Next Article in Journal
Effect of Dietary Compound Acidifiers Supplementation on Growth Performance, Serum Biochemical Parameters, and Body Composition of Juvenile American Eel (Anguilla rostrata)
Next Article in Special Issue
Effects of Macleaya cordata Extract on Growth Performance, Serum Biochemical Parameters, and Intestinal Health of Juvenile American Eel (Anguilla rostrata)
Previous Article in Journal
Intelligent Diagnosis of Fish Behavior Using Deep Learning Method
Previous Article in Special Issue
Effects of Non-Heated and Heat Processed Krill and Squid Meal-Based Diet on Growth Performance and Biochemical Composition in Juvenile Pacific Bluefin Tuna Thunnus orientalis
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 7
Issue 4
10.3390/fishes7040202
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Dietary Protein Modifies Hepatic Glycolipid Metabolism, Intestinal Immune Response, and Resistance to Streptococcus agalactiae of Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus) Exposed to High Temperature

by
Dongyu Huang
1,
Hualiang Liang
2,
Jian Zhu
1,2,
Mingchun Ren
1,2,* and
Xianping Ge
1,2
1
Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China
2
Key Laboratory of Integrated Rice-Fish Farming Ecology, Ministry of Agriculture and Rural Affairs, Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences, Wuxi 214081, China
*
Author to whom correspondence should be addressed.
Fishes 2022, 7(4), 202; https://doi.org/10.3390/fishes7040202
Submission received: 6 July 2022 / Revised: 10 August 2022 / Accepted: 10 August 2022 / Published: 12 August 2022
(This article belongs to the Special Issue Fish Nutrition and Feed Technology)
Browse Figures
Versions Notes

Abstract

:
The present study investigates the effects of dietary protein levels on glucolipid metabolism, immune function, and resistance to Streptococcus agalactiae of genetically improved farmed tilapia (GIFT) exposed to high temperature. Six practical diets were prepared to feed 360 fish (initial weight 43.78 ± 0.12 g) with graded protein levels (26.45%, 29.28%, 31.69%, 33.68%, 36.18%, and 38.75% dry matter). The results showed that 26.45% dietary protein significantly improved glycolysis by increasing PK mRNA levels, while the 29.28% and 31.69% dietary protein levels promoted gluconeogenesis by increasing PEPCK and G6Pase mRNA levels. For lipid metabolism, 26.45% dietary protein enhanced lipid synthesis by increasing PPAR-γ, SREBP1c, and FAS mRNA levels, while 31.69% dietary protein enhanced the level of lipolysis by increasing the PPAR-α and CPT1 mRNA levels. The highest plasma TG and TC contents were observed in the 29.28% and 31.69% dietary protein groups, respectively. In terms of antioxidants and immunity, the 31.69% dietary protein level activated the expression levels of HSP90 mRNA, thus increasing the expression levels of antioxidant-related genes (CAT, SOD, and GPx), and upregulating the anti-inflammatory factor IL-10 mRNA levels. In addition, regarding the antioxidant enzymes, the highest GSH content was found in the 29.28% dietary protein group, while the 31.69% dietary protein group had the maximum GSH-Px activity. The lowest plasma ALT and AST activities were observed in the 31.69% dietary protein group. Ultimately, the survival rate of juvenile GIFT fed 31.69% dietary protein was highest after a Streptococcus agalactiae challenge. Overall, 29.28–31.69% dietary protein was recommended in the diet of GIFT in a high-temperature environment.

1. Introduction

As one of the three major nutrients, protein is the main component of the organism, and affects the metabolic and immune processes of fish. According to previous research on grass carp (Ctenopharyngodon idellus) [1] and top-mouth culter (Erythroculter ilishaeformis) [2], optimum dietary protein levels could effectively regulate glycolipid metabolism, including decreasing lipid synthesis and enhancing glycolytic capacity. Furthermore, previous studies on Japanese sea bass (Lateolabrax japonicus) [3] and leopard coral grouper (Plectropomus leopardus) [4] have shown that the appropriate dietary protein levels have a significant enhancing effect on immunity. Conversely, low-protein feeds with high levels of carbohydrates can lead to the accumulation of body fat in animals [5,6], and deficient dietary protein significantly reduces antioxidant enzyme activities and resistance to bacterial infection [7]. Moreover, excessive dietary protein levels will cause immunosuppression to some extent in fish [8,9], and excess protein will be broken down for energy consumption; then, ammonia nitrogen and oxidation products are produced in the process, which can be toxic to the body [10].
In aquaculture, high-temperature stress will cause a stress response, resulting in a series of changes, including changes in mRNA and metabolites [11,12,13], which directly affect biological functions, resulting in metabolic disorders and reduced disease resistance in fish. A previous study showed that the stress response of cells under stressful conditions is closely related to alterations in energy metabolism (glucose and lipid metabolism), with high temperatures significantly altering lipid and carbohydrate metabolism [14]. Furthermore, Zhao et al. [15] reported that when turbot (Scophthalmus maximus) is exposed to high temperatures, lipid metabolism has an important regulatory role in stress resistance. In addition, it was also found in grass carp that high-temperature stress could decrease fatty acid synthesis and weaken carbohydrate metabolism [16]. In addition, high temperature also affects the immune system of fish, reducing nonspecific and specific immunity and leading to a decrease in resistance to pathogenic bacteria [17]. Cheng et al. [18] showed that the immunity of spotted grouper (Epinephelus coioides) was suppressed during heat stress and that sustained high temperatures would result in a much lower immunity against Vibrio alginolyticus than that at optimal temperatures. Wang et al. [19] reported that the antioxidant system of scallops (Chlamys farreri) is challenged by high-temperature stress and is unable to fully repair the oxidative damage caused by the stress of high temperatures combined with a bacterial infection. Thus, understanding the changes in the metabolic and immune mechanisms of the body under a high temperature environment can help reduce the potential negative effects of heat stress.
Tilapia, Oreochromis niloticus, is the most exported farmed fish in China, with a total production of 1.65 million tons of tilapia farmed in 2020 [20]. Tilapia was once known for its ease of culture and strong disease resistance, but in recent years, with the expansion of culture scale and the increase in culture density, diseases occur frequently and have become increasingly serious, especially Streptococcus agalactiae disease, which seriously threatens the healthy development of the tilapia farming industry. The optimal water temperature for tilapia growth is 29–31 °C [21]. In our previous study, it was found that the protein requirement of tilapia at high temperatures was lower than those at suitable temperatures in terms of growth performance [22]. When the water temperature is higher than 32 °C, tilapia are more likely to be infected with Streptococcus agalactiae [23]. As Kayansamruaj et al. [24] showed, inflammation-related genes were significantly upregulated at high temperatures, causing massive inflammatory responses and acute fish mortality. This result indicated that the resistance of tilapia to the pathogenic bacteria, Streptococcus agalactiae, is reduced under high temperatures, for example, due to suppression of the immune system.
To date, no studies have reported the effects of protein levels in high temperature environments on the glycolipid metabolism and immune system of tilapia, as well as the effects on antimicrobial capacity. Thus, in this study, genetically improved farmed tilapia (GIFT), one of the tilapia strains, was chosen for this experiment. Our purpose was to examine the mechanisms of dietary protein levels on the glycolipid metabolism and immune capacity under high temperature in tilapia, to improve the antimicrobial capacity of tilapia under high-temperature stress through nutritional strategies.

