisms. First, the strong antioxidant properties of polyphenols and flavonoids in mango seeds [13] likely reduce oxidative stress, preserving immune resources and supporting sustained lysozyme production [69]. Dietary polyphenols influence the composition of gut microbiota, while intestinal microbes metabolize polyphenols, producing bioactive compounds in the process [70], thereby enhancing overall immune function. The anti-inflammatory effects of mango seed bioactive compounds could also play a role in maintaining a balanced immune response, preventing chronic inflammation that might otherwise impair immune effectiveness [71]. Additionally, mango seed is a rich source of vitamin C and E [66], which are well-known for their immunostimulatory effects, promoting the production and function of immune cells and enhancing the overall immune response [72,73].
While the intestine is primarily recognized as the main site for nutrient absorption in fish, it also plays a crucial role as an immune organ, capable of preventing intestinal endotoxins and bacterial invasion [74]. Damage to the intestine has been linked to various immune system disorders, weakened disease resistance, decreased appetite, and even slower growth [75]. With this in mind, we examined the villus height, villus width, crypt depth, and villus-to-crypt ratio in Nile tilapia to determine whether the positive effects of mango seed powder on growth and the immune system are also associated with improvements in intestinal anatomy. Our study revealed a significant increase in villus height across all experimental diets compared to the control (MS0). Although we did not observe a corresponding increase in villus width, the increased villus height is still a promising outcome. Greater villus height and width enhance the contact area between the intestine and nutrients, facilitating better nutrient absorption [76]. Crypt depth, which is related to the renewal of intestinal epithelial cells, showed varied results: an increase in depth for the MS10 and MS20 groups, and a decrease for the MS40 and MS80 groups. Shallow crypts indicate slower renewal of epithelial cells [75], suggesting that while appropriate doses of mango seed powder benefit intestinal anatomy, excessive amounts can have adverse effects. Nevertheless, all MS-supplemented diets resulted in an increased villus-to-crypt ratio, which is a positive outcome. A higher ratio indicates stronger digestive absorption capacity and supports both digestion and the immune system [77]. These findings suggest that mango seed powder, when used in appropriate dosages, can significantly enhance intestinal health, thereby supporting overall growth and immunity in Nile tilapia [77].

5. Conclusions

In summary, mango seed powder is a promising natural feed additive for Nile tilapia, enhancing growth, immune response, intestinal health, and gene expression. An optimal dose of 36.43–45 g kg−1 improved key growth metrics and immune function, while promoting better nutrient absorption and intestinal structure. This study supports the use of agricultural by-products as sustainable alternatives to synthetic additives in aquaculture.

Author Contributions

Methodology and writing—original draft, C.M.F.; formal analysis, and writing—review and editing, M.A.A.S.; investigation and formal analysis, S.W.; writing—review and editing, A.R.L.; formal analysis, N.K.; formal analysis, software, and writing—review and editing, N.V.L.; formal analysis, Y.P.; writing—review and editing, S.H.H.; supervision, conceptualization, funding acquisition, project administration, writing—review and editing, H.V.D. All authors have read and agreed to the published version of the manuscript.

Funding

This research work was partially supported by Chiang Mai University (CoE 2567).

Institutional Review Board Statement

The animals used in this study were cared for in accordance with ethical treatment guidelines. All experimental procedures were approved by the Chiang Mai University Animal Care and Use Committee (AAALAC guidelines) on 31 January 2022 (Approval No. RAGIACUC001/2565).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article will be uploaded to public repositories upon acceptance of the manuscript

