Gonadal Transcriptome Analysis Identifies Sex-Related Genes and Regulatory Pathways in Spotted Longbarbel Catfish (Hemibagrus guttatus)
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection and Handling
2.2. Paraffin Sectioning of H. guttatus Gonads
2.3. Total RNA Extraction and Library Construction for Sequencing
2.4. Data Quality Control and Comparison
2.5. Gene Expression Quantification and Differential Expression Analysis
2.6. Enrichment Analysis
2.7. Protein–Protein Interaction Network Construction
2.8. Real-Time Quantitative PCR (RT-qPCR) Validation
3. Results
3.1. Histological Observation
3.2. Transcriptome Sequencing Results
3.3. Transcriptomic Divergence Between Male and Female Gonads
3.4. GO and KEGG Enrichment Analysis
3.5. Screening of Sex-Related Differentially Expressed Genes
3.6. PPI Network Analysis of Sex-Related DEGs
3.7. RT-qPCR Validation
4. Discussion
4.1. Sex-Related Genes Identified in H. guttatus
4.2. Signaling Pathways Related to Gender Regulation
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Tan, D.; Liu, Q.; Xu, H.; Wei, X.; He, N.; Wei, X.; He, X.; Tan, D. Study on artificial propagation technique of Hemibagrus guttatus. Hubei Agric. Sci. 2020, 59, 127–130. [Google Scholar] [CrossRef]
- Zhou, L.; Yang, X.; Li, Z.Y.; Li, D.Y.; Liu, Y.F.; Guan, M. Analysis of nutritional components in muscle of Mystus guttatus. Reserv. Fish. 2006, 36–37. [Google Scholar] [CrossRef]
- Yang, L.; He, S. Phylogeography of the freshwater catfish Hemibagrus guttatus (Siluriformes, Bagridae): Implications for South China biogeography and influence of sea-level changes. Mol. Phylogenet. Evol. 2008, 49, 393–398. [Google Scholar] [CrossRef] [Scilit]
- Chen, J.W.; Wang, S.G.; Meng, Q.M.; Mo, X.Y.; Ma, L. Artificial propagation technology of Mystus guttatus in Southwest China. North. Chin. Fish. 2024, 43, 236–239. [Google Scholar]
- Xie, S.; Fang, W.; Chen, J.; Wang, C.; Zou, J. Gonadal Development and Histological Observation of Cultured Mystus guttatus. J. Dalian Ocean Univ. 2014, 29, 147–150. [Google Scholar]
- Yang, Y.; Liu, Y.; Chen, F.; Wang, Y.; Wu, Y.; He, Z.; Liu, C.; Jiang, Z.; Mu, X.; Bian, C. Gap-free chromosome-level genomes of male and female spotted longbarbel catfish Hemibagrus guttatus. Sci. Data 2024, 11, 572. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ji, L.; Li, X. Transcriptome sequencing (RNA-seq) technology and its applications. Agric. Sci. Serv. 2015, 32, 171–172. [Google Scholar]
- Hayashida, T.; Soma, S.; Nakamura, Y.; Higuchi, K.; Kazeto, Y.; Gen, K. Transcriptome characterization of gonadal sex differentiation in Pacific bluefin tuna, Thunnus orientalis (Temminck et Schlegel). Sci. Rep. 2023, 13, 13867. [Google Scholar] [CrossRef] [Scilit]
- Tang, Y.J.; Ji, H.F.; Wang, H.; Li, Y. Commparative transcriptome analysis of female and male gonads of Portunus trituberculatus. Oceanol. Limnol. Sin. 2019, 50, 197–203. [Google Scholar]
- Domingos, J.A.; Budd, A.M.; Banh, Q.Q.; Goldsbury, J.A.; Zenger, K.R.; Jerry, D.R. Sex-specific dmrt1 and cyp19a1 methylation and alternative splicing in gonads of the protandrous hermaphrodite barramundi. PLoS ONE 2018, 13, e0204182. [Google Scholar] [CrossRef] [Scilit]
- Webster, K.A.; Ponte, B.; Vasquez-Gross, H.; Petereit, J.; Hutchinson, J.; Riddle, M.R. Differential expression of sex regulatory genes in gonads of Astyanax mexicanus surface fish and cavefish. BMC Ecol. Evol. 2025, 25, 57. [Google Scholar] [CrossRef] [Scilit]