2. Materials and Methods

2.1. Experimental Diets

Diets with six different protein levels (26.45%, 29.28%, 31.69%, 33.68%, 36.18%, and 38.75% dry matter) were designed (Table 1). The main protein sources were the fish meal, soybean meal, rapeseed meal, cottonseed meal, and wheat flour. The lipid source is fish oil. All raw materials were first crushed and sieved through 60 mesh and then mixed with water and oil. Then, the mixture was pelletized into 2 mm-diameter pellets through a pelletizer (F-26 [II], South China University of Technology, China), air-dried at room temperature, and maintained at −20 °C until further use.
The chemical compositions of the dried experimental diets were assessed based on the established methods of the AOAC [25]. The protein content was determined by the Kjeldahl method (Auto Kjeldahl apparatus: Hanon K1100 (Jinan Hanon Instruments Co., Ltd., Jinan, China)). The lipid content was determined by the Soxhlet method (Auto fat analyzer: Hanon SOX606 (Jinan Hanon Instruments Co., Ltd., Jinan, China)). The ash content was determined by the combustion method (Muffle: XL-2A (Hangzhou Zhuochi Instrument Co., Ltd., Hangzhou, China)). The fiber content was determined by the FiberCap method (Fiber analysis system (FiberCap™ 2021, FOSS, USA)). The gross energy was determined by the combustion method (Oxygen bomb calorimeter: IKA C6000 (IKA WORKS GUANGZHOU, Guangzhou, China)).

2.2. Experimental Fish and Feeding Management

Juvenile GIFT were obtained from the breeding farm of the Freshwater Fisheries Research Center of the Chinese Academy of Fishery Sciences. A total of 360 healthy GIFT (average initial weight 43.78 ± 0.12 g) were evenly distributed in 18 floating cages. The floating cages with a square shape (1 m × 1 m × 1 m) were hung on the floating frame, with the buoyancy of the floating frame adjusted to allow the cages to remain in the upper layer of water. The netting of the cages is made of mesh sewn together, and the mesh area of the netting is 1 cm×1 cm, which can ensure good water exchange and prevent fish from escaping. Fish were fed to satiation three times daily for four weeks. The natural water temperature ranged from 32 °C to 36 °C, and the water quality parameters during the trial were as follows: dissolved oxygen > 6.0 mg/L, and pH was kept at 7.5–8.0.

2.3. Sampling Procedure

After 4 weeks, three fish in the cage were selected randomly to take blood samples, intestine tissues, and liver tissues. Blood samples were obtained from the caudal vein and then immediately centrifuged at 3000 rpm for 10 min at 4 °C. The separated plasma samples were stored at −20 °C until they were analyzed, and the tissues were frozen in a −80 °C freezer for later analysis.

2.4. Plasma Biochemical Analysis

Plasma biochemical parameters (TG: triglyceride, TC: total cholesterol, GLU: glucose, ALT: alanine transaminase, and AST: aspartic transaminase) were measured by a BS-400 automatic biochemical analyzer (Mindray, Shenzhen, China) using the corresponding Mindray Kits.

2.5. Analysis of Intestinal Antioxidant Indices

Intestinal antioxidant indices, including the activities of intestinal total catalase (CAT), total superoxide dismutase (T-SOD), glutathione peroxidase (GSH-Px), and the levels of glutathione (GSH) and malondialdehyde (MDA), were assayed by relevant assay kits (Jian Cheng Bioengineering Institute, Nanjing, China).

2.6. Total RNA Extraction and Real-Time RT–PCR Analysis

First, total RNA was extracted, and the quality and quantity of the RNA were evaluated with a spectrophotometer. Finally, the reaction system was set up and run on a real-time PCR machine. The reagents and machine models used in the above process were the same as those used in our previous study [16]. Moreover, β-actin was used as the internal reference gene, and the specific primers for the target genes used are shown in Table 2. The mRNA expression levels were determined according to Pfaffl’s mathematical model [26].

2.7. Streptococcus agalactiae Challenge Test

After sampling, 10 fish (average body weight 109.73 g) from each cage were challenged with Streptococcus agalactiae (S. agalactiae) in indoor recirculating culture barrels (180 L), the water temperature was controlled at 33–35 °C, the pH value ranged from 7.6 ± 0.2, and dissolved oxygen levels were maintained at 6–7 mg/L. Before the challenge experiment, the pre-experiment was carried out to determine the half-lethal concentration (1 × 106 CFU/mL) of S. agalactiae using a bacterial turbidimeter (SGZ-6AXJ, Yue Feng Instrument Co. Ltd., Shanghai, China). The specific method is described in our previous study [27]. Then, the fish were challenged by intraperitoneal injection with 1 mL/100 g (1% of body weight). The mortality rate within 144 h was recorded.

2.8. Data Analysis

The data were subjected to normality and homogeneity tests. The experimental data (means  ±  SEM) were analyzed using SPSS 24.0 statistical software for one-way analysis of variance (ANOVA). When the difference was significant (p < 0.05), Duncan’s multiple comparisons were performed.

3. Results

3.1. Plasma Biochemical Composition

Table 3 presents the plasma biochemical variables. Among the plasma variables, the plasma glucose (GLU) contents were insignificant across the treatments (p > 0.05). The plasma triglyceride (TG) content showed an increasing tendency with increasing dietary protein levels up to 29.28% (p < 0.05), and decreased thereafter. The highest plasma total cholesterol (TC) content was observed in the 31.69% dietary protein group (p < 0.05). The group with 31.69% dietary protein in the feed had significantly decreased plasma alanine transaminase (ALT) and aspartate aminotransferase (AST) activities (p < 0.05).

3.2. Intestinal Enzyme and Antioxidant Status

Table 4 shows that the GSH contents and GSH-Px activities were affected by dietary protein levels (p < 0.05). The highest GSH content was observed in the 29.28% dietary protein group, while the 31.69% dietary protein level yielded the largest GSH-Px activity. In addition, the other intestinal antioxidant enzyme activity indices (CAT, T-SOD, and MDA) were not affected (p > 0.05).

3.3. Gene Expression Analysis of Glucose Metabolism

Figure 1 shows the results of the gene expression analysis of the glucose metabolism-related genes. The mRNA expression levels of PK were significantly upregulated by 26.25% dietary protein (p < 0.05, Figure 1B). The GK mRNA showed the same phenomenon as PK, but the difference was not significant (p > 0.05, Figure 1A). The highest PEPCK and G6Pase mRNA levels were observed in the 29.28% and 31.69% dietary protein groups, respectively (p < 0.05, Figure 1C,D).

3.4. Gene Expression Analysis of Lipid Metabolism

Figure 2 shows the results of the gene expression analysis of the lipid metabolism-related genes. Dietary protein (31.69%) significantly upregulated PPAR-α mRNA expression levels (p < 0.05, Figure 2A), and CPT1 mRNA showed the same phenomenon (p < 0.05, Figure 2B). The PPAR-γ, SREBP1c and FAS mRNA expression levels decreased with increasing dietary protein levels, and the 26.45% dietary protein group produced the peak values (p < 0.05, Figure 2C–E).

