Next Article in Journal
Governing Distant-Water Fishing within the Blue Economy in Madagascar: Policy Frameworks, Challenges and Pathways
Next Article in Special Issue
Automated Monitoring of Bluefin Tuna Growth in Cages Using a Cohort-Based Approach
Previous Article in Journal
Hypoxia Activates HIF-1α and Affects Gene Expression and Transcriptional Regulation of PHD in Tegillarca granosa
Previous Article in Special Issue
Seasonal Length–Weight Relationships of European Sea Bass (Dicentrarchus labrax) in Two Aquaculture Production Systems
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 8
Issue 7
10.3390/fishes8070360
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Influences of Aquaponics System on Growth Performance, Antioxidant Parameters, Stress Parameters and Gene Expression of Carassius auratus

by
Hanping Mao
1,*,
Bin Wang
1,
Jian Zhao
2,
Yafei Wang
1,
Xiaoxue Du
1 and
Qiang Shi
3
1
School of Agricultural Engineering, Jiangsu University, Zhenjiang 212013, China
2
College of Biosystems Engineering and Food Science, Zhejiang University, Hangzhou 310000, China
3
School of Science and Technology, Shanghai Open University, Shanghai 200433, China
*
Author to whom correspondence should be addressed.
Fishes 2023, 8(7), 360; https://doi.org/10.3390/fishes8070360
Submission received: 1 June 2023 / Revised: 4 July 2023 / Accepted: 6 July 2023 / Published: 11 July 2023
(This article belongs to the Special Issue Development of Sustainable Aquaculture Production)
Browse Figures
Review Reports Versions Notes

Abstract

:
Aquaponics is a new type of composite farming system, which combines aquaculture and hydroponics through ecological design to achieve scientific synergism. However, the effects of aquaponics on the welfare status and stress parameters of fish are unclear. In this study, 150 crucian carp with an average initial body weight of 7.06 ± 0.32 g were selected. Nine fish were randomly selected as the control group (NC group and hypoxia group) for stress, antioxidant and gene expression parameters after acclimation and hypoxia stress, respectively. The remaining crucian carps were randomly divided into three experimental groups with 20 crucian carps in each group (T0, T1 and T2, respectively), with three replicates. The fresh weight of the lettuce root in the T2 group had no significant effect (p > 0.05). Compared with the control group (T0 and T1), there were significant differences in the specific growth rate, the weight gain rate, the fresh leaf weight, the chlorophyll content and the water quality parameters in group T2 (p < 0.05). Regarding the biochemical parameters, superoxide dismutase and catalase showed significant differences between the T2 and T1 groups (p < 0.05). At the same time, the HSP70 and Prdx3 genes were upregulated in the liver of the T2 group compared to the NC group and the hypoxia group. The research suggests that aquaponics may reduce the hypoxia stress of crucian carp without affecting the growth of crucian carp and lettuce.
Keywords:
crucian carp; stress; antioxidant; aquaponics
Key Contribution: The symbiotic relationship between crucian carp and lettuce can ensure the growth parameters of lettuce and improve the living environment of crucian carp. We have demonstrated through growth parameters, physiological parameters and gene expression profiles that the fish–vegetable symbiosis model may alleviate the stress of crucian carp to a certain extent.

Graphical Abstract

1. Introduction

Aquaponics is a compound culture system and a recent variation on the RAS systems. It is considered a promising and emerging system that combines intensive production with water conservation [1]. The aquaculture wastewater in the complex aquaculture system is not discharged to the outside. Insoluble large-particle feces produced by the fish are separated by physical filtration. The nitrifying bacteria are attached to the biochemical filtration system, and soluble wastes (such as ammonia nitrogen) are converted into nitrates through the nitrification of the nitrifying bacteria, which are then absorbed and used by the plants, while the purified water is returned to the fish pond [2]. When the system is stable, fish, microbes and aquatic plants can achieve a harmonious symbiotic relationship [3,4].
There are many important environmental factors affecting fish growth in an aquaponics system, such as the water temperature and oxygen [5,6]. An unsuitable water environment can cause fish to produce a stress response [7,8]. The aquaponics model may alleviate this problem to some extent. At present, the aquatic plants in the hydroponic system are mostly green leafy vegetables, such as lettuce [9], spinach [1], sweet pepper [2] and so on. Therefore, the aquaponics model has been vigorously developed. Some researchers have shown that aquatic plants can play certain roles in water quality regulation [10,11], such as increasing the oxygen content and cooling, shading and avoiding light.
The selection of fish in the aquaponics system is a key factor to determine the success of the aquaculture system [12]. The fish in the aquaponics system must be able to adapt to the turbidity of the water body and assimilate microbial proteins to a certain extent [13]. Crucian carp has excellent tolerance and strong adaptability to various ecological environments [14]. They have better growth performance and higher survival rates under different water quality conditions [15]. Therefore, they are considered to be one of the most suitable fish species for intensive farming.
The aquaponics system has many benefits for fish feeding, such as enhancing the growth performance and antioxidant capacity of fish [16,17]. Even under conditions of intensive culture, crucian carps have obvious advantages in terms of their antioxidant capacity and growth in aquaponics systems [15]. At the cellular level, their stress response is characterized by the increased expression of the heat shock protein (HSP) [18]. The increased synthesis of HSP70 has been reported in response to various stressors, including hypoxia, pathogens and contaminants [18,19]. Recombinant peroxiredoxin 3 (Prdx3) is closely related to antioxidant defense and tissue repair [20]. Therefore, HSP70 and Prdx3 can partly reflect the stress level of fish. This is conducive to the sustainable development of aquaculture to evaluate whether the aquaponics system can relieve the stress state of crucian carp while giving consideration to the high-quality growth of aquatic plants and fish. Currently, lettuce is mostly used in hydroponic systems and produces good results [21,22,23].
It is worth mentioning that under appropriate proportions, the fecal residue produced by fish in the aquaponics system will not affect the growth status of green leafy plants [24]. At the same time, we did not use any fertilizers or chemical plant protectors during the exploration process.
Therefore, lettuce was selected as the research object in this study. The study was only a preliminary pilot study. The purpose of this study was to explore the effects of an aquaponics system on the growth performance of crucian carp and lettuce quality, and to evaluate whether the aquaponics system has the ability to relieve crucian carp under oxygen stress.

