Next Article in Journal
The Oxytetracycline and Florfenicol Effect on the Immune System and Oxidative Stress Response of the SHK-1 Cell Line of Salmo salar
Next Article in Special Issue
Lysozyme Activity in the Hemolymph of Octopus vulgaris (Cuvier, 1797) Following Challenge with Gram-Negative Bacteria: Insights into Temperature-Driven Innate Immune Response
Previous Article in Journal
Temporal and Spatial Distribution Characteristics of Fish Resources in a Typical River–Lake Confluence Ecosystem During the Initial Period of Fishing Ban
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis)

1
Sanya Institute of Breeding and Multiplication, School of Marine Biology and Fisheries, Collaborative Innovation Center of Marine Science and Technology, Hainan University, Haikou 572025, China
2
Engineering Research Center of Hainan Province for Blue Carbon and Coastal Wetland Conservation and Restoration, Haikou 570228, China
3
International Joint Research Center of Hainan Province for Blue Carbon and Coastal Wetland, Haikou 570228, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Fishes 2024, 9(12), 491; https://doi.org/10.3390/fishes9120491
Submission received: 17 October 2024 / Revised: 25 November 2024 / Accepted: 28 November 2024 / Published: 30 November 2024
(This article belongs to the Special Issue Advances in Pathology of Aquatic Animals)

Abstract

Humpback grouper (Cromileptes altivelis) is an economically important fish, but the increasing density of its farming has led to more severe disease outbreaks. To address this challenge, we established brain (CAB) and kidney (CAK) cell lines in our laboratory previously, providing a valuable tool for in vitro studies on immune responses. In this study, we used quantitative real-time polymerase chain reaction (qRT-PCR) to identify the optimal reference gene from six reference genes for CAB and CAK cells, under both normal conditions and after stimulation with LPS or Poly I: C. The qRT-PCR data were analyzed using geNorm, NormFinder, and BestKeeper software (Version 3.5) to ensure comprehensve evaluation. The results showed that RPL13 was the most stable reference gene for both CAB and CAK cells under normal conditions. Following LPS stimulation, TTLL1 was the best reference gene for CAB cells, while RPL13 remained the most suitable for CAK cells. For Poly I: C stimulation, EF1A and Actin were identified as the most stable reference genes for CAB and CAK cells, respectively. To confirm the reliability of the selected reference genes, we analyzed the expression of the cytokine genes IL-6 and IFN-h, demonstrating the dependability of these reference genes. This study lays a solid foundation for exploring gene expression patterns in humpback grouper cell lines under various experimental conditions, providing essential insights for future research into immune processes and disease control strategies in aquaculture.
Key Contribution: We found that RPL13 was the most stable reference gene for both CAB and CAK cells under normal conditions. TTLL1 and RPL13 were the best reference gene for CAB and CAK cell upon LPS stimulation, whereas EF1A and Actin were identified as the most stable reference genes for CAB and CAK cells on Poly I: C stimulation. The reliability of screened optimal reference genes was further validated by normalization analysis on two target immune genes.

1. Introduction

Quantitative real-time PCR (qRT-PCR) has occupied a prominent position in biological research due to its high precision, sensitivity, and practical application in various fields [1,2,3]. TaqMan probe-based qPCR was established to detect the Enterocytozoon hepatopenaei of Litopenaeus vannamei and has a sensitivity 100 times higher than conventional PCR [4]. It is extensively used for virus detection, genetic analysis, and disease investigation [5,6]. However, the precision of qRT-PCR is limited by several factors, such as variations in RNA extraction, cDNA synthesis efficiency, and PCR reaction consistency [7,8]. To improve the reliability of results, normalizing gene expression data is essential. This ensures accurate comparisons between reference and target genes within the same sample, minimizing unwarranted experimental variations [9,10].
Housekeeping genes, essential in cell survival, are expressed relatively consistently in the cells and tissues of organisms and are widely used as reference genes [11,12]. Nevertheless, recent studies have shown that the expression levels of commonly used reference genes can fluctuate across samples or in response to different treatments. As a result, no universal reference gene has been definitively identified [13,14,15]. Hence, it is essential that we identify the ideal reference gene for normalization purposes in various experimental setups and scenarios.
The humpback grouper (Cromileptes altivelis), belonging to the Perciformes, Serranidae, is naturally scarce and primarily found in the tropical regions of the Indian and Pacific Oceans [16,17]. Its commercial cultivation has increased significantly in recent years, particularly in Southeast Asia [18]. However, the expansion of farming has led to an increased incidence of diseases, among which bacteria and viruses pose significant threats to the humpback grouper cultivation industry [19,20,21]. To facilitate and enhance investigations into fish diseases and immune mechanisms, fish cell lines have become indispensable research tools in vitro [22]. Among them, two Cromileptes altivelis cell lines, the kidney (CAK) cell line and brain (CAB) cell line, have been established in our laboratory previously [23,24]. However, the stability of reference gene expression in these cell lines has not been evaluated to date.
This research focused on identifying the most suitable reference genes for CAK and CAB cells in standard physiological states and after stimulation with LPS or Poly I: C. Candidate genes, including Actin, EF1A, B2M, GAPDH, RPL13, and TTLL1, were analyzed using three widely used algorithms: geNorm, NormFinder, and BestKeeper. Furthermore, IL-6 and IFN-h were chosen as immune-related target genes to validate the ideal reference genes screened in this study. The results will provide a foundation for future qRT-PCR research on humpback grouper cell lines.

2. Materials and Methods

2.1. Cell Culture and Treatment

The CAB cell and CAK cell lines were established in our laboratory. Up to now, CAB cells have undergone more than 40 passages and CAK cells have undergone more than 100 passages [23,24]. They were cultivated in Leibovitz’s L-15 medium (Gibco, Waltham, MA, USA) with 15% fetal bovine serum (FBS, Gibco) and 2% penicillin/streptomycin at 26 °C. Trypsin–EDTA mixture (Gibco) was added to detach the cells to inoculate into 6-well plates when 90% cell confluence was reached. After 24 h of cultivation, 1.5 mL of L-15 medium containing 15% FBS without penicillin/streptomycin was added to 6-well plates. LPS (Solarbio, Beijing, China) and Poly I:C (Yuanye, Shanghai, China) were added to the cells at a final concentration of 10 µg/mL; PBS was used as the control. Three biological replicates were prepared for each treatment group. Cell samples were collected at 2, 4, 8, and 12 h post-stimulation.

2.2. Extraction of RNA and Synthesis of cDNA

RNA extraction was performed meticulously using an RNA extraction kit (Vazyme, Nanjing, China). The concentration and integrity were evaluated using 1% agarose gel electrophoresis and a spectrophotometer (DeNovix DS-11, Wilmington, DE, USA). Subsequently, RNA was reverse-transcribed to cDNA using a kit from Promega (Madison, WI, USA). A mixture was prepared by combining 800 ng RNA with 2 μL RT mix, making up the volume to 10 μL with nuclease-free water. The reaction was carried out at 37 °C for 15 min, followed by a step at 85 °C for 5 s. Finally, the reaction mixture was stored at 4 °C.