3.5. Gene Expression Analysis of HSP90 and Antioxidant Status

Figure 3 shows the results of the gene expression analysis of HSP90 and antioxidant-related genes. The HSP90 mRNA expression levels increased with increasing dietary protein levels up to 31.69% (p < 0.05, Figure 3A) and decreased thereafter.
The expression levels of the antioxidant-related genes CAT, SOD, and GPx increased with increasing dietary protein levels up to 31.69%, and then decreased. The maximum levels were found in the 31.69% dietary protein group (p < 0.05, Figure 3C–E). However, HO-1 mRNA was not affected by the protein treatments (p > 0.05, Figure 3B).

3.6. Gene Expression Analysis of Immunity

Figure 4 shows the results of the gene expression analysis of immunity-related genes. Dietary protein levels did not markedly affect the TNF-α, IFN-γ, and IL-8 mRNA expression levels (p > 0.05, Figure 4A–C). In addition, the mRNA expression level of IL-10 reached a maximum value of 31.69% dietary protein (p < 0.05, Figure 4D).

3.7. Streptococcus agalactiae Challenge Test

Figure 5 shows the survival rate of the GIFT fed with different dietary protein levels with the Streptococcus agalactiae challenge after 144 h. The highest survival rate of GIFT was observed among fish given food with 31.69% dietary protein at 144 h (p < 0.05).

4. Discussion

This study demonstrated that dietary protein had significant effects on the glucose and lipid metabolism of GIFT under high temperatures. In this study, low-protein diets increased the expression of glycolysis-related genes, and 26.45% dietary protein resulted in the highest PK mRNA expression levels. It was found that increasing the carbohydrate levels in the feed induces an increase in glycolytic enzyme activities in the liver, which was consistent with a previous study on rainbow trout (Oncorhynchus mykiss) and common carp (Cyprinus carpio) [28]. In addition, the gluconeogenesis-related genes PEPCK and G6Pase were activated in the 29.28% and 31.69% dietary protein groups, respectively, which were higher than the levels in the 26.45% dietary protein group. This finding indicated that metabolic regulation occurred in GIFT when fed low-protein diets (26.45%, 29.28%, and 31.69%) with high carbohydrate levels, which means that low-protein diets enable rapid adaptation of hepatic glucose metabolism and increased enzyme activity under high temperatures, thus increasing the availability of glucose [29]. Cai et al. [30] reported that a low-protein diet may be more appropriate at higher temperatures due to alterations in liver metabolism. Plasma GLU is an important energy supplier in the fish body and can directly provide energy for various life activities of the fish [31]. In our current study, the plasma GLU contents did not differ significantly among all groups, which was different from other reports that blood glucose levels tend to increase with carbohydrate contents [32,33]. Our current study suggested that dietary protein levels did not influence the energy homeostasis of juvenile GIFT, which may be caused by external temperature factors. However, studies investigating the effect of dietary protein on the plasma parameters of fish under high-temperature stress are still limited, and further investigation is needed.
Regarding lipid metabolism, the PPAR signaling pathway plays an important role in regulating the transcription of genes [34]. PPAR-α and PPAR-γ regulate lipid catabolism and synthesis in lipid metabolism homeostasis, respectively [35]. In this experiment, the expression levels of PPAR-γ mRNA presented a decreasing trend with increasing dietary protein levels. In addition, the downstream factor FAS also showed the same tendency: the highest mRNA level was found in the lowest protein diet (26.45%), which was higher than that in the other groups. This result was in line with our previous study [1] on grass carp, which indicated that low-protein diets could cause an accumulation of lipids in the liver. Furthermore, SREBP1c has a positive correlation with lipid synthesis-related genes [36], which also presented the same phenomenon as PPAR-γ. In addition, the lipolysis-related gene PPAR-α showed a trend of increasing and then decreasing, and the 31.69% dietary protein group achieved the peak value. As a downstream signaling molecule, CPT1 also regulates fatty acid β-oxidation [37], and it exhibited the same trend in response to dietary protein treatments. Our current study indicated that appropriate dietary protein (31.69%) could promote lipolysis and release more energy. As the main sources of blood lipids, the plasma TG and TC contents in the low-protein diets (26.45%, 29.28%, and 31.69%) were higher than those in the high-protein diets (33.68%, 36.18%, and 38.75%), and the highest levels were observed in the 29.28% and 31.69% dietary protein groups. The reason for this result may be the high carbohydrate contents in the low-protein diets, and, thus, the fish can synthesize fat from carbohydrates [38].
High-temperature stress also suppresses the immune system of the fish body while facilitating the growth and reproduction of pathogenic bacteria and reducing the resistance of tilapia to pathogenic bacteria [39]. In the current study, dietary protein levels also had significant effects on the antioxidant status and immune response of GIFT under high temperatures. Under stressful conditions, HSP90 acts as a regulatory enzyme to prevent irreversible protein aggregation and to improve cellular tolerance to stress [40]. Our experimental results showed that an appropriate dietary protein level (31.69%) could activate the expression of HSP90, which was higher than the levels with other dietary treatments. This result indicated that an appropriate dietary protein level (31.69%) enhances the ability to scavenge free radicals and improves the immunity of GIFT under high-temperature stress. Rokutan et al. [41] revealed that increased oxygen radicals can act as a stressor to induce the production of HSP, while HSP can increase the level of peroxidase, inhibit the key enzymes that produce oxygen radicals, and ultimately scavenge oxygen radicals. In addition, HSP significantly attenuates protein exudation during inflammation and inhibits the inflammatory response [42].
High-temperature stress can cause oxidative stress in fish, leading to oxidative damage. The body responds by regulating gene expression levels and regulating the key antioxidant enzymes for oxidative stress [43]. According to previous studies, high expression of antioxidant enzymes can prevent oxidative stress in fish [44]. Numerous studies have shown that the activity of antioxidant enzymes decreases under high-temperature stress, indicating that fish are unable to eliminate the damage produced by peroxides [45,46]. Interestingly, appropriate dietary protein levels could improve the antioxidant enzymes in some fish species [47,48], which supports our findings. In the current study, the highest GSH content was found in the 29.28% dietary protein group, while the 31.69% dietary protein group yielded the maximum GSH-Px activity. In addition, the corresponding antioxidant enzyme genes (CAT, SOD, and GPx) increased continuously with increasing dietary protein levels; however, they started to decrease when the dietary protein level exceeded 31.69%. As downstream regulators of HSPs [49], CAT, SOD, and GPx mRNA showed the same tendency as HSP90, which suggested that the 31.69% dietary protein treatment could significantly improve the intestinal antioxidant capacity of GIFT.
On the other hand, high levels of HSP90 produce a strong stimulus to the body and enhanced immune function [50]. According to previous studies, heat shock proteins reduce damage to the body from inflammatory responses by inhibiting reactive oxygen species and cytokines [42,51]. In this experiment, the pro-inflammatory factors TNF-α, IFN-γ, and IL-8 were not affected by dietary protein treatments under high temperature, while the anti-inflammatory factor IL-10 showed a similar tendency to HSP90, and the highest expression level was found in the 31.69% dietary protein group. Li et al. [52] reported that simultaneous activation of HSPs and anti-inflammatory factors helped to improve the immunity of common carp (Cyprinus carpio L.), which was consistent with our findings in tilapia. In addition, plasma ALT and AST activities can be used as indicators of fish health [53]. In this study, the 31.69% dietary protein group had the lowest ALT and AST activities, while the highest levels were observed with the highest protein diet (38.75%), which suggested that high-protein diets are not good for fish health under high-temperature stress.
In addition, tilapia are more susceptible to Streptococcus agalactiae infection in high-temperature environments. Thus, it is important to select the appropriate dietary protein level to improve the antibacterial ability. In this study, the survival rate of juvenile GIFT fed 31.69% dietary protein was significantly higher than that of other groups (except 29.28% dietary protein) after a Streptococcus agalactiae challenge, which suggested that 31.69% dietary protein level could also enhance the immunity and antioxidant capacity to resist pathogenic bacterial infection.
A previous report has shown that suitable water temperatures for tilapia growth range from 29 to 31 °C [21]. Under appropriate temperature, numerous studies on tilapia have shown that the optimal protein levels of tilapia range from 33% to 35% [54,55,56], which is higher than the optimal protein requirement (29.28–31.69%) under high temperature in this study. The differences could be explained by high temperatures beyond the optimal growth temperatures inducing retarded growth; meanwhile, high-protein feeds are more detrimental to protein utilization [57]. Combined with the immunization results of this experiment, it can be concluded that adequate reduction of dietary protein levels at high temperatures is more beneficial for tilapia to improve its disease resistance than under suitable temperature conditions.