2. Materials and Methods

2.1. Test Design and Installation

The crucian carps used in this study (150 crucian carps, 7.06 ± 0.32 g per culture unit) were obtained from Guangdong Xiongfeng Fry Co., Ltd., Shunde, China. They were initially acclimatized in RAS (recirculating aquaculture systems) for 30 days. The temperature of the water was held at 22–25 °C, the pH was held at 6.5–7.0, the ammonia nitrogen levels were held at 0–0.12 mg/L and the nitrite content was held at less than 0.12 mg/L. A 10% proportion of the water was replaced every day.
In the experiment, 150 crucian carps were initially included in the RAS. After domestication, 3 crucian carps were randomly selected as the NC group to detect stress, antioxidant parameters and liver gene expression, which was repeated three times. Then, the remaining 141 crucian carps were treated with hypoxia, and 3 crucian carps were randomly selected as the hypoxia group to detect stress, antioxidant parameters and liver gene expression, which was also repeated three times. As shown in Figure 1, after oxygen recovery, 120 crucian carps were randomly selected from 132 crucian carps and put into the water–fish group (T1) and fish–vegetable group (T2), with three replicates per treatment. There were 20 crucian carps in each group. Among them, the crucian carps were first subjected to hypoxia stress and then put into T1 and T2 groups, respectively. The volume of each experimental tank was 240 L and the surface area of the lettuce tank was 60 cm2. The stocking density of each tank was approximately 0.59 kg/m3 As shown in Figure 2, the hydroponics unit in the test was composed of a filter box (a), biochemical filter cotton (b), plant bed (c), water inlet pipe (d), aquaculture tank (e), suction pump (f), lettuce (g), floating foam board (h), air pump (i), crucian carps (j) and gas stone (k). The plants were fixed using floating foam plates as a medium [2]. Pipes made of PVC were installed between the fishpond and the plant bed for circulating water. The bottom of the box at the top of the plant bed was lined with a double layer of biochemical filter cotton. This allowed only filtered water to enter the plant bed, preventing damage to plant roots that can be caused by high concentrations of suspended matter in circulating water, which can cause adhesion or blockage, finally reducing the ability of the roots to absorb oxygen. The water was filtered through the submersible pump to the top filter box, and then it circulated back to the plant bed due to gravity, and ultimately back to the fishpond. Laboratory staff adjusted the water level in the tank every week to compensate for losses due to evaporation, transpiration, handling losses and so on.

2.2. Treatment of Test Fish

During this period, the fish were placed in a 12 h/12 h light–dark cycle and artificially fed twice a day with commercial pellets (crude protein 35.0%, crude fiber 12.0%, crude fat 5.0%, crude ash 15.0%, total phosphorus 1.0%, moisture 12.5% and lysine 1.6%) (Shandong Binzhou Ruixing Biotechnology Co., Ltd., Binzhou, China) until they felt full. The maximum value of the daily feed was 2% of the total body weight of the fish. The water quality parameters were measured once a day. Finally, 120 hypoxic crucian carps were taken out quickly and put into the T1 and T2 groups for 30 days, respectively. At the end of the experiment, the growth parameters of the surviving experimental fish were first measured, then 3 fish from each group were randomly selected for sampling, and this process was conducted three times. The parameter abbreviations are shown in Table 1.
At the end of the trial, all fish were collected to obtain the final weight and the following growth indices were calculated [2]:
Specific growth rate (SGR) = 100% × (lnW2 − lnW1)/days,
Relative growth rate (WGR) = 100% × (W2 − W1)/W1,
Survival rate (SR) = 100% × (N2/N1)
Here, W1 is the initial weight, W2 is the final weight, N2 is the final number and N1 is the initial number.

2.3. Lettuce Growth Indices

The lettuce seeds were cultured in hole trays for 7 days using soil as the medium. After germination, the lettuce was separated from the hole dish and the roots were removed from the soil by washing and transferred to a floating foam board with stationary cotton. The average height of the plants was 4.16 ± 0.12 cm, and there were 6 plants per floating foam plate, which remained unchanged in all treatments and controls. At the end of the 30-day trial period, the heights of all plants were measured using vernier calipers, then the samples were washed and the leaves and roots of the plants were weighed using an electronic balance with a minimum measuring range of 0.01 g after wiping the water. Chlorophyll content was indirectly reflected by the SPAD value (relative chlorophyll content), which was measured using a portable chlorophyll analyzer (SPAD-502; KONICA MINOLTA, Osaka, Japan).