2.3. qRT-PCR and Data Analysis

To assess the stability of the reference genes, qRT-PCR analysis was conducted with 2 × ChamQ Universal SYBR qPCR Master Mix (Vazyme, Nanjing, China). We selected six reference genes, including B2M, Actin, RPL13, EF1A, GAPDH, and TTLL1. The primers of the reference genes were synthesized by Tsingke Biotechnology, and the primer sequences are shown in Table 1. The amplification efficiency had been proven previously [25]. The experiments were conducted using the LongGene qRT-PCR system. Subsequently, the data obtained were analyzed using the geNorm, Normfinder, and BestKeeper algorithms to assess gene stability.

2.4. Validation of Reference Gene Stability

To ensure the consistency of the chosen reference genes under various treatment conditions, we performed relative expression analysis on immune genes using the 2−ΔΔCt method. IL-6 and IFN-h, playing a pivotal role in the immune response of fish, help defend against bacterial and viral infections [26,27]. Under LPS or Poly I: C stimulation, the expression levels of IL-6 and IFN-h were analyzed using two of the most stable and unstable reference genes, with the PBS group as the control for each time point of stimulation. Primers of IL-6 (F:5ʹ-CCAACTTCAGCAAGGAGTCTT-3ʹ, R:5ʹ-GATACCGATGGGTGCCATA-3ʹ) and IFN-h (F:5ʹ-AGACAGGTGGACGGACTCAA-3ʹ, R: 5ʹ-CACCAACACGTCCAACTGAT-3ʹ) were designed.

2.5. Statistical Analyses

All assays were repeated three times using independently collected or prepared samples. Statistical analysis was performed using SPSS 20.0 software. Significant differences were determined by Tukey’s multiple-range test. All results are presented as mean ± SD. p-value < 0.05 was considered a statistically significant difference.

3. Results

3.1. Quality and Efficiency of qRT-PCR

Distinct and well-defined bands corresponding to 28S rRNA and 18S rRNA were observed in the agarose gel electrophoresis of total RNA samples, as shown in Figure S1. The high quality and purity of the total RNA were confirmed by the A260/A280 ratio, which fell within the acceptable range of 2.0 to 2.2. It is the prerequisite for subsequent experiments to ensure the reliability of the RNA samples.

3.2. Expression Levels of the Internal Reference Genes in CAB and CAK Cells

3.2.1. Expression Levels of Reference Genes in CAB and CAK Cells Under Normal Physiological Conditions

The data in Table 2 reveal the expression levels of six reference genes in humpback grouper cell lines. In CAB cells under normal conditions, GAPDH showed the least expression, averaging a Ct value of 27.4, whereas Actin displayed the highest expression, averaging a Ct value of 12.8. RPL13 demonstrated strong expression stability, with Ct values narrowly fluctuating between 14.6 and 15.5. In contrast, B2M had the broadest range of Ct values (18.1 to 19.8), indicating its inferior expression stability.
In CAK cells, Ct values ranged from 11.9 to 31.7, with EF1A showing the lowest Ct value at 11.9. Notably, RPL13 showed the narrowest Ct value range, a mere 0.3, underscoring its reliability as a reference gene. In comparison, GAPDH displayed the most pronounced variability, with a Ct range of 0.9. Among the six reference genes, CAPDH demonstrated the lowest expression in CAK cells, averaging a Ct value of 30.6, contrasted by EF1A, which presented the highest expression level, averaging a Ct value of 12.2.

3.2.2. Expression Levels of Reference Genes in CAB and CAK Cells Under LPS Stimulation Condition

Table 2 illustrates the stability of six internal reference genes in CAB cells after LPS stimulation. At 2, 4, 8, and 12 h post-stimulation, GAPDH exhibited the most significant increases in Ct values compared to the control group, with changes of 3.2, 4.8, 5.3, and 3.5, respectively. Conversely, B2M exhibited the least fluctuation at 2, 4, and 8 h, with Ct changes of 1.4, 0.1, and 0, respectively. At 12 h, TTLL1 demonstrated the smallest change, with a Ct increase of 2.3.
At 2 h post-stimulation in CAK cells, GAPDH displayed the most stable expression, while TTLL1 exhibited the greatest change. However, at 4 h, TTLL1 became the most stable gene, with minimal changes in Ct changes. At 8 and 12 h, B2M showed the least fluctuation, with a consistent Ct value change of 0.1. Meanwhile, EF1A exhibited the largest changes at 4, 8, and 12 h, with changes of 1, 1.6, and 1.4, respectively.

3.2.3. Expression Levels of Reference Genes in CAB and CAK Cells Under Poly I: C Stimulation Condition

The expression changes for six reference genes are shown in Table 2 in CAB and CAK cells after Poly I: C stimulation. In CAB cells, RPL13 showed the highest expression stability, with minimal Ct value change at 2 and 4 h post-stimulation. Similarly, EF1A and TTLL1 remained stable at 8 and 12 h, respectively. In contrast, GAPDH displayed the largest fluctuations in Ct values at 2, 4, and 8 h, while B2M exhibited the most significant changes at 12 h.
In CAK cells, B2M and Actin exhibited minimal variation in Ct values at 2 and 4 h, suggesting strong expression stability at these early time points. Meanwhile, TTLL1 demonstrated the greatest changes. At 8 and 12 h post-stimulation, EF1A and RPL13 maintained stability, whereas Actin and GAPDH displayed the largest variations in Ct values.

3.3. Gene Expression Stability in CAB and CAK Cells

3.3.1. Consistency of Reference Gene Expression in CAB and CAK Cells Under Basal Physiological Conditions

To ensure the accurate normalization of gene expression in CAB and CAK cells under normal physiological conditions, we evaluated six candidate reference genes utilizing three distinct computational methods: geNorm, NormFinder, and BestKeeper. In CAB cells, geNorm identified EF1A and RPL13 as the most stable reference genes (Figure S2A). Pairwise variation analysis showed that the V2/3 ratio remained below 0.15, revealing the importance of using a combination of two reference genes for accurate normalization (Figure 1). NormFinder ranked the six reference genes based on stability, with Actin being the most suitable (stability value 0.436), followed by RPL13, TTLL1, EF1A, GAPDH, and B2M (Supplemental Table S1). BestKeeper results further validated RPL13 as the most reliable gene, with a low standard deviation (SD = 0.30), followed by EF1A, GAPDH, TTLL1, Actin, and B2M (Supplemental Table S2). In conclusion, across all three algorithms, RPL13 consistently emerged as the most stable reference gene, while B2M was ranked as the least stable (Table 3).
A similar evaluation in CAK cells under normal conditions yielded comparable results. Using geNorm, NormFinder, and BestKeeper, RPL13 was ranked as the most stable gene, followed by Actin, EF1A, B2M, TTLL1, and GAPDH (Figure 1 and Figure S2, Table 2, Tables S1 and S2). These findings highlight the robust performance of RPL13 as a reference gene in both CAB and CAK cells under normal conditions.