- He, F.; Jiang, D.; Huang, Y.; Mustapha, U.F.; Yang, W.; Cui, X.; Tian, C.; Chen, H.; Shi, H.; Deng, S.; et al. Comparative transcriptome analysis of male and female gonads reveals sex-biased genes in spotted scat (Scatophagus argus). Fish Physiol. Biochem. 2019, 45, 1963–1980. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y. Reproductive Physiology of Cultured Fishes in China; China Agriculture Press: Beijing, China, 1993; pp. 22–40. [Google Scholar]
- Wu, D.; Chen, S.Q.; Ke, L.; Zang, Z.; Zhu, J.; Pan, L.; Li, F.; Xu, R.; Peng, L.; Bian, L.; et al. Comparative analysis of the male and female gonadal transcriptome of Thamnaconus septentrionali. Prog. Fish. Sci. 2024, 45, 53–64. [Google Scholar] [CrossRef]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [Scilit]
- Kopylova, E.; Noé, L.; Touzet, H. SortMeRNA: Fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 2012, 28, 3211–3217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Danecek, P.; Bonfield, J.K.; Liddle, J.; Marshall, J.; Ohan, V.; Pollard, M.O.; Whitwham, A.; Keane, T.; McCarthy, S.A.; Davies, R.M.; et al. Twelve years of SAMtools and BCFtools. GigaScience 2021, 10, giab008. [Google Scholar] [CrossRef] [Scilit]
- Patro, R.; Duggal, G.; Love, M.I.; Irizarry, R.A.; Kingsford, C. Salmon provides fast and bias-aware quantification of transcript expression. Nat. Methods 2017, 14, 417–419. [Google Scholar] [CrossRef] [Scilit]
- Robinson, M.D.; McCarthy, D.J.; Smyth, G.K. edgeR: A Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics 2010, 26, 139–140. [Google Scholar] [CrossRef] [Scilit]
- Wu, T.; Hu, E.; Xu, S.; Chen, M.; Guo, P.; Dai, Z.; Feng, T.; Zhou, L.; Tang, W.; Zhan, L.I.; et al. clusterProfiler 4.0: A universal enrichment tool for interpreting omics data. Innovation 2021, 2, 100141. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Zhao, T.; Hu, Y.; Luo, J.; Mou, X. Histological study on gonadal development of Tilapia buttikoferi. J. Jiangxi Agric. Univ. 2019, 41, 340–346. [Google Scholar] [CrossRef]
- Yang, S.; Wang, Y.Z.; Zheng, N.; Wang, L.Z.; Yu, K. Structure of Testis and Spermatozoa of Mystus guttatus. Chin. J. Fish. 2025, 38, 43–50. [Google Scholar]
- Illumina NGS Platforms. Sequencing Platforms. Available online: https://www.illumina.com/systems/sequencing-platforms.html (accessed on 20 December 2024).
- Cohen, J. Statistical Power Analysis for the Behavioral Sciences, 2nd ed.; Routledge: New York, NY, USA, 1988; p. 567. [Google Scholar]
- Bozhilova, L.V.; Whitmore, A.V.; Wray, J.; Reinert, G.; Deane, C.M. Measuring rank robustness in scored protein interaction networks. BMC Bioinform. 2019, 20, 446. [Google Scholar] [CrossRef] [Scilit]
- Dong, J.; Li, J.; Hu, J.; Sun, C.; Tian, Y.; Li, W.; Yan, N.; Sun, C.; Sheng, X.; Yang, S.; et al. Comparative Genomics Studies on the dmrt Gene Family in Fish. Front. Genet. 2020, 11, 563947. [Google Scholar] [CrossRef] [Scilit]
- Veith, A.M.; Froschauer, A.; Körting, C.; Nanda, I.; Hanel, R.; Schmid, M.; Schartl, M.; Volff, J.N. Cloning of the dmrt1 gene of Xiphophorus maculatus: dmY/dmr1Y is not the master sex-detertnining gene in the platyfish. Gene 2003, 317, 59–66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, S.; Dai, S.; Zhou, X.; Wei, X.; Chen, P.; He, Y.; Kocher, T.D.; Wang, D.; Li, M. Dmrt1 is the only male pathway gene tested indispensable for sex determination and functional testis development in Tilapia. PLoS Genet. 2024, 20, e1011210. [Google Scholar] [CrossRef] [Scilit]