2.4. Stress Parameters

Experimental crucian carp were randomly selected from each pond and each fish was sampled. All samples were taken after anesthetizing them with MS-222. Growth performance data were obtained and then blood was drawn from the tail vein with heparinized syringes and centrifuged at 1350× g for 10 min. The serum was collected 5 h after coagulation at 4 °C and used for the determination of glucose. At the same time, we collected the livers of the crucian carp and turned them into tissue homogenate to measure the cortisol and antioxidant parameters later on.
The activity levels of total superoxide dismutase and catalase were measured. The total superoxide dismutase activity was measured using the hydroxylamine method at 550 nm. The activity of the catalase was determined at 405 nm using the ammonium molybdate method [25]. The cortisol content was determined with the competition method at 450 nm [26]. The kit was acquired from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The glucose level was determined with a Cobas C-311 automatic biochemical analyzer (Roche, Basel, Switzerland). The results of the stress parameters and antioxidant parameters were expressed as means ± SDs.

2.5. Extraction and Quantitative PCR of Tissue RNA

The total RNA of the tissues was isolated using the TRIzol reagent (Invitrogen, California, CA, USA). The reverse transcription was performed using the HiScript 1st Strand cDNA Synthesis kit (Vazyme, Piscataway, NJ, USA), and 1000 ng of total RNA was used in this process. The reverse transcription was carried out at 37 °C for 15 min and 85 °C for 5 s. The qPCR reactions were performed using the Universal SYBR qPCR kit (Vazyme, Piscataway, NJ, USA). The qRT-PCR analysis of the mRNA was carried out with a QuantStudioTM 3 Real-Time PCR Instrument (Thermo Fisher Scientific, Massachusetts, USA). The thermal cycling parameters were as follows: 95 °C for 5 min; 40 cycles at 95 °C for 15 s, 60 °C for 30 s and 60–95 °C to draw the dissociation curve. The expression level of the mRNA was normalized to the expression of GAPDH. The 2−ΔΔCt method was used for quantification. The primer sequences are shown in Table 2.

2.6. Statistical Analysis

The data were analyzed using GraphPad Prism 5.0 software (GraphPad Software). The growth performance, growth, stress and antioxidant parameters of the crucian carps were analyzed using a one-way ANOVA. Here, p < 0.05 indicates a statistically significant difference. The results are expressed as means ± SDs.

3. Results

3.1. Fish Growth Performance

At the end of the trial, the survival rate was 100% in both the T1 and T2 groups. The growth properties of the crucian carp are shown in Table 3. The FW, SGR, WGR and SR values were significantly different between the T1 and T2 groups (p < 0.05), as shown in Table 1. The FW, SGR and WGR values were higher in the T2 group, at 10.26 ± 0.31, 1.25 ± 0.10 and 45.51 ± 4.43, respectively. The FW, SGR and WGR values in the T1 group were lower, at 9.12 ± 0.40, 0.89 ± 0.05 and 30.63 ± 2.14, respectively.

3.2. Plant Growth Parameters

The fresh leaf weight, root fresh weight and chlorophyll content of the lettuce are shown in Table 4. There were significant differences in the leaf fresh weight and chlorophyll content between the T0 group and T2 group (p < 0.05); the T2 group had a higher leaf fresh weight. The chlorophyll content in the T2 group was higher than that in the T0 group. There was no significant difference in the root fresh weights between the two groups, and the root fresh weight in the T2 group was higher than that in the T0 group.

3.3. Water Quality Parameters

The water quality parameters of groups T0, T1 and T2 are shown in Table 5. There were significant differences in the pH, dissolved oxygen, nitrate and nitrite levels among the three groups during the whole experiment (p < 0.05). The pH values ranged from 6.9 to 7.8, and the levels of dissolved oxygen ranged from 5.35 to 7.21 mgL−1. The pH of the T1 group was the highest, followed by the T2 group, while the T0 group was the lowest. The highest level of dissolved oxygen was found in the T0 group, followed by the T2 group and the T1 group. The nitrate level in the T1 group was the highest, followed by group T2, and the T0 group was the lowest. The nitrite levels ranged from 0.06 to 0.27 mgL−1, with the highest nitrite level being found in the T1 group, followed by the T2 group, with the lowest in the T0 group.

3.4. Stress Parameters

The stress parameters (cortisol and glucose) of crucian carp are shown in Figure 3. The difference in cortisol levels was statistically significant (p < 0.05); the cortisol concentrations in the hypoxia, T1, and T2 groups were significantly higher (p < 0.05) compared to the NC group. The group with the highest cortisol concentration was the hypoxia group, followed by groups T1 and T2 in that order. The glucose concentration in the hypoxia group was significantly higher than that in the T1 group, while in the T2 group, it was slightly lower than that in T1 group. Furthermore, there was no significant difference in glucose concentrations between the T2 and NC groups.

3.5. Antioxidant Parameters

The antioxidant parameters of crucian carp are shown in Figure 4, and the differences in the catalase and superoxide dismutase activities were statistically significant (p < 0.05). Compared to the NC group, the CAT concentration was significantly higher (p < 0.05) in the hypoxia, T1 and T2 groups. The hypoxia group had the highest CAT concentration, followed by the T1 group, while the T2 group had the lowest CAT concentration. The SOD concentration in the hypoxia group was significantly higher than that in the T1 group, whereas the SOD concentration in the T2 group was significantly lower than that in the T1 group. Additionally, the SOD concentration in the T2 group did not differ significantly from that in the NC group.

3.6. Gene Expression

The relative expression levels of HSP70 and Prdx3 in crucian carp liver tissues are shown in Figure 5. The relative expression of HSP70 in the control group was the lowest (p < 0.05), while the relative expression of HSP70 in the hypoxia group was significantly higher than that in the T1 group, followed by the T2 group (p < 0.05). On the other hand, compared with the other three groups, the relative expression of Prdx3 in healthy crucian carp in the control group was significantly higher (p < 0.05), and the relative expression of Prdx3 in the T2 group was significantly higher than that of the T1 group, followed by the hypoxia group (p < 0.05).