3.3.2. Stability of Reference Gene Transcripts in CAB and CAK Cells Following LPS Stimulation

At 2, 4, 8, and 12 h after LPS stimulation, the optimal reference genes for CAB cells analyzed by geNorm were EF1A/Actin, EF1A/TTLL1, EF1A/RPL13, and B2M/TTLL1, respectively (Supplemental Figure S3). Importantly, V2/3 values remained below 0.15, indicating that the use of two reference genes ensures reliable normalization (Figure 2A). The analysis of NormFinder evaluated TTLL1 as the optimal reference gene for all examined time points post-stimulation (Supplemental Table S3). Moreover, B2M was singled out by BestKeeper as the superior reference gene at 2 and 4 h post-stimulation, with SD values of 0.71 and 0.50, respectively. Additionally, TTLL1 was identified as the most appropriate reference gene at 8 and 12 h post-stimulation, with SD values of 0.55 and 1.13, respectively (Supplemental Table S4). Collectively, TTLL1 stands out as the most suitable reference gene for CAB cells after LPS stimulation according to comprehensive analysis (Table 4).
Similarly, in CAK cells under LPS stimulation, the most stable reference genes were assessed using geNorm (Figure 2B and Figure S4), NormFinder (Supplemental Table S3) and BestKeeper (Supplemental Table S4). Following a similar analysis, RPL13 was evaluated as the most suitable candidate for CAK cells (Table 4).

3.3.3. Reference Gene Expression Stability in CAB and CAK Cells Stimulated by Poly I: C

GeNorm identified EF1A/RPL13 as the optimal reference gene pair for CAB cells at 2 and 4 h after Poly I: C stimulation, while EF1A/B2M and Actin/B2M were suitable at 8 and 12 h, respectively (Figure S5). Additionally, the V2/3 values across all time points remained below 0.15 (Figure 3A). NormFinder analysis further supported the stability of RPL13 as the most suitable reference gene at all time points, except at 8 h, where its stability was slightly reduced (Supplemental Table S3). According to BestKeeper, EF1A was deemed to be the optimal candidate gene at 2, 4, and 8 h post-stimulation, with SD values of 0.33, 0.49, and 0.42, respectively, while TTLL1 was preferred at 12 h, with an SD value of 0.39 (Supplemental Table S4). In general, EF1A was recognized as a suitable reference gene for CAB cells after Poly I: C stimulation across all time points (Table 4).
Similarly, in CAK cells, Actin emerged as the most optimal reference gene after Poly I: C stimulation, according to the integrated analysis from geNorm (Figure 3B and Figure S6), NormFinder (Supplemental Table S3), and BestKeeper (Supplemental Table S4 and Table 4).

3.4. Validation of Selected Reference Genes in CAB and CAK Cells

It was determined by pairwise variation analysis that two pairs of the most stable reference genes were adequate for accurate gene expression normalization. To further validate the dependability of these chosen reference genes, we calibrated the expression of genes using two pairs of the most stable genes and the most unstable genes for comparison.
As shown in Table 4, following the exposure of CAB cells to Poly I: C and LPS, EF1A/RPL13 and TTLL1/B2M were identified as the most stable reference gene pairs, while GAPDH exhibited the least stability. For CAK cells after Poly I: C and LPS stimulation, the most stable reference genes were Actin/B2M and RPL13/B2M, while TTLL1 and EF1A showed the least stability.
In CAB cells treated with Poly I: C, the expression of IL-6 and IFN-h was significantly upregulated when EF1A/RPL13 were used as reference genes. The upregulation gradually decreased with extended stimulation. In contrast, using GAPDH as a reference gene produced a different expression pattern, peaking at 8 h, with consistently higher fold changes in IL-6 and IFN-h compared to the results from RPL13/EF1A or their combined (Figure 4A,B). Similarly, using TTLL1 and B2M as reference genes in CAB cells stimulated with LPS resulted in changes in IL-6 and IFN-h expression. However, GAPDH led to a significantly higher and inconsistent change in the expression of two target genes (Figure 4C,D).
The same irregular expression patterns were observed in CAK cells stimulated with LPS or Poly I: C when unstable reference genes were used (Figure 5). Overall, normalizing gene expression with stable reference genes, or their combinations, ensured consistent and reliable expression profiles. In contrast, the use of unstable reference genes, such as GAPDH, resulted in significant variations and anomalous patterns that deviated from those observed with stable references.