Acknowledgments

The authors would like to extend their sincere appreciation to Chiang Mai University and the National Research Council of Thailand for supporting and helping with the study (N41A640086). We would like to thank the Central Laboratory, Faculty of Agriculture, Chiang Mai University for their support during the conducting of the experiment.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Caipang, C.M.A.; Mabuhay-Omar, J.; Gonzales-Plasus, M.M. Plant and fruit waste products as phytogenic feed additives in aquaculture. Aquac. Aquar. Conserv. Legis. 2019, 12, 261–268. [Google Scholar]
  2. Jamal, M.T.; Sumon, A.A.; Pugazhendi, A.; Al Harbi, M.; Hussain, A.; Haque, F. Use of Probiotics in Commercially Important Finfish Aquaculture. Int. J. Probiotics Prebiotics 2020, 15, 7–21. [Google Scholar] [CrossRef] [PubMed]
  3. Troell, M.; Costa-Pierce, B.; Stead, S.; Cottrell, R.S.; Brugere, C.; Farmery, A.K.; Little, D.C.; Strand, Å.; Pullin, R.; Soto, D. Perspectives on aquaculture’s contribution to the Sustainable Development Goals for improved human and planetary health. J. World Aquac. Soc. 2023, 54, 251–342. [Google Scholar] [CrossRef]
  4. Hernández-Sánchez, F.; Aguilera-Morales, M.E. Nutritional richness and importance of the consumption of tilapia in the Papaloapan Region. Rev. Electron. Vet. 2012, 13, 1–12. [Google Scholar]
  5. Munguti, J.M.; Nairuti, R.; Iteba, J.O.; Obiero, K.O.; Kyule, D.; Opiyo, M.A.; Abwao, J.; Kirimi, J.G.; Outa, N.; Muthoka, M. Nile tilapia (Oreochromis niloticus Linnaeus, 1758) culture in Kenya: Emerging production technologies and socio-economic impacts on local livelihoods. Aquac. Fish Fish. 2022, 2, 265–276. [Google Scholar] [CrossRef]
  6. Tran, N.; Chu, L.; Chan, C.Y.; Peart, J.; Nasr-Allah, A.M.; Charo-Karisa, H. Prospects of fish supply-demand and its implications for food and nutrition security in Egypt. Mar. Policy 2022, 146, 105333. [Google Scholar] [CrossRef]
  7. Rana, K.J.; Siriwardena, S.; Hasan, M.R. Impact of Rising Feed Ingredient Prices on Aquafeeds and Aquaculture Production; Food and Agriculture Organization of the United Nations (FAO): Québec City, QC, Canada, 2009. [Google Scholar]
  8. Doan, H.V.; Hoseinifar, S.H.; Elumalai, P.; Tongsiri, S.; Chitmanat, C.; Jaturasitha, S.; Doolgindachbaporn, S. Effects of orange peels derived pectin on innate immune response, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus) cultured under indoor biofloc system. Fish Shellfish Immunol. 2018, 80, 56–62. [Google Scholar] [CrossRef]
  9. Kaur, R.; Shah, T.K. A review on role of plant waste products on fish growth, health and production. J. Entomol. Zool. Stud. 2017, 5, 583–589. [Google Scholar]
  10. Daud, N.M.; Putra, N.R.; Jamaludin, R.; Norodin, N.S.M.; Sarkawi, N.S.; Hamzah, M.H.S.; Nasir, H.M.; Zaidel, D.N.A.; Yunus, M.A.C.; Salleh, L.M. Valorisation of plant seed as natural bioactive compounds by various extraction methods: A review. Trends Food Sci. Technol. 2022, 119, 201–214. [Google Scholar] [CrossRef]
  11. Ballesteros-Vivas, D.; Álvarez-Rivera, G.; Morantes, S.J.; del Pilar Sánchez-Camargo, A.; Ibáñez, E.; Parada-Alfonso, F.; Cifuentes, A. An integrated approach for the valorization of mango seed kernel: Efficient extraction solvent selection, phytochemical profiling and antiproliferative activity assessment. Food Res. Int. 2019, 126, 108616. [Google Scholar] [CrossRef]
  12. Global Mango Production 2000–2022; Statista: Hamburg, Germany, 2024.
  13. Martínez-Olivo, A.O.; Carlos-Murillo, M.U.; Sáyago-Ayerdi, S.G.; Sánchez-Burgos, J.A.; Zamora-Gasga, V.M. Optimization of ultrasonic extraction for enhanced polyphenol profile and antioxidant capacity in mango seeds: A comparative study with thermal extraction. Food Chem. Adv. 2023, 3, 100480. [Google Scholar] [CrossRef]
  14. Lim, K.J.A.; Cabajar, A.A.; Migallos, M.K.V.; Lobarbio, C.F.Y.; Taboada, E.B. Microencapsulation of phenolic compounds from waste mango seed kernel extract by spray drying technology. Nat. Environ. Pollut. Technol. 2019, 18, 765–775. [Google Scholar]
  15. Shang, A.; Cao, S.-Y.; Xu, X.-Y.; Gan, R.-Y.; Tang, G.-Y.; Corke, H.; Mavumengwana, V.; Li, H.-B. Bioactive compounds and biological functions of garlic (Allium sativum L.). Foods 2019, 8, 246. [Google Scholar] [CrossRef] [PubMed]