4. Discussion

With the development of aquaculture technology, aquaponics models have been adopted by more and more researchers for related research. However, the information on the effect of this model on the stress level of crucian carp is lacking. The effects of the aquaponics model on the stress of crucian carp were studied in terms of the growth parameters, water quality parameters, antioxidant parameters, stress parameters and gene expression.
In this experiment, the FW, SGR and WGR values of the T2 group were higher than those of the T1 group, which may have been because the aquatic plants [27] improved the living environment conditions of the crucian carp and promoted their growth performance [9]. Some studies have shown that hydroponic systems may contribute to fish growth [28]. In addition, this experiment further proved that under certain density conditions, the water body purified by aquatic plants may improve the water environment, which may improve the growth performance of the fish. At the same time, the survival rate of crucian carp may be guaranteed to a certain extent [29].
Aquaponics may ensure the normal growth of leafy greens [30,31]. This may be due to the fact that higher quantities of nitrate and nitrite in the water [32] are absorbed and utilized by aquatic plants. It has been reported that nitrate and nitrite can promote the vegetative growth of aquatic plants [33,34]. The chlorophyll content is one of the physiological indexes used to evaluate the nutritional status of plants [35]. The chlorophyll content of plants in the T2 group was significantly higher. This may indicate that the photosynthetic capacity of the plants in the aquaponics system was slightly better than those in the traditional hydroponic system. The aquaponics system may have improved the availability of the nitrogen in the form of nitrate and enabled the root system to better absorb nitrogen, thereby improving the photosynthetic capacity [36,37].
Lettuce grown in hydroponics may be involved in regulating water quality through its own photosynthesis. The pH of the T1 group was significantly high. The excrement from the crucian carp in group T1 was probably the reason for the alkalinity of the water and the higher pH. In the T2 group, due to the absorption of nitrate in the water by lettuce, the water remained weakly alkaline [38]. The level of dissolved oxygen in the T1 and T2 groups was significantly lower than that in the T0 group because of the oxygen consumption of the crucian carp (p < 0.05). The level of dissolved oxygen in the T2 group was higher than that in the T1 group, possibly because the lettuce photosynthesis provided dissolved oxygen in the water [39]. The T2 group had low levels of nitrate and nitrite, possibly due to the absorption of these two components by the plants [40].
Cortisol and glucose are important parameters to measure whether fish are in a state of stress [41]. The cortisol and glucose levels of the crucian carp in the T2 group were significantly lower than those in the T1 group. Good water quality may reduce the adverse irritation to fish. Therefore, the crucian carp were less affected by stress in group T2.
The antioxidant parameters of fish can be reflected by the activities of superoxide dismutase and catalase, and the greater the activity change, the more serious the damage to the fish [42]. In organisms, superoxide dismutase plays an important role in antioxidant defense mechanisms by participating in the conversion of superoxides to oxygen and hydrogen peroxide [43]. In addition, catalase also plays an important role in defense mechanisms by breaking down hydrogen peroxide into oxygen and water [44]. In this study, the levels of catalase and superoxide dismutase in the crucian carp in the T1 group were significantly increased, while those in the T2 group were lower. This may have been due to the existence of antioxidant components in plant roots, which may reduce the oxidative stress of fish to some extent [45]. In this study, the levels of superoxide dismutase and catalase were lower, indicating that the stress levels and health status of the crucian carp were better in the symbiotic system.
HSP plays a significant role in protecting cells from protein damage and promoting cell growth [20]. In this study, the expression of HSP70 was significantly increased in the hypoxia group (p < 0.05), indicating that the liver can protect cell homeostasis by upregulating HSP70 gene expression [46]. When the dissolved oxygen in the T1 and T2 groups returned to normal levels, the HSP70 gene expression recovered to the pre-stress level, which was slightly higher than that of the NC group. Prdx3 is believed to be crucial in the process of antioxidant defense and tissue repair [20]. The hypoxia group significantly reduced the expression level of Prdx3, suggesting that the liver can improve the defense system and accelerate the repair of damaged tissues by downregulating the gene expression of Prdx3. In this study, it was observed that after the T1 and T2 groups returned to normal dissolved oxygen levels, the gene expression of Prdx3 returned to near pre-stress levels, slightly lower than that of the NC group.

5. Conclusions

This was a pilot study. The addition of aquatic plants may alleviate the stress of crucian carp. The model of aquaponics under the experimental conditions produced good results on the related parameters of the crucian carp and lettuce. In addition, by analyzing physiological parameters (cortisol, glucose, superoxide dismutase, catalase) and non-invasive parameters such as the chlorophyll content of the aquatic plants, we can judge whether the overall effects on fish and aquatic plants have been improved. This process is informative and cost-effective. At the same time, this experiment shows that the symbiotic model can alleviate the stress state of fish to a certain extent.

Author Contributions

Conceptualization, B.W. and H.M.; methodology, B.W., J.Z., Q.S. and Y.W.; software, B.W., J.Z. and Y.W.; validation, B.W., Q.S. and X.D.; data curation, B.W. and J.Z.; writing—original draft preparation, B.W. and X.D.; writing—review and editing, B.W., Y.W. and J.Z.; project administration, H.M.; funding acquisition, H.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the National Natural Science Foundation of China (32071905), National Natural Science Foundation of China (NSFC) (32201686), the Project of Agricultural Equipment Department of Jiangsu University (NZXB20210106), and the Modern Agriculture Industrial Technology System Special Project—the National Technology System for Conventional Freshwater Fish Industries (grant no. CARS-45-26).