4. Discussion

The selection of appropriate reference genes is critical in ensuring the dependability and accuracy of qRT-PCR experimental results. However, no universally ideal reference gene has been identified in fish cell lines [28]. Hence, it is important to select appropriate reference genes that align with particular experimental situations to achieve valid normalization and accurate data interpretation. There has been much research on the selection of reference genes in diversiform species, experimental situations, cell types, and tissues [29]. However, a comprehensive analysis of reference genes for humpback grouper cell lines has not yet been conducted. In this research, we assessed the expression stability of six commonly used reference genes, including Actin, B2M, RPL13, GAPDH, TTLL1, and EF1A, in CAB and CAK cell lines under both normal conditions and stimulation with LPS or Poly I: C.
LPS, a major component of the outer membrane of Gram-negative bacteria, consists of lipids and polysaccharides. It can induce pro-inflammatory responses in infected hosts and is commonly used to establish inflammatory models [30,31]. Researchers found that β-MG was the optimum reference gene in Nile tilapia head kidney lymphocytes in both the resting state and LTA stimulation state, but after LPS stimulation, GAPDH was the optimum [32]. Poly I:C, a synthetic analog of viral double-stranded RNA (dsRNA), has a molecular pattern associated with viral infection that can activate anti-infective innate immunity [33]. In Trachinotus ovatus, researchers found that B2M and 18S were the most stable genes across tissue types under normal physiological conditions. However, during poly I:C stimulation, no single gene or single pair of reference genes could serve as a universal reference across all tissue types [34]. Similarly, in this study, we found that RPL13 was the most stable reference gene for both CAB and CAK cells under normal conditions. However, after LPS stimulation, TTLL1 and RPL13 were the best reference genes for CAB and CAK cells. After poly I:C stimulation, EF1A and Actin were identified as the most stable reference genes for CAB and CAK cells.
To assess the stability of candidate reference genes, we employed three statistical models: geNorm, NormFinder, and BestKeeper. Variations in gene rankings across these algorithms arise from differences in their algorithmic logic and scaling systems [35,36]. For instance, in healthy goldfish (Carassius auratus), BestKeeper and geNorm both ranked EF1A as the most stable gene, while NormFinder identified 18S as the most stable [37]. Similarly, in our study, RPL13 emerged as the most stable reference gene in CAB cells based on geNorm and BestKeeper, whereas NormFinder preferred Actin. In CAK cells, RPL13 was deemed as the top stable gene according to NormFinder and BestKeeper, while geNorm preferred EF1A/Actin. Despite these differences, both geNorm and BesrKeeper concurred that RPL13 emerged as the optimal reference gene in CAB cells. Similarly, in CAK cells, NormFinder and BestKeeper agreed that RPL13 was the best reference gene. Therefore, we comprehensively analyzed the evaluation results of these three software tools. In both CAB and CAK cell lines, RPL13 consistently emerged as the most stable gene under normal conditions. Consistent with our findings, RPL13 was also identified as the most suitable reference gene in golden pompano snout, head, and kidney cell lines under normal physiological conditions [38].
Numerous studies have shown that reference gene stability varies across different cell types, tissues, and experimental conditions [39,40]. For example, in the skeletal muscle cells of cattle, GAPDH and RPS15A were the most stable reference gene combinations during in vitro proliferation, while RPS15A and RPS9 were the most stable reference gene combinations during in vitro induction [29]. In our study, TTLL1 and EF1A were the most stable reference genes in CAB cells following LPS and Poly I: C stimulation, respectively. Similarly to in our results, EF1A was the most stable reference gene in grass carp kidney cells stimulated by Poly I: C or GCIV [41]. Furthermore, in the salmonid cell lines CHSE-214 and RTS11, EF1A was the most suitable reference gene after infection with Piscirickettsia salmonis and the aquabirnavirus IPNV [42]. Conversely, in CAK cells, RPL13 and Actin were the most stable reference genes under the same conditions. In line with our results, Actin was identified as the most stable reference gene in rainbow trout embryonic cells exposed to TPhP [43]. Moreover, RPL13 was optimal in Sf9 cells treated with the apoptotic agent camptothecin [44].
To assess the reliability of the selected stable reference gene in CAB and CAK cells under LPS or Poly I: C stimulation, we assessed the expression of two immune-related genes, IL-6 and IFN-h. The use of stable reference genes, or their combinations, produced consistent and reliable expression patterns. In contrast, the use of unstable reference genes led to aberrant expression patterns for target genes. These findings were consistent with previous studies that investigated the relative quantification of three induction genes (PePYL1, PeSCOF-1, and PeSCL7) using different reference genes. The results showed that stable internal references produced expression profiles closer to expected values compared to the less suitable reference gene [45,46]. These findings illuminate the necessity for reliable normalization in qRT-PCR experiments and establish a solid foundation for future gene expression analysis in humpback grouper cell lines.

5. Conclusions

In this research, we conducted a thorough analysis of the expression stability of six potential reference genes in CAB and CAK cells by geNorm, Normfinder, and BestKeeper. Our findings confirmed that, under normal physiological conditions, RPL13 exhibited the greatest stability of expression in both CAB and CAK cells. Furthermore, when the cells were exposed to LPS stimulation, TTLL1 and RPL13 emerged as the most suitable candidate genes in CAB and CAK cells, whereas under Poly I: C stimulation, EF1A and Actin were evaluated as the most appropriate reference genes for CAB and CAK cells. To further validate these results, we conducted a normalization analysis of two immunity genes (IL-6 and IFN-h) through screening stable candidates. In summary, our study revealed significant differences in the expression stability of the candidate genes across various experimental conditions and cell types. These results will serve as a valuable reference for future gene expression analyses in humpback grouper cell lines.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/fishes9120491/s1, Table S1. NormFinder evaluated the steadiness of expression for potential housekeeping genes in CAB and CAK cells under standard conditions. Table S2. BestKeeper analysis was used to evaluate the steadiness of expression for potential housekeeping genes in CAB and CAK cells under standard conditions. Table S3. Expression stability of candidate housekeeping genes in CAB and CAK cells following LPS or Poly I: C stimulation for 2, 4, 8, and 12 h, as assessed by NormFinder. Table S4. Expression stability of candidate housekeeping genes in CAB and CAK cells following LPS or Poly I: C stimulation for 2, 4, 8, and 12 h, as assessed by BestKeeper analysis. Figure S1. Analysis of agarose gel of total RNA extracted from CAB and CAK cell lines. Figure S2. Evaluating the stability of potential housekeeping gene expressions in CAB cells (A) and CAK cells (B) under standard conditions utilized geNorm. Figure S3. geNorm was used to evaluate the steadiness of housekeeping gene candidates in CAB cells when stimulated with LPS for durations of 2 (A), 4 (B), 8 (C), and 12 h (D). Figure S4. geNorm was used to evaluate the steadiness of housekeeping gene candidates in CAK cells when stimulated with LPS for durations of 2 (A), 4 (B), 8 (C), and 12 h (D). Figure S5. geNorm was used to evaluate the steadiness of housekeeping gene candidates in CAB cells when stimulated with Poly I: C for durations of 2 (A), 4 (B), 8 (C), and 12 h (D). Figure S6. geNorm was used to evaluate the steadiness of housekeeping gene candidates in CAK cells when stimulated with Poly I: C for durations of 2 (A), 4 (B), 8 (C), and 12 h (D).

Author Contributions

X.D.: Conceptualization, Formal analysis, Writing—original draft. H.Z.: Conceptualization, Formal analysis. L.Z.: Supervision. Y.Z.: Conceptualization. Z.C.: Conceptualization. C.Z.: Supervision. Y.W.: Formal analysis. Y.S.: Conceptualization, Project administration. All authors contributed to the article and approved the submitted version. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by National Natural Science Foundation of China (U22A20534) and Innovational Fund for Scientific and Technological Personnel of Hainan Province (KJRC2023C38).

Institutional Review Board Statement

Not applicable.