5. Conclusions

Under a high-temperature environment, low-protein feed (26.45%) enhanced the level of glycolysis and lipid synthesis, and supplementation with appropriate protein (29.28% and 31.69%) enhanced the level of gluconeogenesis and lipolysis. In addition, appropriate dietary protein (29.28% and 31.69%) can effectively improve the antioxidant capacity, enhance immune function, and strengthen the antibacterial capacity of GIFT at high temperature (Figure 6). Overall, 29.28–31.69% dietary protein was recommended in the diet of GIFT in a high-temperature environment.

Author Contributions

Conceptualization, M.R.; Data curation, D.H.; Funding acquisition, M.R.; Investigation, D.H., H.L. and J.Z.; Methodology, D.H., H.L. and J.Z.; Project administration, M.R.; Supervision, M.R. and X.G.; Writing—original draft, D.H.; Writing—review & editing, M.R. and X.G. All authors have read and agreed to the published version of the manuscript.

Funding

This study was financially supported by the National Key Research and Development Program of China (2018YFD0900400), the earmarked fund for CARS (CARS-46).

Institutional Review Board Statement

The study was conducted according to Standardization Administration of China protocols and guidelines (GB/T 35892-2018), and approved by the Institutional Animal Care and Ethics Committee of Nanjing Agricultural University (Permit number: SYXK (Su) 2011–0036).