Institutional Review Board Statement

The maintenance, handling and experiments conducted on the fish during this study were carried out in strict accordance with the guidelines of the Association for the Study of Animal Behavior of Zhejiang University (no. ZJU20190073).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data available on request due to restrictions. The data presented in this study are available on request from the corresponding author. The data are not publicly available due to privacy reasons.

Acknowledgments

The authors would like to thank the Key Laboratory of Agricultural Engineering in Jiangsu University and Zhejiang University for supporting the experimental conditions of the research.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Luo, X.-L.; Rauan, A.; Xing, J.-X.; Sun, J.; Wu, W.-Y.; Ji, H. Influence of dietary Se supplementation on aquaponic system: Focusing on the growth performance, ornamental features and health status of Koi carp (Cyprinus carpio var. Koi), production of Lettuce (Lactuca sativa) and water quality. Aquac. Res. 2021, 52, 505–517. [Google Scholar] [CrossRef]
  2. Saseendran, S.; Dube, K.; Chandrakant, M.H.; Babitha Rani, A.M. Enhanced growth response and stress mitigation of genetically improved farmed Tilapia in a biofloc integrated aquaponic system with bell pepper. Aquaculture 2021, 533, 736200. [Google Scholar] [CrossRef]
  3. Milliken, S.; Ovca, A.; Antenen, N.; Villarroel, M.; Bulc, T.G.; Kotzen, B.; Junge, R. Aqu@teach—The First Aquaponics Curriculum to Be Developed Specifically for University Students. Horticulturae 2021, 7, 18. [Google Scholar] [CrossRef]
  4. Yamane, K.; Kimura, Y.; Takahashi, K.; Maeda, I.; Iigo, M.; Ikeguchi, A.; Kim, H.-J. The Growth of Leaf Lettuce and Bacterial Communities in a Closed Aquaponics System with Catfish. Horticulturae 2021, 7, 222. [Google Scholar] [CrossRef]
  5. Verberk, W.C.E.P.; Sandker, J.F.; van de Pol, I.L.E.; Urbina, M.A.; Wilson, R.W.; McKenzie, D.J.; Leiva, F.P. Body mass and cell size shape the tolerance of fishes to low oxygen in a temperature-dependent manner. Glob. Change Biol. 2022, 28, 5695–5707. [Google Scholar] [CrossRef]
  6. Blasco, F.R.; Taylor, E.W.; Leite, C.A.C.; Monteiro, D.A.; Rantin, F.T.; McKenzie, D.J. Tolerance of an acute warming challenge declines with body mass in Nile tilapia: Evidence of a link to capacity for oxygen uptake. J. Exp. Biol. 2022, 225, jeb244287. [Google Scholar] [CrossRef]
  7. Dinken, C.P.; Keretz, K.R.; Schramm, H.L.; Petrie-Hanson, L.; Schilling, M.W.; Allen, P.J. The Effects of Water Temperature and Simulated Angling on the Physiological Stress Response of Largemouth Bass. Trans. Am. Fish. Soc. 2022, 151, 487–506. [Google Scholar] [CrossRef]
  8. San, L.; Liu, B.; Liu, B.; Guo, H.; Guo, L.; Zhang, N.; Zhu, K.; Jiang, S.; Zhang, D. Transcriptome Analysis of Gills Provides Insights into Translation Changes Under Hypoxic Stress and Reoxygenation in Golden Pompano, Trachinotus ovatus (Linnaeus 1758). Front. Mar. Sci. 2021, 8, 763622. [Google Scholar] [CrossRef]
  9. Byrd, G.V.; Jha, B.R. Relative Growth of Lettuce (Lactuca sativa) and Common Carp (Cyprinus carpio) in Aquaponics with Different Types of Fish Food. Water 2022, 14, 3870. [Google Scholar] [CrossRef]
  10. Zhang, P.; Huang, Q.; Peng, R.; Jiang, X.; Jiang, M.; Zeng, G.; Lin, J. Environmental factors of rearing water and growth performance of shrimp (Penaeus vannamei) in a microalgal monoculture system. Aquaculture 2022, 561, 738620. [Google Scholar] [CrossRef]
  11. Atique, F.; Lindholm-Lehto, P.; Pirhonen, J. Is Aquaponics Benefificial in Terms of Fish and Plant Growth and Water Quality in Comparison to Separate Recirculating Aquaculture and Hydroponic Systems? Water 2022, 14, 1447. [Google Scholar] [CrossRef]
  12. Kralik, B.; Weisstein, F.; Meyer, J.; Neves, K.; Anderson, D.; Kershaw, J. From water to table: A multidisciplinary approach comparing fish from aquaponics with traditional production methods. Aquaculture 2022, 552, 737953. [Google Scholar] [CrossRef]
  13. Wang, S.-X.; Zhang, J.-Y.; Du, X.-K.; Liu, D.-J.; Liu, L.-X.; Shen, X.-H. Comparative analysis of the intestinal microbiota in goldfish and crucian carps between different aquaponics and traditional farming. Aquac. Rep. 2022, 25, 101240. [Google Scholar] [CrossRef]
  14. Mishina, T.; Takeshima, H.; Takada, M.; Iguchi, K.I.; Zhang, C.; Zhao, Y.; Kawahara-Miki, R.; Hashiguchi, Y.; Tabata, R.; Sasaki, T.; et al. Interploidy gene fow involving the sexual-asexual cycle facilitates the diversifcation of gynogenetic triploid Carassius fish. Sci. Rep. 2021, 11, 22458. [Google Scholar] [CrossRef] [PubMed]