  16. Granato, D.; Shahidi, F.; Wrolstad, R.; Kilmartin, P.; Melton, L.D.; Hidalgo, F.J.; Miyashita, K.; van Camp, J.; Alasalvar, C.; Ismail, A.B. Antioxidant activity, total phenolics and flavonoids contents: Should we ban in vitro screening methods? Food Chem. 2018, 264, 471–475. [Google Scholar] [CrossRef]
  17. Xu, X.-Y.; Meng, J.-M.; Mao, Q.-Q.; Shang, A.; Li, B.-Y.; Zhao, C.-N.; Tang, G.-Y.; Cao, S.-Y.; Wei, X.-L.; Gan, R.-Y. Effects of tannase and ultrasound treatment on the bioactive compounds and antioxidant activity of green tea extract. Antioxidants 2019, 8, 362. [Google Scholar] [CrossRef]
  18. Dorta, E.; González, M.; Lobo, M.G.; Sánchez-Moreno, C.; de Ancos, B. Screening of phenolic compounds in by-product extracts from mangoes (Mangifera indica L.) by HPLC-ESI-QTOF-MS and multivariate analysis for use as a food ingredient. Food Res. Int. 2014, 57, 51–60. [Google Scholar] [CrossRef]
  19. Mercado-Mercado, G.; Montalvo-González, E.; González-Aguilar, G.A.; Alvarez-Parrilla, E.; Sáyago-Ayerdi, S.G. Ultrasound-assisted extraction of carotenoids from mango (Mangifera indica L.‘Ataulfo’) by-products on in vitro bioaccessibility. Food Biosci. 2018, 21, 125–131. [Google Scholar] [CrossRef]
  20. Blancas-Benitez, F.J.; Mercado-Mercado, G.; Quirós-Sauceda, A.E.; Montalvo-González, E.; González-Aguilar, G.A.; Sáyago-Ayerdi, S.G. Bioaccessibility of polyphenols associated with dietary fiber and in vitro kinetics release of polyphenols in Mexican ‘Ataulfo’mango (Mangifera indica L.) by-products. Food Funct. 2015, 6, 859–868. [Google Scholar] [CrossRef]
  21. Nouri, A.; Heibati, F.; Heidarian, E. Gallic acid exerts anti-inflammatory, anti-oxidative stress, and nephroprotective effects against paraquat-induced renal injury in male rats. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2021, 394, 1–9. [Google Scholar] [CrossRef]
  22. Choudhary, D.K.; Chaturvedi, N.; Singh, A.; Mishra, A. Investigation of hypoglycemic effects, oxidative stress potential and xanthine-oxidase activity of polyphenols (gallic acid, catechin) derived from faba bean on 3T3-L1 cell line: Insights into molecular docking and simulation study. Toxicol. Res. 2020, 9, 308–322. [Google Scholar] [CrossRef]
  23. Ghosh, A.K.; Hasanuzzaman, A.F.M.; Sarower, M.G.; Islam, M.R.; Huq, K.A. Unveiling the biofloc culture potential: Harnessing immune functions for resilience of shrimp and resistance against AHPND-causing Vibrio parahaemolyticus infection. Fish Shellfish Immunol. 2024, 151, 109710. [Google Scholar] [CrossRef] [PubMed]
  24. Khanjani, M.H.; Sharifinia, M.; Emerenciano, M.G.C. Biofloc Technology (BFT) in Aquaculture: What Goes Right, What Goes Wrong? A Scientific-Based Snapshot. Aquac. Nutr. 2024, 2024, 7496572. [Google Scholar] [CrossRef] [PubMed]
  25. Khanjani, M.H.; Mozanzadeh, M.T.; Sharifinia, M.; Emerenciano, M.G.C. Broodstock and seed production in biofloc technology (BFT): An updated review focused on fish and penaeid shrimp. Aquaculture 2024, 579, 740278. [Google Scholar] [CrossRef]
  26. Khanjani, M.H.; Sharifinia, M.; Hajirezaee, S. Biofloc: A sustainable alternative for improving the production of farmed cyprinid species. Aquac. Rep. 2023, 33, 101748. [Google Scholar] [CrossRef]
  27. Zablon, W.O.; Ogello, E.O.; Getabu, A.; Omondi, R. Biofloc system improves protein utilization efficiency and growth performance of Nile tilapia, Oreochromis niloticus fry: Experimental evidence. Aquac. Fish Fish. 2022, 2, 94–103. [Google Scholar] [CrossRef]
  28. Ende, S.; Henjes, J.; Spiller, M.; Elshobary, M.; Hanelt, D.; Abomohra, A. Recent advances in recirculating aquaculture systems and role of microalgae to close system loop. Bioresour. Technol. 2024, 407, 131107. [Google Scholar] [CrossRef]
  29. Lin, Y.-S.; Lin, W.-S.; Tung, J.-W.; Cheng, Y.-C.; Chang, M.-Y.; Chen, C.-Y.; Huang, S.-L. Antioxidant Capacities of Jujube Fruit Seeds and Peel Pulp. Appl. Sci. 2020, 10, 6007. [Google Scholar] [CrossRef]
  30. Juan, M.-Y.; Chou, C.-C. Enhancement of antioxidant activity, total phenolic and flavonoid content of black soybeans by solid state fermentation with Bacillus subtilis BCRC 14715. Food Microbiol. 2010, 27, 586–591. [Google Scholar] [CrossRef]
