Next Article in Journal
Annual Fecundity of European Anchovy: A Case Study in the North Aegean Sea (Eastern Mediterranean)
Previous Article in Journal
Dietary Supplementation in Aquaculture
Previous Article in Special Issue
Effects of Different Attractants on Growth, Antioxidant Capacity, and Feeding Gene Expression of Procambarus clarkii
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Fishes
Volume 11
Issue 6
10.3390/fishes11060317
fishes-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Narirutin Mitigates Dextran Sodium Sulfate-Induced Enteritis in Procambarus clarkii by Modulating Intestinal Microbiota

by
Jian Li
1,
Yitian Chen
1,
Yanping Cai
1,
Huiling Zhang
1,
Bin Qiu
1,
Xingfei Huang
1,
Yan Wen
2,
Aimin Wang
3,
Bin He
4,
Yude Wang
1,* and
Shaojun Liu
1,*
1
Engineering Research Center of Polyploid Fish Reproduction and Breeding of the State Education Ministry, Hunan Normal University, Changsha 410081, China
2
Hunan Yuzhe Agricultural Farmers’ Professional Cooperative, Changsha 410081, China
3
College of Marine and Biology Engineering, Yancheng Institute of Technology, Yancheng 224051, China
4
Hunan Fisheries Research Institute and Aquatic Products Seed Stock Station, Changsha 410153, China
*
Authors to whom correspondence should be addressed.
Fishes 2026, 11(6), 317; https://doi.org/10.3390/fishes11060317
Submission received: 14 April 2026 / Revised: 17 May 2026 / Accepted: 23 May 2026 / Published: 26 May 2026
(This article belongs to the Special Issue Recent Advances in Crayfish)
Browse Figures
Versions Notes

Abstract

Enteritis is a disease that affects Procambarus clarkii, significantly impacting aquaculture due to its high incidence and mortality rates, resulting in economic losses. Currently, the molecular mechanisms behind enteritis in Procambarus clarkii are not well understood. In this study, we established a model of intestinal inflammation induced by dextran sodium sulfate (DSS). Subsequently, histopathological changes, transcriptome analysis, intestinal microbiota analysis and immunofluorescence analysis were conducted. Histopathology showed that after treatment in the DSS + Narirutin (NR) group, there was an improvement in intestinal inflammation, and the structure of the intestinal tissue was partially restored. The intestinal transcriptome analysis revealed that in the DSS + NR group, 234 genes were upregulated and 188 genes were downregulated after treatment. This indicates a significant change in gene expression. KEGG enrichment analysis revealed that the DEGs were significantly enriched in TGF-β signaling pathway and PI3K-Akt signaling pathway. The results from 16S rRNA sequencing showed that in the DSS + NR group, the relative abundance of Akkermansia muciniphila significantly increased. Immunofluorescence results showed that, compared to the control group, the expressions of Occludin, nuclear factor-kB-p65 (NfkB-p65), Zonula occludens-1 (ZO-1), and Claudin-1 decreased following DSS treatment. However, treatment with NR was able to inhibit these changes. This further validated that NR can alleviate enteritis in Procambarus clarkii.
Keywords:
Procambarus clarkii; narirutin; gut microbiota; transcriptome; immunofluorescence
Key Contribution: Currently, the molecular mechanisms behind enteritis in Procambarus clarkii are not well understood. In this study, we examined the effect of NR on dextran sodium sulfate (DSS) -induced enteritis in Procambarus clarkii, with particular focus on the role of gut microbiota.

1. Introduction

Procambarus clarkii is native to the United States and Mexico. In the 1930s, Procambarus clarkii was introduced to China and quickly became one of the more important economic aquatic organisms in the country [1]. According to the “China Crayfish Industry Development Report (2025)”, the total Procambarus clarkii breeding area reached 20,333 square kilometers, with an annual output of 3.4476 million tons [2], increasing by 3.39% and 9.07%, respectively, since 2023. However, the frequent occurrence of diseases, such as intestinal diseases, has brought incalculable economic losses to the shrimp farming industry. Enteritis is one of the leading causes of large-scale death in Procambarus clarkii [3]. It can lead to a weakened immune system, making it easier for bacteria and viruses to invade. Enteritis in shrimp may be caused by bacterial infection leading to an imbalance of the gut microbiota. Studies have shown that various pathogenic bacteria were found in the intestines of shrimp with enteritis, including Escherichia coli and Aeromonas hydrophila, etc. [4,5,6]. At present, the mechanism that causes enteritis in Procambarus clarkii is still unclear, which also brings difficulties for the breeding of new disease-resistant varieties.
Dextran sodium sulfate (DSS) has been widely used to induce intestinal inflammation; it is toxic to gut epithelial cells and disrupts the integrity of the mucosal barrier [7,8]. DSS is used to establish intestinal inflammation models in mammals [9]. Meanwhile, in fish species, the use of DSS to induce intestinal inflammation models in zebrafish, Japanese Medaka, and orange-spotted grouper has also been reported [10,11,12]. Currently, there are no reports on using DSS to induce enteritis in crustaceans.
Narirutin (NR) is a flavonoid glycoside commonly found in fruits like grapes [13]. It is often used to treat enteritis [14,15]. It has antioxidant and anti-inflammatory properties, which have been verified in numerous studies [16,17]. It alleviates certain conditions, such as hypertension [18]. Research indicates that it can inhibit the activation of NLRP3 inflammasomes in macrophages and alleviate inflammatory responses. This effect has been confirmed in mice with colitis induced by DSS [19]. Studies have shown that NR inhibits DSS-induced enteritis and maintains the integrity of the DSS-induced intestinal barrier by inhibiting the decrease of claudin3 and occludin. The intestinal flora of mice with enteritis showed more microbial diversity. The abundance of Lactobacillus increased, while the abundance of Bacteroides decreased. NR reduced the process of colitis by maintaining the integrity of intestinal barrier [20].
Currently, there is limited knowledge about the gene expression involved in the immune response to enteritis. In this study, we conducted a combined analysis of the intestinal transcriptome and microbial community to identify the molecular mechanisms associated with enteritis. We further investigated the therapeutic effect of NR on DSS treatment through histopathological and immunofluorescence techniques. Our findings provide a reference for the treatment of enteritis in Procambarus clarkii.