Data Availability Statement

The authors declare that all data supporting the findings of this study are available within the article.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Valasek, M.A.; Repa, J.J. The power of real-time PCR. Adv. Physiol. Educ. 2005, 29, 151–159. [Google Scholar] [CrossRef] [PubMed]
  2. Zhao, X.; Geng, Y.; Hu, T.; Zhao, Y.; Yang, S.; Hao, D. Evaluation of Optimal Reference Genes for qRT-PCR Analysis in Hyphantria cunea (Drury). Insects 2022, 13, 97. [Google Scholar] [CrossRef] [PubMed]
  3. Bustin, S.A.; Benes, V.; Nolan, T.; Pfaffl, M.W. Quantitative real-time RT-PCR--a perspective. J. Mol. Endocrinol. 2005, 34, 597–601. [Google Scholar] [CrossRef] [PubMed]
  4. Chen, W.F.; Fu, W.F.; Zeng, Z.Y.; Guo, S.Q.; Yan, Y.L.; Tu, Y.F.; Gou, T.G.; Zhang, Q.Z. Establishment and application of a TaqMan probe-based qPCR for the detection of Enterocytozoon hepatopenaei in shrimp Litopenaeus vannamei. Parasitol. Res. 2022, 121, 2263–2274. [Google Scholar] [CrossRef]
  5. Najafpanah, M.J.; Sadeghi, M.; Bakhtiarizadeh, M.R. Reference genes selection for quantitative real-time PCR using RankAggreg method in different tissues of Capra hircus. PLoS ONE 2013, 8, e83041. [Google Scholar] [CrossRef]
  6. Yang, Y.W.; Chen, M.K.; Yang, B.Y.; Huang, X.J.; Zhang, X.R.; He, L.Q.; Zhang, J.; Hua, Z.C. Use of 16S rRNA gene-targeted group-specific primers for Real-Time PCR analysis of predominant bacteria in mouse feces. Appl. Environ. Microbiol. 2015, 81, 6749–6756. [Google Scholar] [CrossRef]
  7. Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 2005, 6, 279–284. [Google Scholar] [CrossRef]
  8. Chapman, J.R.; Waldenström, J. With reference to reference genes: A systematic review of endogenous controls in gene expression studies. PLoS ONE 2015, 10, e0141853. [Google Scholar] [CrossRef]
  9. Wang, X.; Peng, F.; Dong, G.; Sun, Y.; Dai, X.; Yang, Y.; Liu, X.; Bai, Z. Identification and validation of appropriate reference genes for qRT-PCR analysis in Corynebacterium glutamicum. FEMS Microbiol. Lett. 2018, 365, fny030. [Google Scholar] [CrossRef]
  10. Su, R.R.; Huang, Z.Y.; Qin, C.W.; Zheng, X.L.; Lu, W.; Wang, X.Y. Evaluation of reference genes in glenea cantor (Fabricius) by using qRT-PCR. Genes 2021, 12, 1984. [Google Scholar] [CrossRef] [PubMed]
  11. Thellin, O.; Zorzi, W.; Lakaye, B.; De Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol. 1999, 75, 291–295. [Google Scholar] [CrossRef] [PubMed]
  12. Butte, A.J.; Dzau, V.J.; Glueck, S.B. Further defining housekeeping, or “maintenance,” genes focus on “A compendium of gene expression in normal human tissues”. Physiol. Genom. 2001, 7, 95–96. [Google Scholar] [CrossRef] [PubMed]
  13. Gao, Z.H.; Wei, J.H.; Yang, Y.; Zhang, Z.; Zhao, W.T. Selection and validation of reference genes for studying stress-related agarwood formation of Aquilaria sinensis. Plant Cell Rep. 2012, 31, 1759–1768. [Google Scholar] [CrossRef] [PubMed]
  14. Płachetka-Bożek, A.; Augustyniak, M. Evaluation of candidate reference genes for quantitative gene expression analysis in Spodoptera exigu a after long-time exposure to cadmium. Sci. Rep. 2017, 7, 8338. [Google Scholar] [CrossRef] [PubMed]
  15. Zhao, Y.; Luo, J.; Xu, S.; Wang, W.; Liu, T.; Han, C.; Chen, Y.; Kong, L. Selection of reference genes for gene expression normalization in Peucedanum praeruptorum Dunn. under abiotic stresses, hormone treatments and different tissues. PLoS ONE 2016, 11, e0152356. [Google Scholar] [CrossRef]
  16. Li, L.; Tian, Y.; Li, Z.; Li, Z.; Duan, P.; Wang, X.; Chen, S.; Wang, L.; Wang, Q.; Zhai, J. Cryopreservation of embryos of humpback grouper (Cromileptes altivelis) using combinations of non-permeating cryoprotectants. Aquaculture 2022, 548, 737524. [Google Scholar] [CrossRef]
  17. Liu, J.; Sun, H.; Tang, L.; Wang, Y.; Wang, Z.; Mao, Y.; Huang, H.; Zhang, Q. Chromosome-level genome assembly of humpback grouper using PacBio HiFi reads and Hi-C technologies. Sci. Data 2024, 11, 51. [Google Scholar] [CrossRef]
  18. Mu, W.; Wang, X.; Wu, X.; Li, X.; Dong, Y.; Geng, L.; Ma, L.; Ye, B. The optimal arginine requirement in diets for juvenile humpback grouper, Cromileptes altivelis. Aquaculture 2020, 514, 734509. [Google Scholar] [CrossRef]
  19. Subekti, S.; Amiin, M.K.; Ardiyanti, H.B.; Yudarana, M.A.; Achmadi, I.; Akbar, R.E.K. Molecular epidemiology of helminth diseases of the humpback grouper, Cromileptes altivelis, as a pattern for mapping fish diseases in the Sunda Strait, Indonesia. Vet. World 2021, 14, 1324–1329. [Google Scholar] [CrossRef]
  20. Sun, Y.; Xiang, Y.; He, M.; Zhang, X.; Wang, S.; Guo, W.; Liu, C.; Cao, Z.; Zhou, Y. Evaluation of Lactococcus lactis HNL12 combined with Schizochytrium limacinum algal meal in diets for humpback grouper (Cromileptes altivelis). Fish Shellfish Immunol. 2019, 94, 880–888. [Google Scholar] [CrossRef]
  21. Wang, L.; Cao, Z.; Liu, Y.; Xiang, Y.; Sun, Y.; Zhou, Y.; Wang, S.; Guo, W. Establishment and characterization of a new cell line from the muscle of humpback grouper (Cromileptes altivelis). Fish Physiol. Biochem. 2020, 46, 1897–1907. [Google Scholar] [CrossRef] [PubMed]