  31. Wannavijit, S.; Outama, P.; Le Xuan, C.; Lumsangkul, C.; Lengkidworraphiphat, P.; Tongsiri, S.; Chitmanat, C.; Van Doan, H. Modulatory effects of longan seed powder on growth performance, immune response, and immune-antioxidant related gene expression in Nile tilapia (Oreochromis niloticus) raised under biofloc system. Fish Shellfish Immunol. 2022, 123, 460–468. [Google Scholar] [CrossRef]
  32. Khieokhajonkhet, A. Mango seed meal as partial replacement in diet for red hybrid tilapia (Oreochromis niloticus × O. mossambicus): Growth performance, feed utilization and economic efficiency. Int. J. Agric. Technol. 2020, 16, 831–844. [Google Scholar]
  33. Official Methods of Analysis, 19th ed.; AOAC: Rockville, MD, USA, 2012.
  34. Mmanda, F.P.; Lindberg, J.E.; Norman Haldén, A.; Mtolera, M.S.P.; Kitula, R.; Lundh, T. Digestibility of Local Feed Ingredients in Tilapia Oreochromis niloticus Juveniles, Determined on Faeces Collected by Siphoning or Stripping. Fishes 2020, 5, 32. [Google Scholar] [CrossRef]
  35. Zhao, Z.; Xu, Q.; Luo, L.; Li, J.; Wang, L. Effect of feed C/N ratio promoted bioflocs on water quality and production performance of bottom and filter feeder carp in minimum-water exchanged pond polyculture system. Aquaculture 2014, 434, 442–448. [Google Scholar] [CrossRef]
  36. Li, R.; Cho, S.H.; Kim, T. Effect of replacing dietary fish meal protein with combined animal meals on the growth performance of olive flounder (Paralichthys olivaceus). Aquac. Rep. 2023, 32, 101712. [Google Scholar] [CrossRef]
  37. Van Doan, H.; Hoseinifar, S.H.; Sringarm, K.; Jaturasitha, S.; Khamlor, T.; Dawood, M.A.; Esteban, M.Á.; Soltani, M.; Musthafa, M.S. Effects of elephant’s foot (Elephantopus scaber) extract on growth performance, immune response, and disease resistance of Nile tilapia (Oreochromis niloticus) fingerlings. Fish Shellfish Immunol. 2019, 93, 328–335. [Google Scholar] [CrossRef]
  38. Parry, R.M., Jr.; Chandan, R.C.; Shahani, K.M. A rapid and sensitive assay of muramidase. Proc. Soc. Exp. Biol. Med. 1965, 119, 384–386. [Google Scholar] [CrossRef]
  39. Outama, P.; Le Xuan, C.; Wannavijit, S.; Lumsangkul, C.; Linh, N.V.; Montha, N.; Tongsiri, S.; Chitmanat, C.; Van Doan, H. Modulation of growth, immune response, and immune-antioxidant related gene expression of Nile tilapia (Oreochromis niloticus) reared under biofloc system using mango peel powder. Fish Shellfish Immunol. 2022, 131, 1136–1143. [Google Scholar] [CrossRef]
  40. Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 1997, 58, 239–248. [Google Scholar] [CrossRef]
  41. Le Xuan, C.; Linh, N.V.; Wannavijit, S.; Outama, P.; Fontana, C.M.; Meepowpan, P.; Van Doan, H. Influences of makiang (Syzygium nervosum) seed powder on growth performance, immunological response, antioxidant and immune related gene expression in juvenile Nile tilapia (Oreochromis niloticus). Aquaculture 2024, 588, 740943. [Google Scholar] [CrossRef]
  42. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  43. Bancroft, J.D.; Gamble, M. Theory and Practice of Histological Techniques; Elsevier Health Sciences: Amsterdam, The Netherlands, 2008. [Google Scholar]
  44. Yossa, R.; Verdegem, M. Misuse of multiple comparison tests and underuse of contrast procedures in aquaculture publications. Aquaculture 2015, 437, 344–350. [Google Scholar] [CrossRef]
  45. Ghosh, T. Recent advances in the probiotic application of the Bacillus as a potential candidate in the sustainable development of aquaculture. Aquaculture 2024, 594, 741432. [Google Scholar] [CrossRef]
  46. Cherian, T.; Ragavendran, C.; Vijayan, S.; Kurien, S.; Peijnenburg, W.J.G.M. A review on the fate, human health and environmental impacts, as well as regulation of antibiotics used in aquaculture. Environ. Adv. 2023, 13, 100411. [Google Scholar] [CrossRef]
  47. Sampathkumar, K.; Yu, H.; Loo, S.C.J. Valorisation of industrial food waste into sustainable aquaculture feeds. Future Foods 2023, 7, 100240. [Google Scholar] [CrossRef]
  48. Onomu, A.J.; Okuthe, G.E. The Role of Functional Feed Additives in Enhancing Aquaculture Sustainability. Fishes 2024, 9, 167. [Google Scholar] [CrossRef]
  49. Falaye, E.; Shakiru Okanlawon, S.; Salimata, S.; Martha, K. Performance of Oreochromis niloticus juveniles fed autoclaved mango seed kernel diets. Aceh J. Anim. Sci. 2021, 6, 39–44. [Google Scholar] [CrossRef]