Data Availability Statement

The authors confirm that the data supporting the findings of this study are available within the manuscript, tables and figures.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Yu, H.; Liang, H.; Ren, M.; Ge, X.; Ji, K.; Huang, D.; Pan, L.; Xia, D. A study to explore the effects of low dietary protein levels on the growth performance and nutritional metabolism of grass carp (Ctenopharyngodon idella) fry. Aquaculture 2022, 546, 737324. [Google Scholar] [CrossRef]
  2. Lu, X.; Wei, H.; Yang, C.; Li, Q.; Li, P.; Chen, J.; Sun, Y.; Wen, H.; Jiang, M.; Wang, G. Effects of dietary protein levels on growth performance and liver transcriptome changes in juvenile top-mouth culter Erythroculter ilishaeformis. Aquac. Rep. 2021, 21, 100964. [Google Scholar] [CrossRef]
  3. Liang, M.; Wang, J.; Chang, Q.; Mai, K. Effects of different levels of fish protein hydrolysate in the diet on the nonspecific immunity of Japanese sea bass, Lateolabrax japonicus (Cuvieret Valenciennes, 1828). Aquac. Res. 2005, 37, 102–106. [Google Scholar] [CrossRef]
  4. Xia, S.; Sun, J.; Li, M.; Zhao, W.; Zhang, D.; You, H.; Rajkumar, M.; Wu, B. Influence of dietary protein level on growth performance, digestibility and activity of immunity-related enzymes of leopard coral grouper, Plectropomus leopardus (Lacépède, 1802). Aquac. Nutr. 2020, 26, 242–247. [Google Scholar] [CrossRef]
  5. Ojaveer, H.; Morris, P.C.; Davies, S.J.; Russell, P. The response of thick-lipped grey mullet, Chelon labrosus (Risso), to diets of varied protein-to-energy ratio. Aquac. Res. 1996, 27, 603–612. [Google Scholar] [CrossRef]
  6. Doran, O.; Moule, S.K.; Teye, G.A.; Whittington, F.M.; Hallett, K.G.; Wood, J.D. A reduced protein diet induces stearoyl-CoA desaturase protein expression in pig muscle but not in subcutaneous adipose tissue: Relationship with intramuscular lipid formation. Br. J. Nutr. 2006, 95, 609–617. [Google Scholar] [CrossRef]
  7. Pascual, C.; Zenteno, E.; Cuzon, G.; Suárez, J.; Sánchez, A.; Gaxiola, G.; Taboada, G.; Maldonado, T.; Rosas, C. Litopenaeus vannamei juveniles energetic balance and immunological response to dietary proteins. Aquaculture 2004, 239, 375–395. [Google Scholar] [CrossRef]
  8. Kiron, V.; Watanabe, T.; Fukuda, H.; Okamoto, N.; Takeuchi, T. Protein nutrition and defence mechanisms in rainbow trout Oncorhynchus mykiss. Comp. Biochem. Physiol. Part A Physiol. 1995, 111, 351–359. [Google Scholar] [CrossRef]
  9. Ma, S.; Guo, Y.; Sun, L.; Fan, W.; Liu, Y.; Liu, D.; Huang, D.; Li, X.; Zhang, W.; Mai, K. Over high or low dietary protein levels depressed the growth, TOR signaling, apoptosis, immune and anti-stress of abalone Haliotis discus hannai. Fish Shellfish Immunol. 2020, 106, 241–251. [Google Scholar] [CrossRef]
  10. Sun, L.; Chen, H.; Huang, L. Growth, faecal production, nitrogenous excretion and energy budget of juvenile yellow grouper (Epinephelus awoara) relative to ration level. Aquaculture 2007, 264, 228–235. [Google Scholar] [CrossRef]
  11. Hu, Y.-C.; Kang, C.-K.; Tang, C.-H.; Lee, T.-H. Transcriptomic Analysis of Metabolic Pathways in Milkfish That Respond to Salinity and Temperature Changes. PLoS ONE 2015, 10, e0134959. [Google Scholar] [CrossRef]
  12. Callaghan, N.I.; Tunnah, L.; Currie, S.; MacCormack, T.J. Metabolic Adjustments to Short-Term Diurnal Temperature Fluctuation in the Rainbow Trout (Oncorhynchus mykiss). Physiol. Biochem. Zool. 2016, 89, 498–510. [Google Scholar] [CrossRef]
  13. Forgati, M.; Kandalski, P.K.; Herrerias, T.; Zaleski, T.; Machado, C.; Souza, M.R.D.P.; Donatti, L. Effects of heat stress on the renal and branchial carbohydrate metabolism and antioxidant system of Antarctic fish. J. Comp. Physiol. B 2017, 187, 1137–1154. [Google Scholar] [CrossRef]
  14. Fernandez, M.V.S.; Johnson, J.S.; Abuajamieh, M.; Stoakes, S.K.; Seibert, J.T.; Cox, L.; Kahl, S.; Elsasser, T.H.; Ross, J.W.; Isom, S.C.; et al. Effects of heat stress on carbohydrate and lipid metabolism in growing pigs. Physiol. Rep. 2015, 3, e12315. [Google Scholar] [CrossRef]
  15. Zhao, T.; Ma, A.; Huang, Z.; Liu, Z.; Sun, Z.; Zhu, C.; Yang, J.; Li, Y.; Wang, Q.; Qiao, X.; et al. Transcriptome analysis reveals that high temperatures alter modes of lipid metabolism in juvenile turbot (Scophthalmus maximus) liver. Comp. Biochem. Physiol. Part D Genom. Proteom. 2021, 40, 100887. [Google Scholar] [CrossRef]
  16. Huang, D.; Ren, M.; Liang, H.; Ge, X.; Xu, H.; Wu, L. Transcriptome analysis of the effect of high-temperature on nutrient metabolism in juvenile grass carp (Ctenopharyngodon idellus). Gene 2021, 809, 146035. [Google Scholar] [CrossRef]
  17. Aepahi, A.; Heidarieh, M.; Mirvaghefi, A.; Rafiee, G.R.; Farid, M.; Sheikhzadeh, N. Effects of water temperature on the susceptibility of rainbow trout to streptococcus agalactiae. Acta Sci. Vet. 2013, 41, 1–5. [Google Scholar]
  18. Cheng, A.-C.; Cheng, S.-A.; Chen, Y.-Y.; Chen, J.-C. Effects of temperature change on the innate cellular and humoral immune responses of orange-spotted grouper Epinephelus coioides and its susceptibility to Vibrio alginolyticus. Fish Shellfish Immunol. 2009, 26, 768–772. [Google Scholar] [CrossRef]
  19. Wang, X.; Wang, L.; Zhang, H.; Ji, Q.; Song, L.; Qiu, L.; Zhou, Z.; Wang, M.; Wang, L. Immune response and energy metabolism of Chlamys farreri under Vibrio anguillarum challenge and high temperature exposure. Fish Shellfish Immunol. 2012, 33, 1016–1026. [Google Scholar] [CrossRef]
  20. Fisheries and Aquaculture Software. FishStatJ-Software for Fishery and Aquaculture Statistical Time Series. In FAO Fisheries and Aquaculture Department, Food and Agriculture Organization; Rome, Italy. 2020. Available online: https://www.fao.org/home/en/ (accessed on 28 December 2020).
  21. Amal, M.N.A.; Zamri-Saad, M. Streptococcosis in tilapia (Oreochromis niloticus): A review. Pertanika J. Trop. Agric. Sci. 2011, 34, 195–206. [Google Scholar]
  22. Huang, D.; Liang, H.; Ren, M.; Ge, X.; Zhang, Q.; Gu, J. The optimum dietary protein requirement of the genetically improved farmed tilapia (GIFT: Oreochromis niloticus): Effects on growth performance and protein metabolism via GH-IGF axis and TOR signalling pathway at different seasonal growth stages. Aquac. Res. 2022, 1–15. [Google Scholar] [CrossRef]