- Zarkower, D.; Murphy, M.W. DMRT1: An Ancient Sexual Regulator Required for Human Gonadogenesis. Sex. Dev. 2021, 16, 112–125. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Q.; Cao, T.; Wang, Y.; Li, X.; Wang, Y. Genome-wide identification and comparative analysis of Dmrt genes in echinoderms. Sci. Rep. 2023, 13, 7664. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, C.; Wang, C.; Ouyang, H.; Zhu, Q.; Huang, J.; Han, L.; Li, S.; Li, G.; Lin, H.; Zhang, Y. Characterization of dmrts and their potential role in gonadal development of mandarin fish (Siniperca chuatsi). Aquac. Rep. 2021, 21, 100802. [Google Scholar] [CrossRef] [Scilit]
- Liang, H.; Cao, L.; Li, Z.; Zou, G.; Liu, X. Mitochondrial genome sequence of the shining catfish (Pelteobagrus nitidus). Mitochondrial DNA 2012, 23, 280–282. [Google Scholar] [CrossRef] [Scilit]
- Xu, H.; Lin, W.; Ma, X.; Jawad, M.; Wu, M.; Qiu, J.; Li, M. A timecourse analysis of gonadal histology and transcriptome during the sexual development of yellow catfish, Pelteobagrus fulvidraco. Comp. Biochem. Phys. D 2025, 56, 101576. [Google Scholar] [CrossRef] [Scilit]
- Henri, V.K.; Guernsey, M.W.; Baker, J.C.; Kloet, S.L.; Groenen, M.A.M.; Pollux, B.J.A.; Hendrik-Jan, M. The Genomes of the Livebearing Fish Species Poeciliopsis retropinna and Poeciliopsis turrubarensis Reflect Their Different Reproductive Strategies. Mol. Biol. Evol. 2020, 37, 1376–1386. [Google Scholar] [CrossRef] [Scilit]
- Maurizio, O.; Liliana, S.M.; Romina, G.; Lorenza, Z.; Alessandro, N.; Maurizio, M.; Enrico, M.; Carlo, F. Evidence for FSH-Dependent Upregulation of SPATA2 (Spermatogenesis-Associated Protein 2). Biochem. Biophys. Res. Commun. 2001, 283, 86–92. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sandeep, T.C.; Yau, J.L.W.; Maclullich, A.M.J.; Noble, J.; Deary, I.J.; Walker, B.R.; Seckl, J.R. 11β-Hydroxysteroid dehydrogenase inhibition improves cognitive function in healthy elderly men and type 2 diabetics. Proc. Natl. Acad. Sci. USA 2004, 101, 6734–6739. [Google Scholar] [CrossRef] [Scilit]
- Nie, D.S.; Liu, Y.; Juan, H.; Yang, X. Overexpression of human SPATA17 protein induces germ cell apoptosis in transgenic male mice. Mol. Biol. Rep. 2012, 40, 1905–1910. [Google Scholar] [CrossRef] [Scilit]
- Wei, W.; Gong, Y.; Guo, X.; Liu, M.; Zhou, Y.; Li, Z.; Zhou, L.; Wang, Z.; Gui, J. Gonadal transcriptomes reveal sex-biased expression genes associated with sex determination and differentiation in red-tail catfish (Hemibagrus wyckioides). BMC Genom. 2023, 24, 183. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ma, X.; Liu, Q.; Wang, L.; Wu, L.; Liu, H.; Li, X. Research progress on the role of cyp19a1 gene in fish sex differentiation and development. J. Henan Norm. Univ. (Nat. Sci. Ed.) 2019, 47, 7. [Google Scholar]
- Lanying, Y.; Xuefeng, Z.; Shujun, L.; Chenhua, Z.; Yiyang, M.; Li, J.; Deshou, W.; Linyan, Z. Cyp17a1 is Required for Female Sex Determination and Male Fertility by Regulating Sex Steroid Biosynthesis in Fish. Endocrinology 2021, 162, bqab205. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Liang, Q.; Xu, L.; Xiong, J.; Gao, K.; Xu, P.; Huang, W. Cuproptosis-related IncRNAs ovarian cancer: Multi-omics analysis of molecular mechanisms and potential therapeutic targets. Environ. Toxicol. 2024, 39, 1650–1665. [Google Scholar] [CrossRef] [Scilit]