2. Materials and Methods

2.1. Animals and Chemicals

Procambarus clarkii were obtained from the cooperative breeding farm of Hunan Normal University. We divided 90 Procambarus clarkii randomly into three groups (30 Procambarus clarkii in each group): the control group, the DSS group, and the DSS + NR group. The P. clarkii were placed in plastic boxes (size: 120 cm × 60 cm × 40 cm) under experiment conditions (dissolved oxygen at 7.1 mg/L, pH 7.5 ± 0.3, ammonia nitrogen < 0.2 mg/L, and temperature at 24 ± 2 °C), each containing 60 L of water to soak the P. clarkii. All the P. clarkii were fed commercially prepared crayfish pellets in the morning and evening. After 14 days of acclimatization, a formal experiment was conducted. Every night, we cleaned the residual feed. Status of the animals was checked every two hours, and any dead individuals were counted and immediately removed. The exposure solution was manually renewed once a day.
By referencing previous cases of intestinal inflammation caused by DSS in aquatic organisms, such as the orange-spotted grouper and grass carp, a 3% DSS dose was determined to be the most appropriate to cause inflammation [18,21]. We conducted a preliminary test with DSS concentrations of 1% to 5%. Eventually, 2.5% was selected as the appropriate concentration, which could cause enteritis without causing death. The Procambarus clarkii in the DSS group were placed in water containing 2.5% (w/v) DSS for 7 days to induce enteritis. Subsequently, the DSS + NR group placed the Procambarus clarkii from the DSS group into water with NR dissolved at a concentration of 30 mg/L, and then continued the observation for a period of 7 days. At the end of each stage, the intestinal contents and intestinal tissues of the three Procambarus clarkii were randomly aseptically collected for subsequent experiments. Narirutin (NR, CAS:14259-46-2, LOT: AZDG1958, purity ≥ 95%) was purchased from Chengdu Alfa Biotechnology Co., LTD. (Chengdu, China). Dextran sodium sulfate (DSS, purity ≥ 99%) was obtained from Shanghai Aichun Biotechnology Co., LTD. (Shanghai, China).

2.2. Histological Observation

Fresh intestinal tissues were fixed in 4% paraformaldehyde solution for more than 24 h. These steps involved dehydration in a series of different alcohol concentrations, embedding, cutting the wax blocks into sections of 5 μm thickness, staining with hematoxylin and eosin (H&E), and then observing the sections under a microscope (Leica company from Germany). The Image-Pro Plus 6.0 software measured the thickness of the epithelium and the folds in the intestinal sections at five different locations.

2.3. 16S rRNA Sequencing of Intestinal Contents

Genomic DNA Extraction Kit (Tiangen Biotech, Beijing, China) was used to extract DNA from the intestinal contents of Procambarus clarkii for analysis. For amplification of the V3–V4 region of the 16S rRNA gene in bacteria, PCR amplification products were processed by cutting, recovering, and quantifying them using a QuantiFluorTM fluorometer (Promega Corporation, Madison, WI, USA). The purified amplification products were then ligated with sequencing linkers to construct libraries, which were sequenced using the Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA). The quality control was carried out using the DADA2 software (v1.41.0), and data were filtered based on overlaps, resulting in ASVs. Taxonomic classification of ASVs was carried out with the Naive Bayes consensus taxonomy classifier implemented in Qiime2, using the SILVA 16S rRNA database (v138) as the reference. Subsequently, the differences in the bacterial communities were analyzed. Linear discriminant analysis (LDA) was combined with effect size measurement (LEfSe) to assess the differences in microbiota between the two groups. Data processing and bioinformatics analysis were carried out using the Illumina HiSeq 2500 platform (Guangzhou Genedenovo Biotechnology Co., Ltd., Guangzhou, China).

2.4. RNA Sequencing Analysis and CFU Count

Total RNA was extracted from the intestines of Procambarus clarkii using Trizol reagent. We enriched the mRNA and then reverse transcribed it to generate cDNA. RNA purity and integrity were assessed using a NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA) and an Agilent 2100 Bioanalyzer (Agilent, Santa Clara, CA, USA). The cDNA library was established, and high-throughput sequencing was performed on the Illumina HiSeq platform. We filtered out low-quality reads and compared it to the reference genome (assembly version: GCF_020424385.1) using Hisat2 (version 2.1.0). Principal Component Analysis (PCA) was conducted using R (http://www.r-project.org/ (accessed on 10 June 2025)). The input data for gene differential expression analysis consisted of the read count data obtained from the gene expression level analysis, which was analyzed using DESeq2 software (v1.20.0). Additionally, the differential genes were analyzed using the DESeq2. The criteria for screening differentially expressed genes (DEGs) were set at a log2FoldChange > 1 and a p-value < 0.05. Functional enrichment analysis of the DEGs was carried out using the Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases.
Three Procambarus clarkii from the control group, DSS group, and DSS + NR group were counted for CFU of intestinal contents, and 1 mL of the original sample was removed and added to a test tube with 9 mL of sterile water. After mixing, 1 ml was removed and added to the next test tube with 9 ml of sterile water, and so on, which were marked as 10−1, 10−2, 10−3, 10−4, 10−5, and 10−6, in turn. Then, 0.1 mL of bacterial liquid was removed from each selected dilution test tube with a pipette, added to the center of the marked sterile plate, respectively, and smeared evenly with a sterile coating rod. The coated plate was placed into a constant temperature incubator for 18 h, then the plate was removed for counting. The calculation formula is: CFU/mL = number of colonies × dilution factor/volume of sample added (mL).

2.5. Immunofluorescence (IF)

The sections were fixed with 4% paraformaldehyde solution, and then the antigens were restored through a water bath. The sections were incubated in a 3% hydrogen peroxide solution for 15 min. Then, the primary antibody was incubated at an appropriate dilution (ZO-1 (AFRP0020, 1:100), Claudin 1 (AFRM0046, 1:300), Occludin (AFRP0025, 1:100), NFKB-P65 (AFRM0286, 1: 100)). The samples were washed with PBST, and Polymer-HRP anti-mouse/rabbit universal secondary antibody IgG was added. After incubation for 30 min, we washed with PBST. The slides were imaged using Leica Aperio VERSA 200 (Leica Biosystems, Nussloch, Germany). For each slice, at least three non-overlapping fields of view were randomly selected for collection, and then the positive cell rate was measured using the ImageJ software (v1.8.0).

2.6. Western Blot Analysis

RIPA cracking solution with various protease inhibitors was used, which was cracked on ice for 30 min and shaken for 5 min to ensure complete cracking. BCA protein detection kit was used to measure protein concentration. SDS-PAGE electrophoresis and transfer to PVDF membrane (0.45 μm) were performed. The solution was sealed with 5% skim milk for 30 min at room temperature, and sat overnight at 4 °C with various diluted primary antibodies: Occludin (AFRP0025, 1:100), Claudin 1 (AFRM0046, 1:300), NFKB-P65 (AFRM0286, 1:100), and α-tubulin (Servicebio, Wuhan, China, GB15003, 1:5000). We then treated the membrane with secondary antibody (HRP- goat anti-rabbit (Servicebio, GB2330, 1:3000)) for 1 h at room temperature. Finally, the results were imaged by Bio-Rad imaging system.