  23. Rodkhum, C.; Kayansamruaj, P.; Pirarat, N.; Zhou, W.; Liu, Y.; Chen, G.H. Effect of water temperature on susceptibility to Streptococcus agalactiae serotype Ia infection in Nile tilapia (Oreochromis niloticus). Thai J. Vet. Med. 2011, 41, 309. [Google Scholar]
  24. Kayansamruaj, P.; Pirarat, N.; Hirono, I.; Rodkhum, C. Increasing of temperature induces pathogenicity of Streptococcus agalactiae and the up-regulation of inflammatory related genes in infected Nile tilapia (Oreochromis niloticus). Veter-Microbiol. 2014, 172, 265–271. [Google Scholar] [CrossRef] [PubMed]
  25. Association of Official Analytical Chemists (AOAC). Official Methods of Analysis of the Association of Official Analytical Chemists, 15th ed.; Association of Official Analytical Chemists Inc.: Arlington, TX, USA, 2003. [Google Scholar]
  26. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, 2002–2007. [Google Scholar] [CrossRef] [PubMed]
  27. Liang, H.; Ji, K.; Ge, X.; Ren, M.; Liu, B.; Xi, B.; Pan, L. Effects of dietary arginine on antioxidant status and immunity involved in AMPK-NO signaling pathway in juvenile blunt snout bream. Fish Shellfish Immunol. 2018, 78, 69–78. [Google Scholar] [CrossRef]
  28. Panserat, S.; Médale, F.; Blin, C.; Brèque, J.; Vachot, C.; Plagnes-Juan, E.; Gomes, E.; Krishnamoorthy, R.; Kaushik, S. Hepatic glucokinase is induced by dietary carbohydrates in rainbow trout, gilthead seabream, and common carp. Am. J. Physiol. Integr. Comp. Physiol. 2000, 278, R1164–R1170. [Google Scholar] [CrossRef] [PubMed]
  29. Kumar, S.; Sahu, N.P.; Pal, A.K.; Subramanian, S.; Priyadarshi, H.; Kumar, V. High dietary protein combats the stress of Labeo rohita fingerlings exposed to heat shock. Fish Physiol. Biochem. 2011, 37, 1005–1019. [Google Scholar] [CrossRef]
  30. Cai, L.-S.; Wang, L.; Song, K.; Lu, K.-L.; Zhang, C.-X.; Rahimnejad, S. Evaluation of protein requirement of spotted seabass (Lateolabrax maculatus) under two temperatures, and the liver transcriptome response to thermal stress. Aquaculture 2020, 516, 734615. [Google Scholar] [CrossRef]
  31. Atli, G.; Ariyurek, S.Y.; Kanak, E.G.; Canli, M. Alterations in the serum biomarkers belonging to different metabolic systems of fish (Oreochromis niloticus) after Cd and Pb exposures. Environ. Toxicol. Pharmacol. 2015, 40, 508–515. [Google Scholar] [CrossRef]
  32. Yu, H.; Ai, Q.; Mai, K.; Ma, H.; Cahu, C.L.; Infante, J.L.Z. Effects of dietary protein levels on the growth, survival, amylase and trypsin activities in large yellow croaker, Pseudosciaena Crocea R., larvae. Aquac. Res. 2012, 43, 178–186. [Google Scholar] [CrossRef]
  33. Ye, C.; Wu, Y.; Sun, Z.; Wang, A. Dietary protein requirement of juvenile obscure puffer, Takifugu obscurus. Aquac. Res. 2017, 48, 2064–2073. [Google Scholar] [CrossRef]
  34. Ibabe, A.; Bilbao, E.; Cajaraville, M.P. Expression of peroxisome proliferator-activated receptors in zebrafish (Danio rerio) depending on gender and developmental stage. Histochem. Cell Biol. 2004, 123, 75–87. [Google Scholar] [CrossRef]
  35. Kota, B.P.; Huang, T.H.-W.; Roufogalis, B.D. An overview on biological mechanisms of PPARs. Pharmacol. Res. 2005, 51, 85–94. [Google Scholar] [CrossRef]
  36. Gou, N.; Chang, Z.; Deng, W.; Ji, H.; Zhou, J. Effects of dietary lipid levels on growth, fatty acid composition, antioxidant status and lipid metabolism in juvenile Onychostoma macrolepis. Aquac. Res. 2019, 50, 3369–3381. [Google Scholar] [CrossRef]
  37. Kerner, J.; Hoppel, C. Fatty acid import into mitochondria. Biochim. Biophys. Acta—Mol. Cell Biol. Lipids 2000, 1486, 1–17. [Google Scholar] [CrossRef]
  38. Wu, F.N.; Wen, H.; Jiang, M.; Liu, W.; Liu, B.; Tian, J.; Yang, C.G. Effects of different dietary carbohydrate levels on growth performance and blood biochemical parameters of juvenile GIFT tilapia (Oreochromis niloticus). J. Northwest A F Univ.-Nat. Sci. Ed. 2012, 40, 8–14. [Google Scholar]
  39. Wongsathein, D. Factors Affecting Experimental Streptococcus Agalactiae Infection in Tilapia, Oreochromis Niloticus; University of Stirling: Stirling, UK, 2012; Available online: https://hdl.handle.net/1893/10375 (accessed on 27 September 2012).
  40. Miyata, Y.; Yahara, I. The 90-kDa heat shock protein, HSP90, binds and protects casein kinase II from self-aggregation and enhances its kinase activity. J. Biol. Chem. 1992, 267, 7042–7047. [Google Scholar] [CrossRef]
  41. Rokutan, K.; Hirakawa, T.; Teshima, S.; Nakano, Y.; Miyoshi, M.; Kawai, T.; Konda, E.; Morinaga, H.; Nikawa, T.; Kishi, K. Implications of heat shock/stress proteins for medicine and disease. J. Med. Investig. 1998, 44, 137–147. [Google Scholar]
  42. Weiss, Y.G.; Maloyan, A.; Tazelaar, J.; Raj, N.; Deutschman, C.S. Adenoviral transfer of HSP-70 into pulmonary epithelium ameliorates experimental acute respiratory distress syndrome. J. Clin. Investig. 2002, 110, 801–806. [Google Scholar] [CrossRef]
  43. Liang, H.; Mokrani, A.; Ji, K.; Ge, X.; Ren, M.; Pan, L.; Sun, A. Effects of dietary arginine on intestinal antioxidant status and immunity involved in Nrf2 and NF-κB signaling pathway in juvenile blunt snout bream, Megalobrama amblycephala. Fish Shellfish Immunol. 2018, 82, 243–249. [Google Scholar] [CrossRef]
  44. Liu, J.; Mai, K.; Xu, W.; Zhang, Y.; Zhou, H.; Ai, Q. Effects of dietary glutamine on survival, growth performance, activities of digestive enzyme, antioxidant status and hypoxia stress resistance of half-smooth tongue sole (Cynoglossus semilaevis Günther) post larvae. Aquaculture 2015, 446, 48–56. [Google Scholar] [CrossRef]
  45. Liu, B.; Xie, J.; Ge, X.; Xu, P.; Wang, A.; He, Y.; Zhou, Q.; Pan, L.; Chen, R. Effects of anthraquinone extract from Rheum officinale Bail on the growth performance and physiological responses of Macrobrachium rosenbergii under high temperature stress. Fish Shellfish Immunol. 2010, 29, 49–57. [Google Scholar] [CrossRef]
  46. Yu, M.-F.; Zhao, X.-M.; Cai, H.; Yi, J.-M.; Hua, G.-H. Dihydropyridine Enhances the Antioxidant Capacities of Lactating Dairy Cows under Heat Stress Condition. Animals 2020, 10, 1812. [Google Scholar] [CrossRef]
  47. Yan, J.; Li, Y.; Liang, X.; Zhang, Y.; Dawood, M.A.; Matuli’C, D.; Gao, J. Effects of dietary protein and lipid levels on growth performance, fatty acid composition and antioxidant-related gene expressions in juvenile loach Misgurnus anguillicaudatus. Aquac. Res. 2017, 48, 5385–5393. [Google Scholar] [CrossRef]