  50. El-Houseiny, W.; Abd-Allah, N.A.; Abd-Elhakim, Y.M.; Abdel-Warith, A.W.A.; Younis, E.M.; Davies, S.J.; Metwally, M.M.; Nasr, M.E.; Al-Sagheer, A.A.; Hassan, B.A.; et al. Dietary garden cress (Lepidium sativum) seeds mitigate the effect of aflatoxin B1 contamination on growth, antioxidant status, AFB1 residues, immune response, and tissue architecture of Oreochromis niloticus. Aquac. Rep. 2024, 36, 102040. [Google Scholar] [CrossRef]
  51. Abdel Rahman, A.N.; Amer, S.A.; Masoud, S.R.; El-Saber, M.M.; Osman, A.; Younis, E.M.; Abdelwarith, A.A.; Davies, S.J.; Khamis, T.; Ibrahim, R.E. Neem seed protein hydrolysate as a fishmeal substitute in Nile tilapia: Effects on antioxidant/immune pathway, growth, amino acid transporters-related gene expression, and Aeromonas veronii resistance. Aquaculture 2023, 573, 739593. [Google Scholar] [CrossRef]
  52. Abd El-Naby, A.S.; El Asely, A.M.; Hussein, M.N.; Fawzy, R.M.; Abdel-Tawwab, M. Stimulatory effects of dietary chia (Salvia hispanica) seeds on performance, antioxidant-immune indices, histopathological architecture, and disease resistance of Nile tilapia. Aquaculture 2023, 563, 738889. [Google Scholar] [CrossRef]
  53. Rashidian, G.; Zare, M.; Tabibi, H.; Stejskal, V.; Faggio, C. The synergistic effects of four medicinal plant seeds and chelated minerals on the growth, immunity, and antioxidant capacity of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2023, 139, 108930. [Google Scholar] [CrossRef]
  54. Serrano, E.; Lefillanca, J.K.; Carrasco, J.; Davies, S.J.; Hernandez Arias, A.J. Evaluation of andean lupin (Lupinus mutabilis) seed meal as a dietary component on growth performance, feed utilization, nutrient digestibility, and liver histology of rainbow trout (Oncorhynchus mykiss) Juveniles. Aquac. Rep. 2024, 34, 101919. [Google Scholar] [CrossRef]
  55. Ashry, A.M.; Habiba, M.M.; Abdel-Wahab, A.; Younis, E.M.; Davies, S.J.; Elnakeeb, M.A.; Abdelghany, M.F.; El-Zayat, A.M.; El-Sebaey, A.M. Dietary effect of powdered herbal seeds on zootechnical performance, hemato-biochemical indices, immunological status, and intestinal microbiota of European sea bass (Dicentrarchus labrax). Aquac. Rep. 2024, 36, 102074. [Google Scholar] [CrossRef]
  56. Waqas, M.; Salman, M.; Sharif, M.S. Application of polyphenolic compounds in animal nutrition and their promising effects. J. Anim. Feed Sci. 2023, 32, 233–256. [Google Scholar] [CrossRef]
  57. Araújo, L.R.S.; Watanabe, P.H.; Fernandes, D.R.; Maia, I.R.O.; Vieira, E.H.M.; Silva, E.C.; Trevisan, M.T.S.; Pinheiro, R.R.S.; Freitas, E.R. Ethanol extract of mango seed is a suitable plant-based replacement for synthetic antioxidants in pig grower–finisher diets. Anim. Prod. Sci. 2019, 59, 1501–1509. [Google Scholar] [CrossRef]
  58. Gupta, A.K.; Gurjar, P.S.; Beer, K.; Pongener, A.; Ravi, S.C.; Singh, S.; Verma, A.; Singh, A.; Thakur, M.; Tripathy, S.; et al. A review on valorization of different byproducts of mango (Mangifera indica L.) for functional food and human health. Food Biosci. 2022, 48, 101783. [Google Scholar] [CrossRef]
  59. Natnan, M.E.; Low, C.-F.; Chong, C.-M.; Bunawan, H.; Baharum, S.N. Oleic acid as potential immunostimulant in metabolism pathways of hybrid grouper fingerlings (Epinephelus fuscoguttatus × Epinephelus lanceolatus) infected with Vibrio vulnificus. Sci. Rep. 2023, 13, 12830. [Google Scholar] [CrossRef]
  60. Beriso, Y.; Tesfaye, E. Livestock feed potential of mango (Mangifera indica Linn) seed kernel. Cogent Food Agric. 2024, 10, 2301833. [Google Scholar] [CrossRef]
  61. Assan, D.; Huang, Y.; Mustapha, U.F.; Addah, M.N.; Li, G.; Chen, H. Fish Feed Intake, Feeding Behavior, and the Physiological Response of Apelin to Fasting and Refeeding. Front. Endocrinol. 2021, 12, 798903. [Google Scholar] [CrossRef]
  62. Hasan, M.M.; Islam, M.R.; Haque, A.R.; Kabir, M.R.; Khushe, K.J.; Hasan, S.M.K. Trends and challenges of fruit by-products utilization: Insights into safety, sensory, and benefits of the use for the development of innovative healthy food: A review. Bioresour. Bioprocess 2024, 11, 10. [Google Scholar] [CrossRef]
  63. Yahia, E.M.; Ornelas-Paz, J.d.J.; Brecht, J.K.; García-Solís, P.; Maldonado Celis, M.E. The contribution of mango fruit (Mangifera indica L.) to human nutrition and health. Arab. J. Chem. 2023, 16, 104860. [Google Scholar] [CrossRef]