2.7. Quantitative RT-PCR Assay

The samples used for RNA sequencing were reverse transcribed into cDNA. Primers were designed using Primer Premier 5.0 software and synthesized by Beijing Qingke Biotechnology Co., Ltd. (Beijing, China). The total 20 μL reaction mixture contained: 1 μL cDNA, 10 μL 2× SybrGreen qPCR Master Mix, 0.4 μL of each forward and reverse primer, and 8.2 μL of ddH2O. The qPCR program was set as follows: 95 °C for 30 s, 40 cycles, each cycle 5 s at 95 °C, 30 s at 60 °C, and 30 s at 72 °C. All the primers used are listed in Table 1. The relative expression levels were validated using the 2−ΔΔCt method.

2.8. Statistical Analysis

The experimental data was performed using SPSS 20.0 software. Data are presented as mean ± SD. The relative expression of the genes was determined by using one-way ANOVA. This was followed by Tukey’s test for post hoc analysis; p value < 0.05 was considered statistically significant.

3. Results

3.1. Histological Observation

Significant pathological changes were observed when comparing the control group to both the DSS group and the DSS + NR group. In the control group, the intestinal tissue exhibited a well-organized structure, with closely connected epithelial cells and significant intestinal folds. In contrast, the DSS group displayed an expanded intestinal lumen, loosely arranged epithelial cells, and a marked reduction in intestinal folds. After treatment in the DSS + NR group, there was an improvement in intestinal inflammation, and the structure of the intestinal tissue was partially restored (Figure 1). The thickness of the intestinal epithelium did not change significantly, but the intestinal fold height was significantly lower compared to the control group, and in the DSS + NR group, the intestinal fold height was partially restored (Figure 2).

3.2. Transcriptome Analysis

To investigate the mechanism by which NR treatment affects enteritis induced by DSS, we performed RNA-seq analysis on the intestines from both the DSS group and the DSS + NR group. PCA revealed distinct transcriptional differences between the two groups (Figure 3A). Heatmap and volcano plot analyses showed that treatment in the DSS + NR group resulted in significant changes in gene expression compared to the DSS group, with 234 up-regulated and 188 down-regulated genes (Figure 3B,C). GO enrichment analysis revealed that DEGs primarily involved catalytic activity, the extracellular region, and transferase activity (Figure 3D). Additionally, KEGG enrichment analysis showed that DEGs were mainly associated with metabolic pathways, Salmonella infection, the TGF-β signaling pathway, and the PI3K-Akt signaling pathway (Figure 3E). GSEA further emphasized the significant role of DSS + NR treatment in regulating the relevant signaling pathways (Figure 3F,G).

3.3. Gut Microbial Analysis

An analysis was conducted on the DSS group and the DSS + NR group through 16S rRNA sequencing. The microbial composition at the genus and family levels is presented in the bar chart and heat map (Figure 4A,F). At the genus level (Figure 4B), the core genera in the NR group were Acinetobacter (26.72%), Cronobacter (13.57%), Kluyvera (6.86%), and Raoultella (2.40%). Compared with the NR group, the DSS group showed significant changes in the abundance of several genera. The core genera of DSS group were Acinetobacter (59.83%), Cronobacter (2.11%), Kluyvera (0.99%), and Raoultella (5.36%). Compared with the DSS group, at the species level (Figure 4C), the relative abundance of Akkermansia muciniphila in the treatment group significantly increased. At the phylum level (Figure 4D,E), the relative abundance of Bacillota increased while that of Pseudomonadota decreased. To identify the bacteria affected by the administration of NR, a comparative analysis using linear discriminant analysis (LDA) of effect size (LEfSe) was performed, which revealed significant changes in the gut microbiota (Figure 4G,J). Principal component analysis (PCoA and NMDS) indicated differences in the components of the gut microbiota between the DSS + NR group and the DSS group (Figure 4H,I). There are differences between DSS group and control group and DSS + NR group by CFU counting (Figure 5F). Therefore, NR can alter the composition of gut microbiota, which may have a positive impact on improving intestinal function.

3.4. Immunofluorescence Assay

To investigate the mechanism by which NR alleviates enteritis, we evaluated its effect on intestinal barrier function. Immunofluorescence staining results indicated that, compared to the control group, the DSS group experienced a significant reduction in the expression of occludin, nfkb-p65, zo-1, and claudin-1 in the intestinal tissue of Procambarus clarkii. However, the DSS + NR group significantly mitigated the down-regulation of these proteins observed in the DSS group (Figure 6). Similarly, the statistical analysis of the positive cell rate also confirmed this result (Figure 5A,D). The transcriptome data showed that the expression levels of Occludin, Nfkb-P65, ZO-1, and Claudin-1 also increased after the addition of NR (Figure 5E). Western blot analysis demonstrated that NR upregulated the protein levels of Occludin, Nfkb-P65, and Claudin-1 (Figure 5G).

3.5. Verification of qRT-PCR Results for Transcriptome Data

Eight DEGs from the transcriptome data were randomly selected for qRT-PCR analysis (Figure 7). The results confirmed the accuracy of the RNA-seq data.