  15. Liu, J.; Wang, B.; Lai, Q.; Lu, Y.; Li, L.; Li, Y.; Liu, S. Immunity, antioxidant capacity and disease resistance of crucian carp (Carassius auratus) by single or in combination dietary Bacillus subtilis and xylo-oligosaccharides. Comp. Biochem. Physiol. Part C 2022, 256, 109296. [Google Scholar] [CrossRef]
  16. Gao, Y.; Zhu, G.; Tian, Y.; Li, K.; Zhao, Y.; Liang, J.; Gu, Q.; Li, X. Blood biochemistry profile of Qihe crucian carp Carassius auratus in different aquaponic systems. Environ. Sci. Pollut. Res. 2022, 27, 42898–42907. [Google Scholar] [CrossRef]
  17. Albadwawi, M.A.O.K.; Ahmed, Z.F.R.; Kurup, S.S.; Alyafei, M.A.; Jaleel, A. A Comparative Evaluation of Aquaponic and Soil Systems on Yield and Antioxidant Levels in Basil, an Important Food Plant in Lamiaceae. Agronomy 2022, 27, 3007. [Google Scholar] [CrossRef]
  18. Luo, L.; Zhao, Z.; Zhang, R.; Guo, K.; Wang, S.; Xu, W.; Wang, C. The effects of temperature changes on the isozyme and Hsp70 levels of the Amur sturgeon, Acipenser schrenckii, at two acclimation temperatures. Aquaculture 2022, 551, 737743. [Google Scholar] [CrossRef]
  19. Elabd, H.; Wang, H.-P.; Shaheen, A.; Matter, A. Nano spirulina dietary supplementation augments growth, antioxidative and immunological reactions, digestion, and protection of Nile tilapia, Oreochromis niloticus, against Aeromonas veronii and some physical stressors. Fish Physiol. Biochem. 2020, 46, 2143–2155. [Google Scholar] [CrossRef]
  20. Martos-Sitcha, J.A.; Simó-Mirabet, P.; de Las Heras, V.; Calduch-Giner, J.À.; Pérez-Sánchez, J. Tissue-Specific Orchestration of Gilthead Sea Bream Resilience to Hypoxia and High Stocking Density. Front. Physiol. 2019, 10, 840. [Google Scholar] [CrossRef] [Green Version]
  21. Tsoumalakou, E.; Mente, E.; Kormas, K.A.; Katsoulas, N.; Vlahos, N.; Kapsis, P.; Levizou, E. Precise Monitoring of Lettuce Functional Responses to Minimal Nutrient Supplementation Identifies Aquaponic System’s Nutrient Limitations and Their Time-Course. Agriculture 2022, 12, 1278. [Google Scholar] [CrossRef]
  22. Villarroel, M.; Miranda-de la Lama, G.C.; Escobar-Álvarez, R.; Moratiel, R. Fish Welfare in Urban Aquaponics: Effects of Fertilizer for Lettuce (Lactuca sativa L.) on Some Physiological Stress Indicators in Nile Tilapia (Oreochromis niloticus L.). Water 2022, 14, 935. [Google Scholar] [CrossRef]
  23. Flores, R.M.V.; Preckel, P.V.; Quagrainie, K.; Widmar, N.O.; Silva, L.; da Costa, J.I.; Pinho, S.M.; Portella, M.C.; Branco, T.C.; Filho, M.X.P. Efciency tests for screening production strategies in a lettuce-juvenile tilapia aquaponics system in Brazil. Aquac. Int. 2022, 30, 2403–2424. [Google Scholar] [CrossRef]
  24. Goddek, S.; Schmautz, Z.; Scott, B.; Delaide, B.; Keesman, K.J.; Wuertz, S.; Junge, R. The Effect of Anaerobic and Aerobic Fish Sludge Supernatant on Hydroponic Lettuce. Agronomy 2016, 6, 37. [Google Scholar] [CrossRef] [Green Version]
  25. Adel, M.; Omidi, A.H.; Dawood, M.A.; Karimi, B.; Shekarabi, S.P.H. Dietary Gracilaria persica mediated the growth performance, fillet colouration, and immune response of Persian sturgeon (Acipenser persicus). Aquaculture 2020, 530, 735950. [Google Scholar] [CrossRef]
  26. Agusti, C.; Carbajal, A.; Olvera-Maneu, S.; Domingo, M.; Lopez-Bejar, M. Blubber and serum cortisol concentrations as indicators of the stress response and overall health status in striped dolphins. Comp. Biochem. Physiol. Part A 2022, 272, 111268. [Google Scholar] [CrossRef]
  27. Sundar, L.S.; Chen, G.S. Study on the Growth Performance of Lettuce (Lactuca sativa) and Pak Choi (Brassica chinensis) in Different Aquaponic Growing Systems. Horticulturae 2020, 6, 69. [Google Scholar] [CrossRef]
  28. Maitland, D.M.; Baker, J.; Chambers, G.; Ross, N.W.; Colombo, S.M. Population growth dynamics and their implications for fish welfare in mixed-size cohorts of Cyprinus Carpio var koi grown in a commercial-scale aquaponics system. Aquac. Int. 2022, 30, 187–210. [Google Scholar] [CrossRef]
  29. Vlahos, N.; Levizou, E.; Stathopoulou, P.; Berillis, P.; Antonopoulou, E.; Bekiari, V.; Krigas, N.; Kormas, K.; Mente, E. An Experimental Brackish Aquaponic System Using Juvenile Gilthead Sea Bream (Sparus aurata) and Rock Samphire (Crithmum maritimum). Sustainability 2019, 11, 4820. [Google Scholar] [CrossRef] [Green Version]