  64. El-Houseiny, W.; El-Murr, A.; El-Sayed, B. Evaluation of Dietary Inclusion of Mango Kernel Meal and Oat Extract on Performance and Immunity of Oreochromis niloticus. Zagazig Vet. J. 2017, 45, 118–125. [Google Scholar] [CrossRef]
  65. Sahu, S.; Das, B.K.; Pradhan, J.; Mohapatra, B.; Mishra, B.; Sarangi, N. Effect of Magnifera indica kernel as a feed additive on immunity and resistance to Aeromonas hydrophila in Labeo rohita fingerlings. Fish Shellfish Immunol. 2007, 23, 109–118. [Google Scholar] [CrossRef] [PubMed]
  66. Lebaka, V.R.; Wee, Y.J.; Ye, W.; Korivi, M. Nutritional Composition and Bioactive Compounds in Three Different Parts of Mango Fruit. Int J Env. Res Public Health 2021, 18, 741. [Google Scholar] [CrossRef] [PubMed]
  67. Guebebia, S.; Espinosa-Ruiz, C.; Zourgui, L.; Cuesta, A.; Romdhane, M.; Esteban, M.Á. Effects of okra (Abelmoschus esculentus L.) leaves, fruits and seeds extracts on European sea bass (Dicentrarchus labrax) leukocytes, and their cytotoxic, bactericidal and antioxidant properties. Fish Shellfish Immunol. 2023, 138, 108799. [Google Scholar] [CrossRef] [PubMed]
  68. Magnoni, L.J.; Silva-Brito, F.; Cavalheri, T.; Espirito-Santo, C.; Palma, M.; Ozório, R.; Panserat, S.; Morais, S.; Viegas, I. Dietary tributyrin supplementation enhances the immune and antioxidant responses of rainbow trout (Oncorhynchus mykiss) without changes in fish performance. Aquac. Rep. 2023, 32, 101735. [Google Scholar] [CrossRef]
  69. Rudrapal, M.; Khairnar, S.J.; Khan, J.; Dukhyil, A.B.; Ansari, M.A.; Alomary, M.N.; Alshabrmi, F.M.; Palai, S.; Deb, P.K.; Devi, R. Dietary Polyphenols and Their Role in Oxidative Stress-Induced Human Diseases: Insights Into Protective Effects, Antioxidant Potentials and Mechanism(s) of Action. Front. Pharmacol. 2022, 13, 806470. [Google Scholar] [CrossRef]
  70. Wang, X.; Qi, Y.; Zheng, H. Dietary Polyphenol, Gut Microbiota, and Health Benefits. Antioxidants 2022, 11, 1212. [Google Scholar] [CrossRef]
  71. Castro, R.J.; Pedroza, K.; Hong, M.Y. The effects of mango consumption on vascular health and immune function. Metab. Open 2023, 20, 100260. [Google Scholar] [CrossRef]
  72. Pourahad Anzabi, M.; Sarvi Moghanlou, K.; Imani, A.; Tahmasebi, R. Effects of dietary vitamin E and C co-supplementation on growth performance, hemato-immunological indices, digestive enzymes activity, and intestinal histology of rainbow trout fed diet contained spoiled fish meal and oil. Aquac. Rep. 2023, 33, 101842. [Google Scholar] [CrossRef]
  73. Li, T.; Zhang, Z.-L.; Zheng, P.-H.; Li, J.-T.; Zhang, X.-X.; Li, J.-J.; Lu, Y.-N.; Xian, J.-A.; Guo, H.; Lu, Y.-P. Effects of dietary vitamin C on the growth performance, muscle composition, non-specific immunity, and resistance of juvenile ivory shell (Babylonia areolata) to ammonia. Aquac. Rep. 2024, 36, 102188. [Google Scholar] [CrossRef]
  74. Diwan, A.D.; Harke, S.N.; Panche, A.N. Studies on exploring the potentials of gut microbiomes to mitigate the bacterial and viral diseases of fish and shellfish in aquaculture farming. Microbe 2024, 2, 100031. [Google Scholar] [CrossRef]
  75. Qin, H.; Long, Z.; Ma, J.; Kong, L.; Lin, H.; Zhou, S.; Lin, Y.; Huang, Z.; Liu, L.; Li, Z. Growth performance, digestive capacity and intestinal health of juvenile spotted seabass (Lateolabrax maculatus) fed dietary laminarin supplement. Front. Mar. Sci. 2023, 10, 1242175. [Google Scholar] [CrossRef]
  76. Li, Q.; Fu, B.; Huang, L.; Wang, F.; Zhou, D.; Yang, Q.; Zou, Y.; Xiao, Y.; Liao, S.; Xing, D. Effects of silkworm pupae powder on growth performance, muscle fatty acid composition, and intestinal function in mandarin fish (Siniperca chuatsi). Aquac. Rep. 2024, 39, 102435. [Google Scholar] [CrossRef]
  77. Su, X.; Ji, D.; Yao, J.; Zou, Y.; Yan, M. Comparative analysis of intestinal characteristics of largemouth bass (Micropterus salmoides) and intestinal flora with different growth rates. Fishes 2022, 7, 65. [Google Scholar] [CrossRef]
Figure 1. Quadratic relationships and polynomial regression analyses (p < 0.05) were used to evaluate the effects of dietary mango seed (MS) powder levels on the final body weight (a), weight gain (b), specific growth rate (c), and feed conversion ratio (d) of Nile tilapia after eight weeks. Data are presented as means ± SE.