  22. Jia, P.; Jin, F.; Xiang, Y.; Li, J.; Pan, H.; Cui, K.; Yi, M.; Jia, K. Establishment and characterization of a fin cell line from yellowfin sea bream (Acanthopagrus latus) and its application to fish virology and toxicology. Aquaculture 2022, 549, 737801. [Google Scholar] [CrossRef]
  23. Liu, Y.; Wei, C.; Liu, Z.; Cao, Z.; Sun, Y.; Zhou, Y.; Wang, S.; Guo, W. Establishment of a new fish cell line from the brain of humpback grouper (Cromileptes altivelis) and its application in toxicology and bacterial susceptibility. Fish Physiol. Biochem. 2021, 47, 1645–1658. [Google Scholar] [CrossRef] [PubMed]
  24. Wei, C.; Yang, X.; Kang, M.; Cao, Z.; Sun, Y.; Zhou, Y. An established kidney cell line from humpback grouper (Cromileptes altivelis) and its susceptibility to bacteria and heavy metals. Fish Physiol. Biochem. 2022, 48, 521–533. [Google Scholar] [CrossRef]
  25. Chen, X.; Sun, Y.; Zhang, P.; Li, J.; Li, H.; Wei, C.; Cao, Z.; Zhou, Y. Screening of stable internal reference genes by quantitative real-time PCR in humpback grouper Cromileptes altivelis. J. Oceanol. Limnol. 2021, 39, 1985–1999. [Google Scholar] [CrossRef]
  26. Uciechowski, P.; Dempke, W.C.M. Interleukin-6: A masterplayer in the cytokine network. Oncology 2020, 98, 131–137. [Google Scholar] [CrossRef]
  27. Lu, X.; Hu, Z.; Qin, Z.; Huang, H.; Yang, T.; Yi, M.; Jia, K. IFNh and IRF9 influence the transcription of MHCII mediated by IFNγ to maintain immune balance in sea perch Lateolabrax japonicus. Fish Shellfish Immunol. 2024, 153, 109857. [Google Scholar] [CrossRef]
  28. Lee, P.D.; Sladek, R.; Greenwood, C.M.; Hudson, T.J. Control genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studies. Genome Res. 2002, 12, 292–297. [Google Scholar] [CrossRef] [PubMed]
  29. Wang, G.H.; Liang, C.C.; Li, B.Z.; Du, X.Z.; Zhang, W.Z.; Cheng, G.; Zan, L.S. Screening and validation of reference genes for qRT-PCR of bovine skeletal muscle-derived satellite cells. Sci. Rep. 2022, 12, 5653. [Google Scholar] [CrossRef]
  30. Dickson, K.; Lehmann, C. Inflammatory response to different toxins in experimental sepsis models. Int. J. Mol. Sci. 2019, 20, 4341. [Google Scholar] [CrossRef]
  31. Qureshi, S.T.; Gros, P.; Malo, D. The Lps locus: Genetic regulation of host responses to bacterial lipopolysaccharide. Inflamm. Res. 1999, 48, 613–620. [Google Scholar] [CrossRef]
  32. Jiang, B.J.; Li, Q.; Zhang, Z.Q.; Huang, Y.X.; Wu, Y.Q.; Li, X.; Huang, M.L.; Huang, Y.; Jian, J.C. Selection and evaluation of stable reference genes for quantitative real-time PCR in the head kidney leukocyte of Oreochromis niloticus. Aquac. Rep. 2023, 31, 101660. [Google Scholar] [CrossRef]
  33. Chen, X.; Liu, X.; Cai, D.; Wang, W.; Cui, C.; Yang, J.; Xu, X.; Li, Z. Sequencing-based network analysis provides a core set of genes for understanding hemolymph immune response mechanisms against Poly I:C stimulation in Amphioctopus fangsiao. Fish Shellfish Immunol. 2023, 133, 108544. [Google Scholar] [CrossRef]
  34. Chen, X.J.; Zhang, X.Q.; Huang, S.; Cao, Z.J.; Qin, Q.W.; Hu, W.T.; Sun, Y.; Zhou, Y.C. Selection of reference genes for quantitative real-time RT-PCR on gene expression in Golden Pompano (Trachinotus ovatus). Pol. J. Vet. Sci. 2017, 20, 583–594. [Google Scholar] [CrossRef]
  35. Zhai, Y.; Lin, Q.; Zhou, X.; Zhang, X.; Liu, T.; Yu, Y. Identification and validation of reference genes for quantitative real-time PCR in Drosophila suzukii (Diptera: Drosophilidae). PLoS ONE 2014, 9, e106800. [Google Scholar] [CrossRef]
  36. Sagri, E.; Koskinioti, P.; Gregoriou, M.E.; Tsoumani, K.T.; Bassiakos, Y.C.; Mathiopoulos, K.D. Housekeeping in Tephritid insects: The best gene choice for expression analyses in the medfly and the olive fly. Sci. Rep. 2017, 7, 45634. [Google Scholar] [CrossRef]
  37. Dharmaratnam, A.; Sudhagar, A.; Nithianantham, S.R.; Das, S.; Swaminathan, T.R. Evaluation of candidate reference genes for quantitative RTqPCR analysis in goldfish (Carassius auratus L.) in healthy and CyHV-2 infected fish. Vet. Immunol. Immunopathol. 2021, 237, 110270. [Google Scholar] [CrossRef]
  38. Zhao, N.; Zhang, H.; Zhu, L.; Hou, Y.; Wu, Y.; Cao, Z.; Sun, Y. Selection and verification of reference genes for gene expression studies in different cell lines of golden pompano (Trachinotus ovatus). Fishes 2022, 8, 8. [Google Scholar] [CrossRef]
  39. González-Bermúdez, L.; Anglada, T.; Genescà, A.; Martín, M.; Terradas, M. Identification of reference genes for RT-qPCR data normalisation in aging studies. Sci. Rep. 2019, 9, 13970. [Google Scholar] [CrossRef]
  40. Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, Research0034. [Google Scholar] [CrossRef]
  41. Su, J.; Zhang, R.; Dong, J.; Yang, C. Evaluation of internal control genes for qRT-PCR normalization in tissues and cell culture for antiviral studies of grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2011, 30, 830–835. [Google Scholar] [CrossRef] [PubMed]
  42. Peña, A.A.; Bols, N.C.; Marshall, S.H. An evaluation of potential reference genes for stability of expression in two salmonid cell lines after infection with either Piscirickettsia salmonis or IPNV. BMC Res. Notes 2010, 3, 101. [Google Scholar] [CrossRef] [PubMed]