  30. Zarantoniello, M.; Chemello, G.; Ratti, S.; Pulido-Rodríguez, L.F.; Daniso, E.; Freddi, L.; Salinetti, P.; Nartea, A.; Bruni, L.; Parisi, G.; et al. Growth and Welfare Status of Giant Freshwater Prawn (Macrobrachium rosenbergii) Post-Larvae Reared in Aquaponic Systems and Fed Diets including Enriched Black Soldier Fly (Hermetia illucens) Prepupae Meal. Animals 2023, 13, 715. [Google Scholar] [CrossRef]
  31. Danner, R.I.; Mankasingh, U.; Anamthawat-Jonsson, K.; Thorarinsdottir, R.I. Designing Aquaponic Production Systems towards Integration into Greenhouse Farming. Water 2019, 11, 2123. [Google Scholar] [CrossRef] [Green Version]
  32. Supajaruwong, S.; Satanwat, P.; Pungrasmi, W.; Powtongsook, S. Design and function of a nitrogen and sediment removal system in a recirculating aquaculture system optimized for aquaponics. Environ. Eng. Res. 2021, 26, 190494. [Google Scholar] [CrossRef]
  33. Yang, T.; Kim, H.-J. Characterizing Nutrient Composition and Concentration in Tomato-, Basil-, and Lettuce-Based Aquaponic and Hydroponic Systems. Water 2020, 12, 1259. [Google Scholar] [CrossRef]
  34. Goddek, S.; Keesman, K.J. Improving nutrient and water use efficiencies in multi-loop aquaponics systems. Aquac. Int. 2020, 28, 2481–2490. [Google Scholar] [CrossRef]
  35. Liu, X.; Wang, S.; Deng, X.; Zhang, Z.; Yin, L. Comprehensive evaluation of physiological traits under nitrogen stress and participation of linolenic acid in nitrogendeficiency response in wheat seedlings. BMC Plant Biol. 2020, 20, 501. [Google Scholar] [CrossRef]
  36. Anderson, T.S.; Goldstein, L.T.; Timmons, M.B. Root nitrification capacity of lettuce plants with application to aquaponics. Aquac. Eng. 2019, 86, 101997. [Google Scholar] [CrossRef]
  37. Zhang, Z.; Cao, B.; Chen, Z.; Xu, K. Grafting Enhances the Photosynthesis and Nitrogen Absorption of Tomato Plants Under Low-Nitrogen Stress. J. Plant Growth Regul. 2022, 41, 1714–1725. [Google Scholar] [CrossRef]
  38. Gillespie, D.P.; Papio, G.; Kubota, C. High Nutrient Concentrations of Hydroponic Solution Can Improve Growth and Nutrient Uptake of Spinach (Spinacia oleracea L.) Grown in Acidic Nutrient Solution. Hortscience 2021, 56, 687–694. [Google Scholar] [CrossRef]
  39. Concepcion, R.; Dadios, E.; Cuello, J.; Duarte, B. Thermo-gas dynamics affect the leaf canopy shape and moisture content of aquaponic lettuce in a modified partially diffused microclimatic chamber. Sci. Hortic. 2022, 292, 110649. [Google Scholar] [CrossRef]
  40. Ni, M.; Yuan, J.; Zhang, L.; Hua, J.; Rong, H.; Gu, Z. In-situ and ex-situ purification effect of ecological ponds of Euryale ferox Salisb on shrimp aquaculture. Aquaculture 2021, 540, 736678. [Google Scholar] [CrossRef]
  41. Baßmann, B.; Harbach, H.; Weißbach, S.; Palm, H.W. Effect of plant density in coupled aquaponics on the welfare status of African catfish, Clarias gariepinus. J. World Aquac. Soc. 2020, 51, 183–199. [Google Scholar] [CrossRef]
  42. Ajima, M.N.O.; Kumar, K.; Poojary, N.; Pandey, P.K. Sublethal diclofenac induced oxidative stress, neurotoxicity, molecular responses and alters energy metabolism proteins in Nile tilapia, Oreochromis niloticus. Environ. Sci. Pollut. Res. 2021, 28, 44494–44504. [Google Scholar] [CrossRef] [PubMed]
  43. Zhang, M.; Kuang, S.; Sun, Y.; Sun, J.; Tian, X.; Hu, Y.; Hu, J.; Wang, Y.; Xu, S.L.; Xu, W.; et al. Effects of dietary vitamin C on growth, antioxidant enzyme activity and immune-related gene expression of Pampus argenteus. Aquac. Res. 2020, 53, 5342–5353. [Google Scholar] [CrossRef]
  44. González-Silvera, D.; Cuesta, A.; Esteban, M. Immune defence mechanisms presented in liver homogenates and bile of gilthead seabream (Sparus aurata). J. Fish Biol. 2021, 99, 1958–1967. [Google Scholar] [CrossRef]
  45. Senavirathna, M.D.H.J.; Zhaozhi, L.; Fujino, T. Root Adsorption of Microplastic Particles Affects the Submerged Freshwater Macrophyte Egeria densa. Water Air Soil. Pollut. 2022, 233, 80. [Google Scholar] [CrossRef]
  46. Shi, Q.; Yu, C.; Zhu, D.; Li, S.; Wen, X. Effects of dietary Sargassum horneri on resisting hypoxia stress, which changes blood biochemistry, antioxidant status, and hepatic HSP mRNA expressions of juvenile black sea bream Acanthopagrus schlegelii. J. Appl. Phycol. 2020, 32, 3457–3466. [Google Scholar] [CrossRef]
Fishes 08 00360 g001 550
Figure 1. The three experimental groups: (T0) water–vegetable group; (T1) water–fish group; (T2) fish–vegetable group.
Figure 1. The three experimental groups: (T0) water–vegetable group; (T1) water–fish group; (T2) fish–vegetable group.
Fishes 08 00360 g001