Figure 1. Quadratic relationships and polynomial regression analyses (p < 0.05) were used to evaluate the effects of dietary mango seed (MS) powder levels on the final body weight (a), weight gain (b), specific growth rate (c), and feed conversion ratio (d) of Nile tilapia after eight weeks. Data are presented as means ± SE.
Fishes 09 00514 g001
Figure 2. Lysozyme and peroxidase activities in skin mucus and serum of Nile tilapia were measured after 4 and 8 weeks of feeding with mango seed powder at 0 (MS0, control), 10 (MS10), 20 (MS20), 40 (MS40), and 80 (MS80) g/kg. Data represent the mean ± SE from three replicates. Groups with different letters show significant differences (p < 0.05), while “ns” indicates no significant difference. Statistical analysis was performed using ANOVA.
Figure 2. Lysozyme and peroxidase activities in skin mucus and serum of Nile tilapia were measured after 4 and 8 weeks of feeding with mango seed powder at 0 (MS0, control), 10 (MS10), 20 (MS20), 40 (MS40), and 80 (MS80) g/kg. Data represent the mean ± SE from three replicates. Groups with different letters show significant differences (p < 0.05), while “ns” indicates no significant difference. Statistical analysis was performed using ANOVA.
Fishes 09 00514 g002aFishes 09 00514 g002b
Figure 3. Relative expression levels of immune-related genes (IL-1, IL-8, and LBP) and antioxidant-related genes (GPX, GST-α, and GSR) in the liver (A) and intestinal tissues (B) of Nile tilapia (n = 6) were assessed after feeding diets containing 0 (MS0, control), 10 (MS10), 20 (MS20), 40 (MS40), and 80 (MS80) g/kg. Data are presented as means ± SE from three replicates. Groups with different letters indicate significant differences (p < 0.05). Statistical analysis was conducted using ANOVA.
Figure 3. Relative expression levels of immune-related genes (IL-1, IL-8, and LBP) and antioxidant-related genes (GPX, GST-α, and GSR) in the liver (A) and intestinal tissues (B) of Nile tilapia (n = 6) were assessed after feeding diets containing 0 (MS0, control), 10 (MS10), 20 (MS20), 40 (MS40), and 80 (MS80) g/kg. Data are presented as means ± SE from three replicates. Groups with different letters indicate significant differences (p < 0.05). Statistical analysis was conducted using ANOVA.
Fishes 09 00514 g003
Figure 4. The intestine photomicrograph of Nile tilapia, O. niloticus tested with MS. VH: villus height, VW: villus width, CD: crypt depth. Stain H&E, scale bar = 100 µm.
Figure 4. The intestine photomicrograph of Nile tilapia, O. niloticus tested with MS. VH: villus height, VW: villus width, CD: crypt depth. Stain H&E, scale bar = 100 µm.
Fishes 09 00514 g004
Table 1. Proximate composition of mango seed powder used in the experiment.
Table 1. Proximate composition of mango seed powder used in the experiment.
Test ItemsResults
Dry matter95.30
Ash2.28
Crude fiber5.48
Crude protein5.5
Ether extract6.84
Nitrogen-free extract75.2
Table 2. Bioactive compounds of mango seed powder used in the experiment.
Table 2. Bioactive compounds of mango seed powder used in the experiment.
Test ItemsResultsMethods
DPPH (IC50) (mg/mL)0.21 ± 0.00[29]
ABTS+ (mg TE/g)5.38 ± 2.47[29]
FRAP (mg TE/g)64.98 ± 0.41[29]
Total flavonoid content (mg CE/g)4.40 ± 0.18[30]
Total phenolic content (mg GAE/g)36.97 ± 0.54[30]
Table 3. Formulation and proximate analysis of the experimental diets (g kg−1).
Table 3. Formulation and proximate analysis of the experimental diets (g kg−1).
IngredientsExperimental Diets (g kg−1)
MS0MS10MS20MS40MS80
Fish meal200200200200200
Soybean meal390390390390390
Corn meal150150150150150
Rice bran15014514012590
Wheat flour7070707070
Binder20151050
Soybean oil22222
MS a010204080
Premix b1010101010
Vitamin C98%88888
Proximate composition of the experimental diets (g kg−1)
Dry matter98.8798.1398.2198.1898.31
GE (Kcal/kg)4231.54224.64218.94227.44224.6
Crude protein32.1432.2732.0932.3332.18
Ash8.047.987.998.18.08
Fiber3.983.783.863.913.79
Crude lipid3.013.113.092.983.00