  43. Germain, L.; Pereira, D.; Winn, L.M. Reference gene considerations for toxicological assessment of the flame retardant triphenyl phosphate in an in vitro fish embryonic model. J. Appl. Toxicol. 2024. online ahead of print. [Google Scholar] [CrossRef]
  44. Shu, B.; Zhang, J.; Zeng, J.; Cui, G.; Zhong, G. Stability of selected reference genes in Sf9 cells treated with extrinsic apoptotic agents. Sci. Rep. 2019, 9, 14147. [Google Scholar] [CrossRef] [PubMed]
  45. Chen, Y.; Tan, Z.; Hu, B.; Yang, Z.; Xu, B.; Zhuang, L.; Huang, B. Selection and validation of reference genes for target gene analysis with quantitative RT-PCR in leaves and roots of bermudagrass under four different abiotic stresses. Physiol. Plant. 2015, 155, 138–148. [Google Scholar] [CrossRef]
  46. Wang, H.L.; Chen, J.; Tian, Q.; Wang, S.; Xia, X.; Yin, W. Identification and validation of reference genes for Populus euphratica gene expression analysis during abiotic stresses by quantitative real-time PCR. Physiol. Plant. 2014, 152, 529–545. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Evaluation of the stability of reference genes in CAB cells and CAK cells under standard conditions by geNorm.
Figure 1. Evaluation of the stability of reference genes in CAB cells and CAK cells under standard conditions by geNorm.
Fishes 09 00491 g001
Figure 2. Evaluation of the stability of reference genes in CAB (A) and CAK (B) cells treated with LPS by geNorm.
Figure 2. Evaluation of the stability of reference genes in CAB (A) and CAK (B) cells treated with LPS by geNorm.
Fishes 09 00491 g002
Figure 3. Evaluation of the stability of reference genes in CAB (A) and CAK (B) cells treated with Poly I: C by geNorm.
Figure 3. Evaluation of the stability of reference genes in CAB (A) and CAK (B) cells treated with Poly I: C by geNorm.
Fishes 09 00491 g003
Figure 4. Expression profiles of target genes under Poly I: C or LPS stimulation in CAB cells, using screened genes as internal references. (A,B) The relative expression levels of IL-6 and IFN-h in CAB cells upon Poly I: C treatment. (C,D) The relative expression levels of IL-6 and IFN-h in CAB cells upon LPS treatment. All values are the mean ± SD (n = 3). Statistically significant differences among conditions are denoted by different letters (p < 0.05).
Figure 4. Expression profiles of target genes under Poly I: C or LPS stimulation in CAB cells, using screened genes as internal references. (A,B) The relative expression levels of IL-6 and IFN-h in CAB cells upon Poly I: C treatment. (C,D) The relative expression levels of IL-6 and IFN-h in CAB cells upon LPS treatment. All values are the mean ± SD (n = 3). Statistically significant differences among conditions are denoted by different letters (p < 0.05).
Fishes 09 00491 g004
Figure 5. Expression profiles of target genes under Poly I: C or LPS stimulation in CAK cells, using screened genes as internal references. (A,B) The relative expression levels of IL-6 and IFN-h in CAK cells upon Poly I: C treatment. (C,D) The relative expression levels of IL-6 and IFN-h in CAK cells upon LPS treatment. All values are the mean ± SD (n = 3). Statistically significant differences among conditions are denoted by different letters (p < 0.05).
Figure 5. Expression profiles of target genes under Poly I: C or LPS stimulation in CAK cells, using screened genes as internal references. (A,B) The relative expression levels of IL-6 and IFN-h in CAK cells upon Poly I: C treatment. (C,D) The relative expression levels of IL-6 and IFN-h in CAK cells upon LPS treatment. All values are the mean ± SD (n = 3). Statistically significant differences among conditions are denoted by different letters (p < 0.05).
Fishes 09 00491 g005
Table 1. Primer sequences of housekeeping genes.
Table 1. Primer sequences of housekeeping genes.
GenePrimer Sequence (5′→3′)
ActinF:CTGCGGAATCCATGAGACCA
R:CATCGTACTCCTGCTTGCTGA
B2MF:CCGTCAATGGCTAAAGATGC
R:CAATGGTGATTTCTGGTGGGT
GAPDHF:CAAATACGACGACATCAAGAAGGT
R:ATCCGAACTCGTTGTCATACCAT
TTLL1F:CACCCTCAACATCGTCACTCC
R:AGGTCACGCTCGGCATTCT
RPL13F:CGGACGTGGCTTCACTCTG
R:CTTGATGGGCATGACTGGAC
EF1AF:CAACTTCAACGCCCAGGTCA
R:CTCATGTCACGCACAGCAAAA
Table 2. Expression abundance of six housekeeping genes in CAB cells under normal conditions and stimulation with LPS or Poly I: C conditions for 2, 4, 8, and 12 h. Values are shown as means ± SD (N = 3).
Table 2. Expression abundance of six housekeeping genes in CAB cells under normal conditions and stimulation with LPS or Poly I: C conditions for 2, 4, 8, and 12 h. Values are shown as means ± SD (N = 3).
Reference GeneTreatmentsCABCAK
2 h4 h8 h12 h2 h4 h8 h12 h
ActinPBS12.8 ± 0.513.2 ± 0.912.2 ± 0.513.0 ± 0.912.6 ± 0.712.4 ± 1.012.8 ± 0.512.1 ± 0.6
LPS10.7 ± 0.810.5 ± 0.510.8 ± 0.39.6 ± 0.513.7 ± 0.411.7 ± 0.311.5 ± 1.011.7 ± 0.4
Poly I: C12.0 ± 0.212.1 ± 0.310.9 ± 0.811.4 ± 0.813.4 ± 0.312.4 ± 0.410.7 ± 0.211.6 ± 0.4
B2MPBS19.8 ± 0.618.1 ± 1.118.2 ± 1.319.7 ± 0.519.3 ± 0.919.4 ± 0.619.2 ± 0.919.0 ± 0.6
LPS18.4 ± 0.618.0 ± 0.218.2 ± 0.317.3 ± 0.320.3 ± 0.519.8 ± 0.319.1 ± 0.819.1 ± 0.3