4. Discussion

In this study, through histological observation, we determined that the intestine in the control group had a good organizational structure, including closely connected epithelial cells and intestinal folds. However, in the DSS group, the intestinal lumen expanded, the epithelial cells arranged loosely, and the intestinal folds decreased. After treatment in DSS + NR group, intestinal inflammation was improved and the structural part of intestinal tissue was restored. After measurement, we found that the thickness of intestinal epithelium did not change significantly, but compared with the control group, the height of intestinal folds in DSS group decreased significantly, and in the DSS + NR group, the height of intestinal folds partially recovered.
It is important to note that disturbances in the intestinal microbiota play a crucial role in the pathological mechanisms of enteritis. Ulcerative colitis is primarily caused by an imbalance in the intestinal microbiota, leading to the influx of harmful bacteria into the intestine [22,23,24]. Therefore, it is essential to identify suitable drugs to regulate the gut microbiota for treating enteritis. Studies have shown that Ganoderma lucidum polysaccharides can alleviate DSS-induced colitis in rats [25]. Additionally, L. reuteri-cytoplasmic membrane vesicles (CMVs) have been found to restore the gut microbiota, regulate the immune response, and alleviate DSS-induced colitis in mice [26]. Furthermore, strawberries have improved the gut microbiota in mice and reduced DSS-induced colonic inflammation [27]. Thus, enhancing the gut microbiota presents an effective strategy for treating enteritis. Agaricus bisporus polysaccharides (ABPs) have a certain effect on crayfish enteritis induced by Aeromonas salmonicida [3]. Fraxetin can alleviate intestinal inflammation in grass carp induced by DSS and enhance the intestinal immunity of the fish [28]. Enzymatic cottonseed protein (ECP) can alleviate the intestinal inflammation in yellow catfish induced by DSS [29]. In aquaculture, high mortality rates from enteritis in Procambarus clarkii present a major challenge for farmers. Finding effective treatments for enteritis in this species has become a pressing concern in our farming practices. This study examined the changes in the diversity of gut microbiota after NR treatment through 16S rRNA sequencing. The results of PCoA and NMDS analysis indicated that after DSS treatment and the addition of NR, significant changes occurred in the microbiota structure. This suggests that NR changed the composition of the gut microbial community.
To better understand the primary bacteria affected by NR treatment, we analyzed the gut microbiota. Compared with the DSS group, at the species level, the relative abundance of Akkermansia muciniphila in the treatment group significantly increased. At the phylum level, the relative abundance of Bacillota increased while that of Pseudomonadota decreased. Research indicates that an excess of Pseudomonadota is indicative of disrupted gut microbiota and is commonly found in patients with colitis [30,31]. Some species of Proteobacteria have been proven to be pathogenic [32]. This study showed that Pseudomonadota decreased after NR treatment. Numerous studies have highlighted that Akkermansia is a symbiotic bacterium that enhances the integrity of the intestinal barrier [33,34]. It has been used to treat conditions such as enteritis in patients with intestinal disorders [35,36,37] and is currently a hot topic in research, being poised to become the next generation probiotics [38,39]. Akkermansia can positively influence the gut microbiota environment, enhancing its nutritional status [40]. Inflammatory enteritis is characterized by dysregulation of the gut microbiota [41], and Akkermansia has the potential to restore this balance and reduce inflammation [42]. Additionally, A. muciniphila can stimulate mucin production, strengthen the mucus barrier, and maintain the integrity of the gut microbiota, thereby having notable effects on health and disease [43,44]. Compared with the NR group, the DSS group showed significant changes in the abundance of several genera. At the genus level, these included Acinetobacter, Cronobacter, Kluyvera, and Raoultella. Therefore, NR can increase the proportion of Akkermansia, improve intestinal function, and may have a positive effect on enteritis caused by the intestinal microbial imbalance resulting from DDS.
In this study, we found that Akkermansia levels were significantly elevated after treatment with NR, which helped alleviate DSS-induced enteritis, regulate the gut microbiota, and promote overall intestinal health. Probiotic-derived extracellular vesicles (EVs) are effective in preventing intestinal inflammation and maintaining the integrity of the intestinal barrier. For instance, exosomes from the probiotic Escherichia coli enhance the levels of tight junction proteins by activating the NOD1 signaling pathway, thus promoting intestinal homeostasis [45]. Similarly, exosomes derived from Akkermansia can upregulate the expression of tight junction proteins such as Ocln and ZO-1, contributing to the reduction of inflammation in colitis in mice [46]. At present, immunofluorescence detection has been carried out on crustaceans [47,48]. In our research, we observed that NR treatment increased levels of proteins, including Occludin, Nfkb-p65, ZO-1, and Claudin-1, in Procambarus clarkii suffering from enteritis. Similarly, the statistical analysis of the positive cell rate also confirmed that NR can effectively restore the expression of these proteins. Furthermore, NR treatment reduced intestinal permeability and maintained the integrity of the intestinal barrier in these crustaceans.
Research has shown that the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (AKT) signaling pathway plays a crucial role in regulating and releasing inflammatory cytokines that contribute to ulcerative colitis (UC) [49]. The activated PI3K-Akt signaling pathway can cause intestinal inflammation and is involved in various cellular functions [50,51]. During periods of inflammation, macrophages can interact with Toll-like receptor 4 (TLR4), which stimulates this pathway to produce inflammatory cytokines [52]. Transforming growth factor-beta (TGF-β) regulates a wide range of innate and adaptive immune functions. Tacrolimus can activate the TGF-β signaling pathway, providing a protective effect against dextran sulfate sodium (DSS)-induced colitis [53]. Additionally, pregnancy-specific beta-1-glycoprotein 1 (PSG1) activates TGF-β and protects mice from DSS-induced enteritis [54]. Ginsenoside Rh2 (GRh2) has also been shown to enhance TGF-β signaling, alleviating DSS-induced enteritis in mice [55]. In this study, after treatment in the DSS + NR group, significant changes occurred in gene expression, with 234 and 188 genes showing upregulation and downregulation. The KEGG enrichment analysis indicates that the potential role of NR in improving intestinal inflammation is achieved through the TGF-β signaling pathway (DEG include SDK1, RHOBTB1, and emc, etc.) and the PI3K-Akt signaling pathway (DEG include sgk1-a, ANGPT1, G6pc2, and FGL2, etc.). These two pathways jointly contribute to alleviating the intestinal inflammation symptoms in the Procambarus clarkii.
In conclusion, NR treatment may alleviate enteritis in Procambarus clarkii induced by DSS. It primarily regulated the enteritis caused by disorders in the gut microbiota, inhibited inflammatory responses, and helped maintain the integrity of the intestinal barrier. This study provides new insights into the mechanisms by which NR treats enteritis in Procambarus clarkii.

5. Conclusions

In this study, intestinal inflammation in Procambarus clarkii was induced by using DSS. The results showed that NR might have a relieving effect on the inflammation. The imbalance of the intestinal microbial community was improved. NR promoted the improvement of intestinal inflammation by regulating the intestinal microbiota, thereby alleviating the condition of Procambarus clarkii.

Author Contributions

J.L.: Writing-review & editing, Project administration, Resources, Supervision; Y.C. (Yitian Chen): Writing-review & editing, Resources; Y.C. (Yanping Cai): Software, Methodology; H.Z.: Methodology, Investigation; B.Q.: Data curation, Resources; X.H.: Investigation, Methodology; Y.W. (Yan Wen): Methodology, Resources; A.W.: Software, Methodology; B.H.: Software, Methodology: Y.W. (Yude Wang): Conceptualization, Writing-review & editing, Supervision, Project administration, & Funding acquisition. S.L.: Conceptualization, Supervision. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported Yuelushan Laboratory Breeding Program (Grant No. YLS-2025-ZY02044) and the National Key R&D Program of China (2022YFD2400701, 2023YFD2401803) and the National Advantageous and Characteristic Industrial Cluster Project of Dongting Lake Crayfish.

Institutional Review Board Statement

This study was conducted in accordance with the “Ethical Statement” and was approved by the Biomedical Research Ethics Committee of Hunan Normal University (Approval Number: 2024-143; Approval Date: 13 June 2024).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data from the study are available from the corresponding authors upon reasonable request.