a MS: mango seed powder. b Vitamin and trace mineral mix supplemented as follows (IU kg−1 or g kg−1 diet): cholecalciferol (217,000 IU), retinyl acetate (1,085,000 IU), thiamine nitrate (0.5 g), folic acid (0.05 g), Ca pantothenate (1 g kg−1), D, L-a-tocopherol acetate (0.5 g), inositol (0.5 g), pyridoxine hydrochloride (0.5 g), sodium (7.85 g), niacin (3 g), zinc (1 g), copper (0.25 g), manganese (1.32 g), cyanocobalamin (10 g), and iodine (0.05 g).
Table 4. Primers used for quantitative RT-PCR in this study.
Table 4. Primers used for quantitative RT-PCR in this study.
Target GeneSequence (5′–3′)Tm (°C)Product Size
(bp)
Reference
18S rRNAF: GTGCATGGCCGTTCTTAGTT
R: CTCAATCTCGTGTGGCTGAA
60150XR_003216134
IL-1F: GTCTGTCAAGGATAAGCGCTG
R: ACTCTGGAGCTGGATGTTGA
59200XM_019365844
IL-8F: CTGTGAAGGCATGGGTGTG
R: GATCACTTTCTTCACCCAGGG
59196NM_001279704
LBPF: ACCAGAAACTGCGAGAAGGA
R: GATTGGTGGTCGGAGGTTTG
59200XM_013271147
GST-αF: ACTGCACACTCATGGGAACA
R: TTAAAAGCCAGCGGATTGAC
60190NM_001279635
GPXF: GGTGGATGTGAATGGAAAGG
R: CTTGTAAGGTTCCCCGTCAG
60190NM_001279711
GSRF: CTGCACCAAAGAACTGCAAAR: CCAGAGAAGGCAGTCCACTC60172XM_005467348
Table 5. Growth performances and feed utilization of Nile tilapia after 4 and 8 weeks feeding with mango seed diets.
Table 5. Growth performances and feed utilization of Nile tilapia after 4 and 8 weeks feeding with mango seed diets.
MS0MS10MS20MS40MS80p-Value
IW (g)15.32 ± 0.05 a15.23 ± 0.03 a15.33 ± 0.03 a15.30 ± 0.05 a15.28 ± 0.03 a0.9785
FW (g)
4 weeks39.61 ± 1.67 b42.77 ± 1.33 a41.86 ± 1.15 a41.37 ± 0.86 ab40.81 ± 0.07 ab0.0224
8 weeks86.54 ± 5.86 a91.70 ± 3.95 a91.72 ± 0.56 a91.87 ± 3.3 a87.99 ± 3.14 a0.675
WG (g)
4 weeks24.29 ± 1.64 b27.53 ± 1.33 a26.53 ± 1.12 a26.07 ± 0.88 ab25.53 ± 0.06 ab0.0312
8 weeks71.47 ± 0.89 a76.47 ± 3.84 a76.38 ± 0.53 a76.57 ± 3.35 a72.07 ± 3.12 a0.747
SGR (%/day)
4 weeks3.16 ± 0.13 b3.44 ± 0.10 a3.35 ± 0.09 a3.32 ± 0.08 ab3.27 ± 0.00 ab0.0412
8 weeks2.88 ± 0.12 a2.99 ± 0.07 a2.98 ± 0.01 a2.99 ± 0.07 a2.90 ± 0.06 a0.8210
FCR
4 weeks0.78 ± 0.05 b0.89 ± 0.04 a0.85 ± 0.06 ab0.83 ± 0.01 ab0.82 ± 0.05 ab0.0156
8 weeks0.73 ± 0.06 a0.82 ± 0.12 a0.71 ± 0.03 a0.70 ± 0.02 a0.78± 0.02 a0.1456
SR (%)
4 weeks96.67 ± 2.89 a100.0 ± 0.00 a98.33 ± 2.89 a96.33 ± 2.89 a96.67 ± 2.89 a0.2143
8 weeks96.67 ± 2.89 ab95.00 ± 5.00 ab96.67 ± 3.21 a96.33 ± 2.75 a91.67 ± 7.64 b0.0297
MS: Mango seed, IW: initial fish weight, FW: final fish weight, WG: weight gain, SGR: specific fish growth rate, FCR: feed conversion ratio, SR: survival rate. Different letters in the same row represent significant differences (p < 0.05).
Table 6. Effect of dietary MS supplementation on intestinal histological parameters of Nile Tilapia after 8 weeks.
Table 6. Effect of dietary MS supplementation on intestinal histological parameters of Nile Tilapia after 8 weeks.
MS0MS10MS20MS40MS80SEMp-Value
Villus height (VH)3417.39 c4087.06 ab4224.12 a4230.45 a3943.28 b32.94<0.001
Villus width (VW)631.48 ab612.06 b657.87 a659.89 a602.35 b5.14<0.001
Crypt depth (CD)207.11 a129.78 b113.12 b99.25 bc96.10 c3.86<0.001
Villus: Crypt ratio (VH: CD)17.57 d33.93 c39.36 b44.50 a42.72 ab0.98<0.001
Groups with different superscript letters indicate significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Fontana, C.M.; Sumon, M.A.A.; Wannavijit, S.; Lubis, A.R.; Khongdee, N.; Linh, N.V.; Phimolsiripol, Y.; Hoseinifar, S.H.; Van Doan, H. Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes 2024, 9, 514. https://doi.org/10.3390/fishes9120514

AMA Style

Fontana CM, Sumon MAA, Wannavijit S, Lubis AR, Khongdee N, Linh NV, Phimolsiripol Y, Hoseinifar SH, Van Doan H. Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes. 2024; 9(12):514. https://doi.org/10.3390/fishes9120514

Chicago/Turabian Style

Fontana, Camilla Maria, Md Afsar Ahmed Sumon, Supreya Wannavijit, Anisa Rilla Lubis, Nuttapon Khongdee, Nguyen Vu Linh, Yuthana Phimolsiripol, Seyed Hossein Hoseinifar, and Hien Van Doan. 2024. "Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus)" Fishes 9, no. 12: 514. https://doi.org/10.3390/fishes9120514

APA Style

Fontana, C. M., Sumon, M. A. A., Wannavijit, S., Lubis, A. R., Khongdee, N., Linh, N. V., Phimolsiripol, Y., Hoseinifar, S. H., & Van Doan, H. (2024). Effects of Mango Seed (Mangifera indica) Powder on Growth Performance, Immune Response, Gut Morphology, and Gene Expression of Nile Tilapia (Oreochromis niloticus). Fishes, 9(12), 514. https://doi.org/10.3390/fishes9120514

Article Metrics

Back to TopTop