Fishes 08 00360 g002 550
Figure 2. Hydroponics unit in the test: (a) filter box; (b) biochemical filter cotton; (c) plant bed; (d) water inlet pipe; (e) aquaculture tank; (f) suction pump; (g) lettuce; (h) floating foam board; (i) air pump; (j) crucian carp; (k) air stone.
Figure 2. Hydroponics unit in the test: (a) filter box; (b) biochemical filter cotton; (c) plant bed; (d) water inlet pipe; (e) aquaculture tank; (f) suction pump; (g) lettuce; (h) floating foam board; (i) air pump; (j) crucian carp; (k) air stone.
Fishes 08 00360 g002
Fishes 08 00360 g003 550
Figure 3. Stress parameters of crucian carp in NC, hypoxia, T1 and T2 groups: (a) cortisol; (b) serum glucose. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Figure 3. Stress parameters of crucian carp in NC, hypoxia, T1 and T2 groups: (a) cortisol; (b) serum glucose. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Fishes 08 00360 g003
Fishes 08 00360 g004 550
Figure 4. Antioxidant parameters of crucian carp in the NC, hypoxia, T1 and T2 groups were studied: (a) CAT; (b) SOD. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Figure 4. Antioxidant parameters of crucian carp in the NC, hypoxia, T1 and T2 groups were studied: (a) CAT; (b) SOD. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Fishes 08 00360 g004
Fishes 08 00360 g005 550
Figure 5. Average relative expression of hypoxia stress-related genes in the livers of crucian carp under different treatment conditions: (a) HSP70; (b) Prdx3. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Figure 5. Average relative expression of hypoxia stress-related genes in the livers of crucian carp under different treatment conditions: (a) HSP70; (b) Prdx3. Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Fishes 08 00360 g005
Table
Table 1. Parameter Abbreviations.
Table 1. Parameter Abbreviations.
ParameterParameter Abbreviation
SGRSpecific growth rate
WGRRelative growth rate
SRSurvival rate
SODTotal superoxide dismutase
CATCatalase
Table
Table 2. Primer sequences.
Table 2. Primer sequences.
GeneForward PrimerReverse Primer
HSP705′–ACTGAACTCGGTCATTGGCT–3′5′–AGAGGCCAATTGCAGTTCAT–3′
Prdx35′–TCGCAGTCTCAGTGGATTCC–3′5′–CAGGAGGCATTGCTGATGAT–3′
GAPDH5′–CAGGAGGCATTGCTGATGAT–3′5′–GAAGGCTGGGGCTCATTT–3′
Table
Table 3. Growth properties of crucian carp in T1 and T2 groups.
Table 3. Growth properties of crucian carp in T1 and T2 groups.
ParameterW1 (g)W2 (g)SGR (%)WGR (%)SR (%)
T17.00 ± 0.40 a9.12 ± 0.40 b0.89 ± 0.05 b30.63 ± 2.14 b100 a
T27.11 ± 0.24 a10.26 ± 0.31 a1.25 ± 0.10 a45.51 ± 4.43 a100 a
Results are expressed as means ± SDs (n = 9) and different letters indicate significant differences (p < 0.05).
Table
Table 4. Leaf fresh weight, root fresh weight and chlorophyll contents of lettuces in T0 and T2 groups.
Table 4. Leaf fresh weight, root fresh weight and chlorophyll contents of lettuces in T0 and T2 groups.
ParameterLeaf Fresh Weight
(g plant−1) 		Fresh Root Weight
(g plant−1) 		Chlorophyll
(SPAD)
T032.80 ± 0.50 b6.93 ± 0.42 a31.64 ± 0.78 b
T234.33 ± 0.65 a7.64 ± 0.36 a34.40 ± 0.43 a
Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Table
Table 5. Study of the water quality parameters under the conditions of groups T0, T1 and T2.
Table 5. Study of the water quality parameters under the conditions of groups T0, T1 and T2.
ParameterpHDissolved Oxygen
(mg/L)		Nitrate
(mg/L)		Nitrite
(mg/L)
T07.05 ± 0.03 c7.01 ± 0.05 a3.40 ± 0.13 c0.08 ± 0.01 c
T17.52 ± 0.04 a5.56 ± 0.10 c6.83 ± 0.10 a0.24 ± 0.01 a
T27.19 ± 0.01 b6.71 ± 0.03 b5.19 ± 0.09 b0.12 ± 0.01 b
Results are expressed as means ± SDs (n = 9), and different letters indicate significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mao, H.; Wang, B.; Zhao, J.; Wang, Y.; Du, X.; Shi, Q. Influences of Aquaponics System on Growth Performance, Antioxidant Parameters, Stress Parameters and Gene Expression of Carassius auratus. Fishes 2023, 8, 360. https://doi.org/10.3390/fishes8070360

AMA Style

Mao H, Wang B, Zhao J, Wang Y, Du X, Shi Q. Influences of Aquaponics System on Growth Performance, Antioxidant Parameters, Stress Parameters and Gene Expression of Carassius auratus. Fishes. 2023; 8(7):360. https://doi.org/10.3390/fishes8070360

Chicago/Turabian Style

Mao, Hanping, Bin Wang, Jian Zhao, Yafei Wang, Xiaoxue Du, and Qiang Shi. 2023. "Influences of Aquaponics System on Growth Performance, Antioxidant Parameters, Stress Parameters and Gene Expression of Carassius auratus" Fishes 8, no. 7: 360. https://doi.org/10.3390/fishes8070360

Article Metrics

Back to TopTop