  48. Xu, J.; Feng, L.; Jiang, W.-D.; Wu, P.; Liu, Y.; Jiang, J.; Kuang, S.-Y.; Tang, L.; Zhou, X.-Q. Different dietary protein levels affect flesh quality, fatty acids and alter gene expression of Nrf2-mediated antioxidant enzymes in the muscle of grass carp (Ctenopharyngodon idella). Aquaculture 2018, 493, 272–282. [Google Scholar] [CrossRef]
  49. Yamamoto, Y.; Kume, M.; Yamaoka, Y. Implications of heat shock proteins during liver surgery and liver perfusion. Isol. Liver Perfus. Hepatic Tumors 1998, 147, 157–172. [Google Scholar] [CrossRef]
  50. Lauber, K.; Brix, N.; Ernst, A.; Hennel, R.; Krombach, J.; Anders, H.; Belka, C. Targeting the heat shock response in combination with radiotherapy: Sensitizing cancer cells to irradiation-induced cell death and heating up their immunogenicity. Cancer Lett. 2015, 368, 209–229. [Google Scholar] [CrossRef]
  51. Wong, H.R. Heat shock proteins. Facts, thoughts, and dreams. Shock 1999, 11, 323–325. [Google Scholar] [CrossRef]
  52. Li, Y.; Ding, W.; Li, X. Acute exposure of glyphosate-based herbicide induced damages on common carp organs via heat shock proteins-related immune response and oxidative stress. Toxin Rev. 2019, 40, 1071–1083. [Google Scholar] [CrossRef]
  53. Sheikh, Z.A.; Ahmed, I. Impact of environmental changes on plasma biochemistry and hematological parameters of Himalayan snow trout, Schizothorax plagiostomus. Comp. Clin. Pathol. 2019, 28, 793–804. [Google Scholar] [CrossRef]
  54. Wang, K.W.; Takeuchi, T.; Watanabe, T. Effect of dietary protein levels on growth of Tilapia nilotica. Bull. Jpn. Soc. Sci. Fish. 1985, 51, 133–140. [Google Scholar] [CrossRef]
  55. Sayed, A.N. Optimum Crude Protein Requirement of the Fingerlings Nile Tilapia (Oreochromis niloticus). Biol. Sci. 2018, 2, 1–8. [Google Scholar] [CrossRef]
  56. Kpundeh, M.D.; Qiang, J.; He, J.; Yang, H.; Xu, P. Effects of dietary protein levels on growth performance and haemato-immunological parameters of juvenile genetically improved farmed tilapia (GIFT), Oreochromis niloticus. Aquac. Int. 2015, 23, 1189–1201. [Google Scholar] [CrossRef]
  57. Lu, K.L.; Cai, L.S.; Wang, L.; Song, K.; Zhang, C.X.; Rahimnejad, S. Effects of dietary protein/energy ratio and water temperature on growth performance, digestive enzymes activity and non-specific immune response of spotted seabass (Lateolabrax macu-latus). Aquac. Nutr. 2020, 26, 2023–2031. [Google Scholar] [CrossRef]
Fishes 07 00202 g001 550
Figure 1. Relative mRNA expressions of glucose metabolism-related genes with dietary protein levels. (A) GK; (B) PK; (C) PEPCK; (D) G6Pase. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Figure 1. Relative mRNA expressions of glucose metabolism-related genes with dietary protein levels. (A) GK; (B) PK; (C) PEPCK; (D) G6Pase. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Fishes 07 00202 g001
Fishes 07 00202 g002a 550Fishes 07 00202 g002b 550
Figure 2. Relative mRNA expressions of lipid metabolism-related genes with dietary protein levels. (A) PPAR-α; (B) CPT1; (C) PPAR-γ; (D) SREBP1c; (E) FAS. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Figure 2. Relative mRNA expressions of lipid metabolism-related genes with dietary protein levels. (A) PPAR-α; (B) CPT1; (C) PPAR-γ; (D) SREBP1c; (E) FAS. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Fishes 07 00202 g002aFishes 07 00202 g002b
Fishes 07 00202 g003a 550Fishes 07 00202 g003b 550
Figure 3. Relative mRNA expressions of HSP90 and antioxidant-related genes with dietary protein levels. (A) HSP90; (B) HO-1; (C) CAT; (D) SOD; (E) GPx. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Figure 3. Relative mRNA expressions of HSP90 and antioxidant-related genes with dietary protein levels. (A) HSP90; (B) HO-1; (C) CAT; (D) SOD; (E) GPx. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Fishes 07 00202 g003aFishes 07 00202 g003b
Fishes 07 00202 g004a 550Fishes 07 00202 g004b 550
Figure 4. Relative mRNA expressions of antioxidant and immune-related genes with dietary protein levels. (A) TNF-α; (B) IFN-γ; (C) IL-8; (D) IL-10. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Figure 4. Relative mRNA expressions of antioxidant and immune-related genes with dietary protein levels. (A) TNF-α; (B) IFN-γ; (C) IL-8; (D) IL-10. Data are expressed as means with SEM (n = 9). Values with different superscripts are significantly different (p < 0.05).
Fishes 07 00202 g004aFishes 07 00202 g004b
Fishes 07 00202 g005 550
Figure 5. The survival rate of GIFTs fed with different dietary protein levels with Streptococcus agalactiae challenge after 144h. Data are expressed as means with SEM (n = 3). Values with different superscripts are significantly different (p < 0.05).
Figure 5. The survival rate of GIFTs fed with different dietary protein levels with Streptococcus agalactiae challenge after 144h. Data are expressed as means with SEM (n = 3). Values with different superscripts are significantly different (p < 0.05).
Fishes 07 00202 g005
Fishes 07 00202 g006 550
Figure 6. Regulation mechanism of improving health status by appropriate dietary protein levels in GIFT under high-temperature environment.
Figure 6. Regulation mechanism of improving health status by appropriate dietary protein levels in GIFT under high-temperature environment.
Fishes 07 00202 g006
Table
Table 1. Formulation and proximate composition (% dry matter) of experimental diets.
Table 1. Formulation and proximate composition (% dry matter) of experimental diets.
IngredientsDiet 1Diet 2Diet 3Diet 4Diet 5Diet 6
Fish meal a2.00 2.00 2.00 2.00 2.00 2.00
Rapeseed meal a25.00 25.00 25.00 25.00 25.00 25.00
Soybean meal a2.00 10.00 18.00 26.00 34.00 43.00
Cottonseed meal a9.00 9.00 9.00 9.00 9.00 9.00
Wheat flour a35.00 29.30 23.60 17.90 12.20 6.00
Soybean oil 2.50 2.50 2.50 2.50 2.50 2.50
Choline chloride 0.50 0.50 0.50 0.50 0.50 0.50
Vitamin C (35%) 0.05 0.05 0.05 0.05 0.05 0.05
Vitamins premix b2.00 2.00 2.00 2.00 2.00 2.00
Mineral premix c2.00 2.00 2.00 2.00 2.00 2.00
Calcium dihydrogen phosphate2.50 2.50 2.50 2.50 2.50 2.50
Rice bran10.00 8.00 6.50 5.00 3.50 2.00
Microcrystalline cellulose4.62 4.35 3.71 3.08 2.26 0.96
Ethoxy quinoline0.01 0.01 0.01 0.01 0.01 0.01
Bentonite2.00 2.00 2.00 2.00 2.00 2.00
Lysine d0.32 0.26 0.14 0.00 0.00 0.00
Methionine d0.33 0.38 0.40 0.42 0.47 0.48
Threonine d0.17 0.15 0.09 0.04 0.02 0.00
Analyzed proximate composition
Dry matter (%)94.1693.2993.2993.8292.7992.21
Crude protein (%)26.45 29.28 31.69 33.68 36.18 38.75
Crude lipid (%)4.56 4.35 4.65 4.39 4.60 4.31