Acknowledgments

We would like to sincerely appreciate many researchers who help to complete this manuscript.

Conflicts of Interest

The author declares that there are no potential conflicts of interest.

References

  1. Wang, Y.; Hong, D.; Yao, J.; Tan, H.; Wang, S.; Li, J.; Luo, Y.; Wang, D.; Liu, S. Comparative transcriptome preliminary reveals the molecular mechanism of the growth rate of Procambarus clarkii. Reprod. Breed. 2021, 1, 204–209. [Google Scholar] [CrossRef]
  2. Fisheries Department of Ministry of Agriculture. China Fishery Statical Yearbook: 2025; China Agriculture Press: Beijing, China, 2025. [Google Scholar]
  3. Zhu, X.; Wang, L.; He, H.; Yang, Z.; Liu, Y.; Ai, X.; Yao, J.; Yang, Y. RNA-Seq and 16S rRNA Analysis Revealed the Effects of Agaricus bisporus Polysaccharides on Aeromonas salmonicida-Induced Enteritis in Crayfish. Fish. Shellfish Immunol. 2025, 168, 110968. [Google Scholar] [CrossRef]
  4. Silvester, R.; Alexander, D.; Ammanamveetil, M.H.A. Prevalence, antibiotic resistance, virulence and plasmid profiles of Vibrio parahaemolyticus from a tropical estuary and adjoining traditional prawn farm along the southwest coast of India. Ann. Microbiol. 2015, 65, 2141–2149. [Google Scholar] [CrossRef]
  5. Battison, A.L.; Després, B.M.; Greenwood, S.J. Ulcerative enteritis in Homarus americanus: Case report and molecular characterization of intestinal aerobic bacteria of apparently healthy lobsters in live storage. J. Invertebr. Pathol. 2008, 99, 129–135. [Google Scholar] [CrossRef] [PubMed]
  6. Yaashikaa, P.R.; Saravanan, A.; Kumar, P.S. Isolation and identification of Vibrio cholerae and Vibrio parahaemolyticus from prawn (Penaeus monodon) seafood: Preservation strategies. Microb. Pathog. 2016, 99, 5–13. [Google Scholar] [CrossRef] [PubMed]
  7. Zuo, T.; Ng, S.C. The Gut Microbiota in the Pathogenesis and Therapeutics of Inflammatory Bowel Disease. Front. Microbiol. 2018, 9, 2247. [Google Scholar] [CrossRef]
  8. Wlodarska, M.; Kostic, A.D.; Xavier, R.J. An Integrative View of Microbiome-Host Interactions in Inflammatory Bowel Diseases. Cell Host Microbe 2015, 17, 577–591. [Google Scholar] [CrossRef]
  9. Chassaing, B.; Aitken, J.D.; Malleshappa, M.; Vijay-Kumar, M. Dextran sulfate sodium (DSS)-induced colitis in mice. Curr. Protoc. Immunol. 2014, 104, 15.25.11–15.25.14. [Google Scholar] [CrossRef]
  10. Martin, J.C.; Bériou, G.; Josien, R. Dextran Sulfate Sodium (DSS)-Induced Acute Colitis in the Rat. In Methods in Molecular Biology; Springer: New York, NY, USA, 2016; pp. 197–203. [Google Scholar]
  11. Takahashi, Y.; Okamura, Y.; Harada, N.; Watanabe, M.; Miyanishi, H.; Kono, T.; Sakai, M.; Hikima, J.i. Interleukin-22 Deficiency Contributes to Dextran Sulfate Sodium-Induced Inflammation in Japanese Medaka, Oryzias latipes. Front. Immunol. 2021, 12, 688036. [Google Scholar] [CrossRef]
  12. Zhang, Y.; Wang, Y.; Shi, J.; Wang, H.; Xu, S.; Ge, Q.; Zhang, H. In vitro activity, structural characterization and modulation of DSS-induced intestinal inflammation in zebrafish by Pseudognaphalium affine (D.Don) Anderb polysaccharides. Fitoterapia 2025, 184, 106658. [Google Scholar] [CrossRef]
  13. Moser, S.E.; Shin, J.E.; Kasturi, P.; Hamaker, B.R.; Ferruzzi, M.G.; Bordenave, N. Formulation of orange juice with dietary fibers enhances bioaccessibility of orange flavonoids in juice but limits their ability to inhibit in vitro glucose transport. J. Agric. Food Chem. 2020, 68, 9387–9397. [Google Scholar] [CrossRef]
  14. Singh, S.; Maurya, A.K.; Meena, A.; Mishra, N.; Luqman, S. Narirutin. A flavonoid found in citrus fruits modulates cell cycle phases and inhibits the proliferation of hormone-refractory prostate cancer cells by targeting hyaluronidase. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2023, 174, 113638. [Google Scholar] [CrossRef]
  15. Yu, J.; Deng, K.; Peng, T.; Zhu, B.; Liu, H. Simultaneous determination of six ingredients in Huoxiang Zhengqi oral liquid by UPLC. Zhongguo Zhong Yao Za Zhi Zhongguo Zhongyao Zazhi China J. Chin. Mater. Medica 2013, 38, 2314–2317. [Google Scholar]
  16. Mitra, S.; Lami, M.S.; Uddin, T.M.; Das, R.; Islam, F.; Anjum, J.; Hossain, J.; Emran, T.B. Prospective multifunctional roles and pharmacological potential of dietary flavonoid narirutin. Biomed. Pharmacother. 2022, 150, 112932. [Google Scholar] [CrossRef] [PubMed]
  17. Park, K.; Makki, H.M.M.; Kim, S.; Chung, H.; Jung, J. Narirutin ameliorates alcohol-induced liver injury by targeting MAPK14 in zebrafish larvae. Biomed. Pharmacother. 2023, 166, 115350. [Google Scholar] [CrossRef] [PubMed]
  18. Xu, D.; Liu, D.; Jiang, N.; Xie, Y.; He, D.; Cheng, J.; Liu, J.; Fu, S.; Hu, G. Narirutin mitigates dextrose sodium sulfate-induced colitis in mice by modulating intestinal flora. Phytomedicine 2024, 130, 155730. [Google Scholar] [CrossRef]
  19. Ri, M.H.; Li, M.Y.; Xing, Y.; Zuo, H.X.; Li, G.; Li, C.; Ma, J.; Jin, X. Narirutin exerts anti-inflammatory activity by inhibiting NLRP3 inflammasome activation in macrophages. Phytother. Res. 2023, 37, 1293–1308. [Google Scholar] [CrossRef]
  20. Yu, D.; Yang, G.; Xia, H.; Gan, Z.; Wang, Z.; Xia, L.; Kwok, K.; Cai, J.; Lu, Y. Dextran Sulfate Sodium Salt (DSS) induced enteritis in Orange-spotted grouper, Epinephelus coioides. Fish. Shellfish Immunol. 2023, 137, 108742. [Google Scholar] [CrossRef] [PubMed]
  21. Chen, Z.; Feng, L.; Wu, P.; Jiang, W.; Jiang, J.; Zhou, X.; Liu, Y. From growth promotion to intestinal inflammation alleviation: Unraveling the potential role of Lactobacillus rhamnosus GCC-3 in juvenile grass carp (Ctenopharyngodon idella). Fish Shellfish. Immunol. 2024, 148, 109511. [Google Scholar] [CrossRef]
  22. Lu, Q.; Yang, M.F.; Liang, Y.J.; Xu, J.; Xu, H.M.; Nie, Y.Q.; Wang, L.S.; Yao, J.; Li, D.F. Immunology of Inflammatory Bowel Disease: Molecular Mechanisms and Therapeutics. J. Inflamm. Res. 2022, 15, 1825–1844. [Google Scholar] [CrossRef]
  23. Tian, C.M.; Yang, M.F.; Xu, H.M.; Zhu, M.Z.; Zhang, Y.; Yao, J.; Wang, L.S.; Liang, Y.J.; Li, D.F. Emerging role of bacterial outer membrane vesicle in gastrointestinal tract. Gut Pathog. 2023, 15, 20. [Google Scholar] [CrossRef] [PubMed]