Poly I: C18.9 ± 0.218.7 ± 0.317.4 ± 0.818.0 ± 1.019.0 ± 0.019.0 ± 1.117.4 ± 0.118.0 ± 0.5
GAPDHPBS27.4 ± 0.526.9 ± 0.627.0 ± 0.128.2 ± 0.429.8 ± 0.430.5 ± 1.131.7 ± 2.230.5 ± 1.1
LPS30.6 ± 0.931.7 ± 0.832.3 ± 0.631.7 ± 0.430.4 ± 1.530.2 ± 0.130.6 ± 0.430.3 ± 1.0
Poly I: C29.3 ± 0.229.9 ± 0.529.2 ± 0.730.5 ± 1.630.5 ± 1.330.0 ± 2.130.3 ± 0.128.1 ± 0.5
RPL13PBS15.3 ± 0.614.6 ± 0.915.1 ± 0.215.5 ± 0.414.5 ± 0.614.4 ± 0.414.6 ± 0.514.7 ± 0.4
LPS13.3 ± 0.613.6 ± 0.013.1 ± 0.712.6 ± 0.615.6 ± 1.314.1 ± 0.114.3 ± 0.914.2 ± 0.4
Poly I: C14.9 ± 0.314.9 ± 0.713.6 ± 0.914.5 ± 1.215.7 ± 0.715.2 ± 1.214.3 ± 0.714.5 ± 0.3
EF1APBS13.4 ± 0.612.6 ± 1.113.2 ± 0.213.6 ± 0.412.1 ± 0.912.4 ± 0.912.2 ± 0.811.9 ± 0.5
LPS11.3 ± 0.811.0 ± 0.311.4 ± 0.210.4 ± 0.711.9 ± 0.711.4 ± 0.210.6 ± 0.310.5 ± 0.3
Poly I: C12.9 ± 0.312.9 ± 0.212.4 ± 0.212.3 ± 0.911.2 ± 0.111.4 ± 0.312.1 ± 0.010.5 ± 0.1
TTLL1PBS27.2 ± 0.327.3 ± 1.026.9 ± 0.626.2 ± 0.927.8 ± 0.828.4 ± 1.027.9 ± 0.828.4 ± 1.2
LPS25.4 ± 1.025.7 ± 0.525.9 ± 0.323.9 ± 0.629.7 ± 0.028.2 ± 0.127.7 ± 0.927.1 ± 0.3
Poly I: C27.8 ± 0.228.5 ± 0.227.5 ± 0.726.5 ± 0.230.2 ± 0.429.8 ± 1.128.8 ± 0.328.7 ± 0.3
Note: CAK represents the Cromileptes altivelis kidney cell line, and CAB represents the Cromileptes altivelis brain cell line.
Table 3. The comprehensive ranking of reference genes in CAB and CAK cells under normal conditions based on three algorithm analyses.
Table 3. The comprehensive ranking of reference genes in CAB and CAK cells under normal conditions based on three algorithm analyses.
Cell LineRanking OrdergeNormNormFinderBestKeeperRecommended
Comprehensive
Ranking
CAB1EF1A/RPL13ActinRPL13RPL13
2 RPL13EF1AEF1A
3ActinTTLL1GAPDHActin
4TTLL1EF1ATTLL1TTLL1
5B2MGAPDHActinGAPDH
6GAPDHB2MB2MB2M
CAK1EF1A/ActinRPL13RPL13RPL13
2 TTLL1ActinActin
3B2MB2MB2MEF1A
4RPL13EF1AEF1AB2M
5TTLL1ActinTTLL1TTLL1
6GAPDHGAPDHGAPDHGAPDH
Table 4. The comprehensive ranking of reference genes in CAB and CAK cells under LPS and Poly I: C stimulation at 2, 4, 8, and 12 h, based on three algorithm analyses.
Table 4. The comprehensive ranking of reference genes in CAB and CAK cells under LPS and Poly I: C stimulation at 2, 4, 8, and 12 h, based on three algorithm analyses.
Cell LineStimulusRanking OrdergeNormNormFinderBestKeeperRecommended Comprehensive Ranking
2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h2 h4 h8 h12 h
CABLPS1EF1A/
Actin
TTLL1/
EF1A
RPL13/
EF1A
TTLL1/
B2M
TTLL1TTLL1TTLL1TTLL1/
B2M
B2MB2MTTLL1TTLL1TTLL1TTLL1TTLL1TTLL1
2 B2MRPL13B2M RPL13RPL13B2MB2MB2MRPL13B2MB2M
3RPL13RPL13ActinRPL13RPL13B2MActinRPL13TTLL1TTLL1ActinRPL13RPL13B2MEF1ARPL13
4TTLL1ActinTTLL1EF1AActinEF1AEF1AEF1AActinEF1AEF1AEF1AActinEF1AActinEF1A
5B2MB2MB2MActinEF1AActinRPL13ActinEF1AActinRPL13ActinEF1AActinRPL13Actin
6GAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDH
Poly I: C1EF1A/
RPL13
EF1A/
RPL13
EF1A/
B2M
Actin/
B2M
RPL13EF1A/
RPL13
EF1ARPL13EF1AEF1AEF1ATTLL1EF1AEF1AEF1AEF1A
2 EF1A B2MEF1ATTLL1RPL13TTLL1EF1ARPL13RPL13B2MRPL13
3ActinB2MActinEF1ATTLL1B2MTTLL1TTLL1RPL13B2MActinRPL13TTLL1B2MActinActin
4B2MTTLL1RPL13RPL13ActinTTLL1ActinActinActinTTLL1B2MActinActinTTLL1TTLL1TTLL1
5TTLL1ActinTTLL1TTLL1B2MActinRPL13B2MB2MActinRPL13B2MB2MActinRPL13B2M
6GAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDHGAPDH
CAKLPS1RPL13/B2MRPL13/TTLL1RPL13/TTLL1RPL13/
Actin
RPL13/B2MRPL13/
TTLL1
GAPDHRPL13/
Actin
EF1ARPL13RPL13B2MRPL13RPL13RPL13RPL13
2 Actin RPL13B2MB2MRPL13B2MTTLL1TTLL1Actin
3ActinGAPDHB2MGAPDHActinGAPDHRPL13GAPDHActinTTLL1TTLL1ActinActinGAPDHB2MB2M
4GAPDHActinGAPDHB2MGAPDHActinTTLL1TTLL1B2MGAPDHActinEF1AGAPDHActinActinGAPDH
5TTLL1EF1AActinTTLL1TTLL1EF1AB2MB2MGAPDHActinEF1AGAPDHEF1AB2MGAPDHTTLL1
6EF1AB2MEF1AEF1AEF1AB2MEF1AEF1ATTLL1EF1AGAPDHTTLL1TTLL1EF1AEF1AEF1A
Poly I: C1Actin/
GAPDH
B2M/
GAPDH
Actin/
B2M
Actin/
RPL13
Actin/
GAPDH
ActinRPL13ActinB2MActinEF1ARPL13ActinActinRPL13Actin
2 B2MGAPDHB2MActinB2MRPL13ActinGAPDHB2MEF1ARPL13
3RPL13ActinGAPDHB2MRPL13GAPDHEF1AEF1AEF1AEF1ATTLL1TTLL1B2MGAPDHB2MB2M
4B2MEF1ARPL13EF1AB2MRPL13B2MRPL13RPL13RPL13B2MB2MRPL13EF1AActinEF1A
5EF1ARPL13EF1ATTLL1EF1AEF1AActinTTLL1GAPDHTTLL1ActinEF1AEF1ARPL13GAPDHTTLL1
6TTLL1TTLL1TTLL1GAPDHTTLL1TTLL1TTLL1GAPDHTTLL1GAPDHGAPDHGAPDHTTLL1TTLL1TTLL1GAPDH
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Du, X.; Zhang, H.; Zhu, L.; Cao, Z.; Zhang, C.; Wu, Y.; Zhou, Y.; Sun, Y. Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes 2024, 9, 491. https://doi.org/10.3390/fishes9120491

AMA Style

Du X, Zhang H, Zhu L, Cao Z, Zhang C, Wu Y, Zhou Y, Sun Y. Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes. 2024; 9(12):491. https://doi.org/10.3390/fishes9120491

Chicago/Turabian Style

Du, Xiangyu, Han Zhang, Longfei Zhu, Zhenjie Cao, Chen Zhang, Ying Wu, Yongcan Zhou, and Yun Sun. 2024. "Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis)" Fishes 9, no. 12: 491. https://doi.org/10.3390/fishes9120491

APA Style

Du, X., Zhang, H., Zhu, L., Cao, Z., Zhang, C., Wu, Y., Zhou, Y., & Sun, Y. (2024). Selection of Reference Genes by Quantitative Real-Time PCR in Different Cell Lines from Humpback Grouper (Cromileptes altivelis). Fishes, 9(12), 491. https://doi.org/10.3390/fishes9120491

Article Metrics

Back to TopTop