Crude ash (%)10.56 10.54 10.94 11.22 11.25 11.74
Crude fiber (%)6.176.326.576.817.057.36
NFE e46.4242.8039.4437.7233.7130.05
Gross energy (KJ/g)17.96 18.03 18.00 18.03 18.06 18.14
Note: The feed formulation referred to our previous study [22]. a Fish meal, crude protein 65.8%, crude lipid 9.5%; Rapeseed meal, crude protein 41.3%, crude lipid 6.1%; Soybean meal, crude protein 50.8%, crude lipid 4.3%; Cottonseed meal, crude protein 53.7%, crude lipid 1.4%; Wheat flour, crude protein 13.1%, crude lipid 4.0%. They were obtained from Wuxi Tongwei feedstuffs Co., Ltd., Wuxi, China. b Vitamins premix were obtained from HANOVE Animal Health Products Co. LTD (IU, mg/kg of diet): Vitamin A, 900,000 IU; Vitamin D, 250,000 IU; Vitamin E, 4500 mg; Vitamin K3, 220 mg; Vitamin B1, 320 mg; Vitamin B2, 1090 mg; Vitamin B5, 2000 mg; Vitamin B6, 5000 mg; Vitamin B12, 116 mg; Pantothenate, 1000 mg; Folic acid, 165 mg; Choline, 60,000 mg; Biotin, 50 mg Niacin acid, 2500 mg. c Mineral premix was obtained from HANOVE Animal Health Products Co. LTD (g/kg of diet): calcium biphosphate, 20 g; sodium chloride, 2.6 g; potassium chloride, 5 g; magnesium sulphate, 2 g; ferrous sulphate, 0.9 g; zinc sulphate, 0.06 g; cupric sulphate, 0.02 g; manganese sulphate, 0.03 g; sodium selenate, 0.02 g; cobalt chloride, 0.05 g; potassium iodide, 0.004 g. d Lysine, methionine and threonine, obtained from Feeer Co., LTD (Shanghai, China). e NFE (nitrogen free extract, %) = dry matter (%)—(crude protein (%) + crude lipid (%) + crude ash (%) + crude fiber (%)).
Table
Table 2. Primer sequence for qRT-PCR.
Table 2. Primer sequence for qRT-PCR.
GeneForward Primer (5′-3′) Reverse Primer (5′-3′)
CAT aGGAAGAGGATGACGAAGAGGTTACGGCGAGATGATGT
CPT1 bTCAACACCACACGCATTCCTAAAGTAGCGCCCTTTGTGGT
FAS cTCATCCAGCAGTTCACTGGCATTTGATTAGGTCCACGGCCACA
G6Pase dAGCGCGAGCCTGAAGAAGTACT ATGGTCCACAGCAGGTCCACAT
GK eGACATGAGGACATTGACAAGGGAACTTGATGGCGTCTCTGAGTAAACC
GPx fCCAAGAGAACTGCAAGAACGACAGGACACGTCATTCCTACAC
HO-1 gCTTGCCCGTGTGGAATCACTAGATCACCGAGGTAGCGAGT
HSP90 hATCATCAATGTCCAGCATCACATCTTCGCAGCATACCA
IFN-γ iATGGCTACCACAGTGAGGGCAGAACTCTGGGGCGACCTTTAGC
IL-8 jCTGTGAAGGCATGGGTGTGGAGTCGCAGTGGGAGTTGGGAAGAA
IL-10 kCTGCTAGATCAGTCCGTCGAAGCAGAACCGTGTCCAGGTAA
PEPCK lCTGCGCAAGTACAGCAACTGTCATGGCTTTGTCCCACTCC
PK mGCACTCCTCAGCTGGTTAATGCAAGCACTAGAGCAGGATTT
PPAR-α nTCCAAAAGAAGAACCGAAACATTCCACCTCTTTCTCAACCAT
PPAR-γ oTTTACCCATCAAACTGACCACGAGGAAATGGAGGCGTAGT
SOD pACAGAAGAGAAGTATCAGGAGCACCGTAACAGCAGACAT
SREBP1c qTGCAGCAGAGAGACTGTATCCGAACTGCCCTGAATGTGTTCAGACA
TNF-α rAAGCCAAGGCAGCCATCCATTTGACCATTCCTCCACTCCAGA
β-actinCCACACAGTGCCCATCTACGA CCACGCTCTGTCAGGATCTTCA
a CAT, catalase. b CPT1, carnitine palmitoyl transterase-1. c FAS, fatty acid synthase. d G6Pase, glucose-6-phosphatase. e GK, glucokinase. f GPx, glutathione peroxidase. g HO-1, heme oxygenase-1. h HSP90, heat shock protein 90. i IFN-γ, interferon γ. j IL-8, interleukin 8. k IL-10, interleukin 10. l PEPCK, phosphoenolpyruvate carboxykinase. m PK, pyruvate kinase. n PPAR-α, peroxisome proliferators-activated receptor-α. o PPAR-γ, peroxisome proliferators-activated receptor-γ. p SOD, superoxide dismutase. q SREBP1c, sterol-regulatory element binding protein 1c. r TNF-α, tumor necrosis factor α.
Table
Table 3. Plasma biochemical parameters.
Table 3. Plasma biochemical parameters.
Dietary Protein (%)GLU (mmol/L)TG (mmol/L)TC (mmol/L)ALT (U/L)AST (U/L)
26.4516.63 ± 1.5942.32 ± 0.86 b,c3.24 ± 0.08 a,b22.16 ± 2.35 a118.04 ± 11.00 a,b
29.2818.61 ± 0.7945.64 ± 1.86 c3.22 ± 0.07 a,b25.60 ± 1.89 a,b117.57 ± 13.99 a,b
31.6915.35 ± 0.8945.39 ± 2.90 c3.47 ± 0.08 b21.25 ± 3.68 a75.60 ± 16.75 a
33.6817.98 ± 1.1439.60 ± 2.37 a,b3.15 ± 0.13 a22.72 ± 4.05 a93.88 ± 14.74 a,b
36.1818.57 ± 0.6334.61 ± 1.18 a3.15 ± 0.06 a36.59 ± 3.32 b,c132.18 ± 18.08 b,c
38.7516.35 ± 1.1235.44 ± 1.44 a3.16 ± 0.08 a46.10 ± 5.75 c170.29 ± 20.01 c
Data are expressed as means with SEM (n = 9). Means in the same column with different superscripts a,b,c are significantly different (p < 0.05).
Table
Table 4. Antioxidant enzyme activities of GIFT fed with diets containing six levels of dietary protein under high temperature.
Table 4. Antioxidant enzyme activities of GIFT fed with diets containing six levels of dietary protein under high temperature.
Dietary Protein
(%)		CAT
(U/mg Protein)		T-SOD
(U/mg Protein)		MDA
(nmol/mg Protein)		GSH
(μmol/g Protein)		GSH-Px
(U/mg Protein)
26.451.68 ± 0.140.83 ± 0.060.25 ± 0.0421.64 ± 1.64 a,b6.59 ± 0.67 b
29.281.61 ± 0.120.73 ± 0.050.26 ± 0.0624.99 ± 1.37 b6.70 ± 0.61 b
31.691.60 ± 0.080.74 ± 0.060.21 ± 0.0422.64 ± 2.29 a,b7.42 ± 0.77 b
33.681.51 ± 0.140.70 ± 0.030.16 ± 0.0218.27 ± 1.71 a6.17 ± 0.64 a,b
36.181.46 ± 0.090.71 ± 0.030.31 ± 0.0317.71 ± 1.33 a5.56 ± 0.53 a,b
38.751.53 ± 0.090.68 ± 0.030.27 ± 0.0517.27 ± 1.76 a4.52 ± 0.44 a
Data are expressed as means with SEM (n = 9). Means in the same column with different superscripts a,b are significantly different (p < 0.05).
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Huang, D.; Liang, H.; Zhu, J.; Ren, M.; Ge, X. Dietary Protein Modifies Hepatic Glycolipid Metabolism, Intestinal Immune Response, and Resistance to Streptococcus agalactiae of Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus) Exposed to High Temperature. Fishes 2022, 7, 202. https://doi.org/10.3390/fishes7040202

AMA Style

Huang D, Liang H, Zhu J, Ren M, Ge X. Dietary Protein Modifies Hepatic Glycolipid Metabolism, Intestinal Immune Response, and Resistance to Streptococcus agalactiae of Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus) Exposed to High Temperature. Fishes. 2022; 7(4):202. https://doi.org/10.3390/fishes7040202

Chicago/Turabian Style

Huang, Dongyu, Hualiang Liang, Jian Zhu, Mingchun Ren, and Xianping Ge. 2022. "Dietary Protein Modifies Hepatic Glycolipid Metabolism, Intestinal Immune Response, and Resistance to Streptococcus agalactiae of Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus) Exposed to High Temperature" Fishes 7, no. 4: 202. https://doi.org/10.3390/fishes7040202

APA Style

Huang, D., Liang, H., Zhu, J., Ren, M., & Ge, X. (2022). Dietary Protein Modifies Hepatic Glycolipid Metabolism, Intestinal Immune Response, and Resistance to Streptococcus agalactiae of Genetically Improved Farmed Tilapia (GIFT: Oreochromis niloticus) Exposed to High Temperature. Fishes, 7(4), 202. https://doi.org/10.3390/fishes7040202

Article Metrics

Back to TopTop