  24. Halfvarson, J.; Brislawn, C.J.; Lamendella, R.; Vázquez-Baeza, Y.; Walters, W.A.; Bramer, L.M.; D’amato, M.; Bonfiglio, F.; McDonald, D.; Gonzalez, A.; et al. Dynamics of the human gut microbiome in inflammatory bowel disease. Nat. Microbiol. 2017, 2, 17004. [Google Scholar] [CrossRef]
  25. Xie, J.; Liu, Y.; Chen, B.; Zhang, G.; Ou, S.; Luo, J.; Peng, X. Ganoderma lucidum polysaccharide improves rat DSS-induced colitis by altering cecal microbiota and gene expression of colonic epithelial cells. Food Nutr. Res. 2019, 63, 10-29219. [Google Scholar] [CrossRef] [PubMed]
  26. Yue, N.; Zhao, H.; Hu, P.; Zhang, Y.; Tian, C.; Kong, C.; Mai, Z.; Huang, L.; Luo, Q.; Wei, D.; et al. Real-world of Limosilactobacillus reuteri in mitigation of acute experimental colitis. J. Nanobiotechnol. 2025, 23, 65. [Google Scholar] [CrossRef] [PubMed]
  27. Han, Y.; Song, M.; Gu, M.; Ren, D.; Zhu, X.; Cao, X.; Li, F.; Wang, W.; Cai, X.; Yuan, B.; et al. Dietary Intake of Whole Strawberry Inhibited Colonic Inflammation in Dextran-Sulfate-Sodium-Treated Mice via Restoring Immune Homeostasis and Alleviating Gut Microbiota Dysbiosis. J. Agric. Food Chem. 2019, 67, 9168–9177. [Google Scholar] [CrossRef]
  28. Zhang, J.; Jiang, W.D.; Wu, P.; Liu, Y.; Ma, Y.B.; Shi, H.Q.; Zhou, X.Q.; Feng, L. Dietary fraxetin modulates the gut-immune axis to alleviate DSS-induced enteritis in grass carp (Ctenopharyngodon idella). Aquaculture 2026, 613, 743403. [Google Scholar] [CrossRef]
  29. Zhang, G.; Zhou, X.; Jiang, W.; Wu, P.; Liu, Y.; Ma, Y.; Ren, H.; Jin, X.; Xiao, W.; Li, Y.; et al. Enzymatic cottonseed protein alleviates DSS-induced enteritis in juvenile yellow catfish (Pelteobagrus fulvidraco): Focus on macrophage polarization and necroptosis in the intestine. J. Anim. Sci. Biotechnol. 2025, 16, 119. [Google Scholar] [CrossRef]
  30. Shin, N.-R.; Whon, T.W.; Bae, J.-W. Proteobacteria: Microbial signature of dysbiosis in gut microbiota. Trends Biotechnol. 2015, 33, 496–503. [Google Scholar] [CrossRef]
  31. Katsuyoshi, M.; Takanori, K. The gut microbiota and inflammatory bowel disease. Semin. Immunopathol. 2015, 37, 47–55. [Google Scholar]
  32. Ohkusa, T.; Koido, S. Intestinal microbiota and ulcerative colitis. J. Infect. Chemother. 2015, 21, 761–768. [Google Scholar] [CrossRef]
  33. Cani, P.D.; Depommier, C.; Derrien, M.; Everard, A.; de Vos, W.M. Akkermansia muciniphila: Paradigm for next-generation beneficial microorganisms. Nat. Rev. Gastroenterol. Hepatol. 2022, 19, 625–637. [Google Scholar] [CrossRef] [PubMed]
  34. Kim, S.; Shin, Y.-C.; Kim, T.-Y.; Kim, Y.; Lee, Y.-S.; Lee, S.-H.; Kim, M.-N.; O, E.; Kim, K.S.; Kweon, M.-N. Mucin degrader Akkermansia muciniphila accelerates intestinal stem cell-mediated epithelial development. Gut Microbes 2021, 13, 1892441. [Google Scholar] [CrossRef] [PubMed]
  35. Cani, P.D.; de Vos, W.M. Next-Generation Beneficial Microbes: The Case of Akkermansia muciniphila. Front. Microbiol. 2017, 8, 1765. [Google Scholar] [CrossRef]
  36. Belzer, C.; de Vos, W.M. Microbes inside--from diversity to function: The case of Akkermansia. ISME J. 2012, 6, 1449–1458. [Google Scholar] [CrossRef]
  37. Shang, Q.; Song, G.; Zhang, M.; Shi, J.; Xu, C.; Hao, J.; Li, G.; Yu, G. Dietary fucoidan improves metabolic syndrome in association with increased Akkermansia population in the gut microbiota of high-fat diet-fed mice. J. Funct. Foods 2017, 28, 138–146. [Google Scholar] [CrossRef]
  38. Zhou, K. Strategies to promote abundance of Akkermansia muciniphila, an emerging probiotics in the gut, evidence from dietary intervention studies. J. Funct. Foods 2017, 33, 194–201. [Google Scholar] [CrossRef]
  39. Shang, Q.; Wang, Y.; Pan, L.; Niu, Q.; Li, C.; Jiang, H.; Cai, C.; Hao, J.; Li, G.; Yu, G. Dietary Polysaccharide from Enteromorpha Clathrata Modulates Gut Microbiota and Promotes the Growth of Akkermansia muciniphila, Bifidobacterium spp. and Lactobacillus spp. Mar. Drugs 2018, 16, 167. [Google Scholar] [CrossRef]
  40. Belzer, C.; Chia, L.W.; Aalvink, S.; Chamlagain, B.; Piironen, V.; Knol, J.; de Vos, W.M. Microbial Metabolic Networks at the Mucus Layer Lead to Diet-Independent Butyrate and Vitamin B12 Production by Intestinal Symbionts. mBio 2017, 8, e00770-17. [Google Scholar] [CrossRef]
  41. Santana, P.T.; Rosas, S.L.B.; Ribeiro, B.E.; Marinho, Y.; de Souza, H.S. Dysbiosis in Inflammatory Bowel Disease: Pathogenic Role and Potential Therapeutic Targets. Int. J. Mol. Sci. 2022, 23, 3464. [Google Scholar] [CrossRef]
  42. Cheng, D.; Xie, M.Z. A review of a potential and promising probiotic candidate—Akkermansia muciniphila. J. Appl. Microbiol. 2021, 130, 1813–1822. [Google Scholar] [CrossRef] [PubMed]
  43. Rodrigues, V.F.; Elias-Oliveira, J.; Pereira Í, S.; Pereira, J.A.; Barbosa, S.C.; Machado, M.S.G.; Carlos, D. Akkermansia muciniphila and Gut Immune System: A Good Friendship That Attenuates Inflammatory Bowel Disease, Obesity, and Diabetes. Front. Immunol. 2022, 13, 934695. [Google Scholar] [CrossRef]
  44. Shaheen, N.; Khursheed, W.; Gurung, B.; Wang, S. Akkermansia muciniphila: A key player in gut microbiota-based disease modulation. Microbiol. Res. 2025, 301, 128317. [Google Scholar] [CrossRef]
  45. Alvarez, C.-S.; Badia, J.; Bosch, M.; Giménez, R.; Baldomà, L. Outer Membrane Vesicles and Soluble Factors Released by Probiotic Escherichia coli Nissle 1917 and Commensal ECOR63 Enhance Barrier Function by Regulating Expression of Tight Junction Proteins in Intestinal Epithelial Cells. Front. Microbiol. 2016, 7, 1981. [Google Scholar] [CrossRef]
  46. Wang, X.; Lin, S.; Wang, L.; Cao, Z.; Zhang, M.; Zhang, Y.; Liu, R.; Liu, J. Versatility of bacterial outer membrane vesicles in regulating intestinal homeostasis. Sci. Adv. 2023, 9, eade5079. [Google Scholar] [CrossRef] [PubMed]
  47. Cho, S.; Schaefer, D.A.; Mai, H.N.; Riggs, M.W.; Dhar, A.K. Immunofluorescence detection of Ecytonucleospora hepatopenaei (EHP) in Penaeus vannamei. J. Microbiol. Methods 2024, 226, 107039. [Google Scholar] [CrossRef]
  48. Nanakorn, Z.; Kawai, T.; Söderhäll, I.; Söderhäll, K.; Tassanakajon, A. PmVago1 and PmVago4 from Penaeus monodon Act as Cytokine-like Mediators of Antiviral Immune Responses to White Spot Syndrome Virus in Penaeid Shrimp. Fish. Shellfish Immunol. 2025, 169, 111057. [Google Scholar] [CrossRef]
  49. Li, N.; Sun, W.; Zhou, X.; Gong, H.; Chen, Y.; Chen, D.; Xiang, F. Dihydroartemisinin Protects against Dextran Sulfate Sodium-Induced Colitis in Mice through Inhibiting the PI3K/AKT and NF-κB Signaling Pathways. BioMed Res. Int. 2019, 2019, 1415809. [Google Scholar] [CrossRef]
  50. Dong, L.; Du, H.; Zhang, M.; Xu, H.; Pu, X.; Chen, Q.; Luo, R.; Hu, Y.; Wang, Y.; Tu, H.; et al. Anti-inflammatory effect of Rhein on ulcerative colitis via inhibiting PI3K/Akt/mTOR signaling pathway and regulating gut microbiota. Phytother. Res. 2022, 36, 2081–2094. [Google Scholar] [CrossRef]
  51. Awad, M.M.; Gohary, R.M.E.; Ibrahim, S.; Ghafar, M.T.A.; Farghal, E.E.; Aboalsoud, A.; Shaer, R.A.A.E. Potential mitigating impact of a dipeptidyl peptidase-IV inhibitor, vildagliptin, on oxazolone-induced ulcerative colitis: Targeting the role of PI3K/AKT/mTOR and AMPK/Nrf2 signaling pathways. Int. Immunopharmacol. 2024, 133, 112110. [Google Scholar] [CrossRef] [PubMed]
  52. Wu, C.; Guo, L.; Muhataer, X.; Li, Q.; Lian, Z.; Li, Y.; Wang, W.; Ding, W.; Zhou, Y.; Yang, X.; et al. Interaction between the PI3K/AKT pathway and mitochondrial autophagy in macrophages and the leukocyte count in rats with LPS-induced pulmonary infection. Open Life Sci. 2023, 18, 20220588. [Google Scholar] [CrossRef]
  53. Satake, M.; Sakuraba, H.; Hiraga, H.; Yoshida, S.; Ota, S.; Hasui, K.; Tanaka, N.; Watanabe, R.; Akemoto, Y.; Ishiguro, Y.; et al. P-299 Protective Effect of Tacrolimus on DSS-induced Colitis via Direct Activation of TGF-β–Smad Signaling Pathway in Intestinal Epitherial Cells. Inflamm. Bowel Dis. 2017, 23, s95–s96. [Google Scholar]
  54. Blois, S.M.; Fuss, I.J.; Strober, W.; Dveksler, G. Mo1744 Pregnancy-Specific Glycoprotein 1 (PSG1) Activates TGF-β and Prevents Dextran Sodium Sulfate (DSS)-Induced Colitis in Mice. Gastroenterology 2014, 146, 348–358. [Google Scholar] [CrossRef]
  55. Ye, H.; Wu, Q.; Zhu, Y.; Guo, C.; Zheng, X. Ginsenoside Rh2 alleviates dextran sulfate sodium-induced colitis via augmenting TGF beta signaling. Mol. Biol. Rep. 2014, 41, 5485–5490. [Google Scholar] [CrossRef]
Fishes 11 00317 g001
Figure 1. H&E staining pictures. IF. Intestinal folds; S. Epithelium; TE. Outer membrane.
Figure 1. H&E staining pictures. IF. Intestinal folds; S. Epithelium; TE. Outer membrane.
Fishes 11 00317 g001
Fishes 11 00317 g002
Figure 2. (A) Intestinal epithelial thickness. (B) Intestinal fold height. * (p < 0.05), ** (p < 0.01).
Figure 2. (A) Intestinal epithelial thickness. (B) Intestinal fold height. * (p < 0.05), ** (p < 0.01).
Fishes 11 00317 g002
Fishes 11 00317 g003
Figure 3. (A) PCA of the gene expression level (FPKM) in different samples between the DSS group and the DSS + NR group. (B,C) Heatmap and volcano plot analysis of the total DEGs in the DSS group and DSS + NR group. (D,E) GO and KEGG enrichment analysis based on DEGs. (F,G) GSEA for genes associated with the other signaling pathway. All data are presented as mean ± SD (n = 3).
Figure 3. (A) PCA of the gene expression level (FPKM) in different samples between the DSS group and the DSS + NR group. (B,C) Heatmap and volcano plot analysis of the total DEGs in the DSS group and DSS + NR group. (D,E) GO and KEGG enrichment analysis based on DEGs. (F,G) GSEA for genes associated with the other signaling pathway. All data are presented as mean ± SD (n = 3).
Fishes 11 00317 g003
Fishes 11 00317 g004
Figure 4. (A,B) Histograms of microbial community composition on Genus and Family levels. (C) Relative abundance of Akkermansia_muciniphila. (D) Relative abundance of Bacillota. (E) Relative abundance of Pseudomonadota. (F) Heatmap analysis of community composition at the family level. (G) Circos plot of the gut microbiota in different groups on Family level. (H,I) β-diversity represented by PCoA and NMDS analyses at the OTU level. (J) Taxonomic map of LEfSe. All data are presented as mean ± SD (n = 3).
Figure 4. (A,B) Histograms of microbial community composition on Genus and Family levels. (C) Relative abundance of Akkermansia_muciniphila. (D) Relative abundance of Bacillota. (E) Relative abundance of Pseudomonadota. (F) Heatmap analysis of community composition at the family level. (G) Circos plot of the gut microbiota in different groups on Family level. (H,I) β-diversity represented by PCoA and NMDS analyses at the OTU level. (J) Taxonomic map of LEfSe. All data are presented as mean ± SD (n = 3).
Fishes 11 00317 g004
Fishes 11 00317 g005
Figure 5. (A–D) The positive cell rates of Occludin, Nfkb-P65, ZO-1, and Claudin-1. All data are presented as mean ± SD (n = 3). (E) The expression levels of ZO-1, Claudin-1, Nfkb-P65, and Occludin. (F) CFU count. (G) Western blot analysis of Occludin, Nfkb-P65, and Claudin-1. * (p < 0.05), ** (p < 0.01), *** (p < 0.001).
Figure 5. (A–D) The positive cell rates of Occludin, Nfkb-P65, ZO-1, and Claudin-1. All data are presented as mean ± SD (n = 3). (E) The expression levels of ZO-1, Claudin-1, Nfkb-P65, and Occludin. (F) CFU count. (G) Western blot analysis of Occludin, Nfkb-P65, and Claudin-1. * (p < 0.05), ** (p < 0.01), *** (p < 0.001).
Fishes 11 00317 g005
Fishes 11 00317 g006
Figure 6. (A–D) Immunofluorescence (IF) images of Occludin, Nfkb-P65, ZO-1, and Claudin-1.
Figure 6. (A–D) Immunofluorescence (IF) images of Occludin, Nfkb-P65, ZO-1, and Claudin-1.
Fishes 11 00317 g006
Fishes 11 00317 g007
Figure 7. Verify the RNA-seq data through qRT-PCR.
Figure 7. Verify the RNA-seq data through qRT-PCR.
Fishes 11 00317 g007
Table 1. The primer sequences used in this study.
Table 1. The primer sequences used in this study.
Primer NamePrimer Sequences (5′-3′)
18S rRNA-FGTCAGGTCATCACCATCGGCA
18S rRNA -RCGGTCTCGTGAACACCAGCA
phc-2-FGTGGTCGTGGACGGTGTT
phc-2- RATTCTTCGTGGTTGAGGC
C1GalTA-FTCACTCACGGACTCAGAAGC
C1GalTA- RGCCCTATGGTGGGTGGTA
HPGDS-FGCTGCCAGTGCTGATTGT
HPGDS- RACGCCTCCGGTATGAGTT
ARSJ-FCTGCCAGTGCTGATTGTTG
ARSJ- RGCCTCCGGTATGAGTTCG
Ist1-FCACCACAGGCAAGACAGC
Ist1- RCCACAACAAGGACGAGAT
Gale-FGTGGTGTACTCGTCGTCAGC
Gale- RTGCGTCCGTAGGTGTTTG
FucTC-FCCTTACGACGACTGGATA
FucTC- RTCTTCTTTAGTGGAGGATTA
ARSF-FTAAACACGGCAGATACGGG
ARSF-RCGCCCTGGTCTGAAGTGA
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Li, J.; Chen, Y.; Cai, Y.; Zhang, H.; Qiu, B.; Huang, X.; Wen, Y.; Wang, A.; He, B.; Wang, Y.; et al. Narirutin Mitigates Dextran Sodium Sulfate-Induced Enteritis in Procambarus clarkii by Modulating Intestinal Microbiota. Fishes 2026, 11, 317. https://doi.org/10.3390/fishes11060317

AMA Style

Li J, Chen Y, Cai Y, Zhang H, Qiu B, Huang X, Wen Y, Wang A, He B, Wang Y, et al. Narirutin Mitigates Dextran Sodium Sulfate-Induced Enteritis in Procambarus clarkii by Modulating Intestinal Microbiota. Fishes. 2026; 11(6):317. https://doi.org/10.3390/fishes11060317

Chicago/Turabian Style

Li, Jian, Yitian Chen, Yanping Cai, Huiling Zhang, Bin Qiu, Xingfei Huang, Yan Wen, Aimin Wang, Bin He, Yude Wang, and et al. 2026. "Narirutin Mitigates Dextran Sodium Sulfate-Induced Enteritis in Procambarus clarkii by Modulating Intestinal Microbiota" Fishes 11, no. 6: 317. https://doi.org/10.3390/fishes11060317

APA Style

Li, J., Chen, Y., Cai, Y., Zhang, H., Qiu, B., Huang, X., Wen, Y., Wang, A., He, B., Wang, Y., & Liu, S. (2026). Narirutin Mitigates Dextran Sodium Sulfate-Induced Enteritis in Procambarus clarkii by Modulating Intestinal Microbiota. Fishes, 11(6), 317. https://doi.org/10.3390/fishes11060317

Article Metrics

Article metric data becomes available approximately 24 hours after publication online.
Back to TopTop