- Li, N.; Oakes, J.A.; Storbeck, K.H.; Cunliffe, V.T.; Krone, N.P. The P450 side-chain cleavage enzyme Cyp11a2 facilitates steroidogenesis in zebrafish. J. Endocrinol. 2020, 244, 309–321. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, D.; Fan, Z.; Zou, Y.; Tan, X.; Wu, Z.; Jiao, S.; Li, J.; Zhang, P.; You, F. Characteristics of Cyp11a during Gonad Differentiation of the Olive Flounder Paralichthys olivaceus. Int. J. Mol. Sci. 2018, 19, 2641. [Google Scholar] [CrossRef] [Scilit]
- Fan, Z.; Zou, Y.; Jiao, S.; Tan, X.; Wu, Z.; Liang, D.; Zhang, P.; You, F. Significant association of cyp19a promoter methylation with environmental factors and gonadal differentiation in olive flounder Paralichthys olivaceus. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2017, 208, 70–79. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Albalat, R.; Ca Estro, C. Identification of Aldh1a, Cyp26 and RAR orthologs in protostomes pushes back the retinoic acid genetic machinery in evolutionary time to the bilaterian ancestor. Chem.-Biol. Interact. 2009, 178, 188–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collignon, J.; Sockanathan, S.; Hacker, A.; Cohen-Tannoudji, M.; Norris, D.; Rastan, S.; Stevanovic, M.; Goodfellow, P.N.; Lovell-Badge, R. A comparison of the properties of Sox-3 with Sry and two related genes, Sox-1 and Sox-2. Development 1996, 122, 509–520. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhu, C.; Liu, H.; Pan, Z.; Cheng, L.; Sun, Y.; Wang, H.; Chang, G.; Wu, N.; Ding, H.; Zhao, H.; et al. Insights into chromosomal evolution and sex determination of Pseudobagrus ussuriensis (Bagridae, Siluriformes) based on a chromosome-level genome. DNA Res. 2022, 29, dsac028. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shukla, V.; Dhiman, N.; Nayak, P.; Dahanukar, N.; Deshpande, G.; Ratnaparkhi, G. Stonewall and Brickwall: Two Partially Redundant Determinants Required for the Maintenance of Female Germline in Drosophila. G3 2018, 8, 2027–2041. [Google Scholar] [CrossRef] [Scilit]
- Zhai, Y.; Zhang, X.; Zhao, C.; Geng, R.; Wu, K.; Yuan, M.; Ai, N.; Ge, W. Rescue of bmp15 deficiency in zebrafish by mutation of inha reveals mechanisms of BMP15 regulation of folliculogenesis. PLoS Genet. 2023, 19, e1010954. [Google Scholar] [CrossRef] [Scilit]
- Long, J.; Zheng, S.; Wang, X.; Zhang, S.; Wang, D. Role of the TGF-β signaling pathway in sex determination and differentiation of fish. J. Fish. China 2020, 44, 12. [Google Scholar]
- Makoto, K.; Ikumi, N.; Graham, Y. 11β-Hydroxysteroid Dehydrogenase Complementary Deoxyribonucleic Acid in Rainbow Trout: Cloning, Sites of Expression, and Seasonal Changes in Gonads. Endocrinology 2003, 144, 2534–2545. [Google Scholar] [CrossRef] [Scilit]
- Huang, P.; Li, Y.; Xu, C.; Melino, G.; Shao, C.; Shi, Y. HSD11B1 is upregulated synergistically by IFNγ and TNFα and mediates TSG-6 expression in human UC-MSCs. Cell Death Discov. 2020, 6, 24. [Google Scholar] [CrossRef] [Scilit]
- Lin, X.; Xie, X.Y.; Ou, Y.J.; Li, J. Effects of dissolved oxygen on gill tissue of juvenile Eleutheronema tetradactylum based on transcriptome sequencing. J. South. Agric. 2024, 55, 660–669. [Google Scholar]
- Liu, L.; Chen, S.; Yu, M.; Ge, C.; Luo, J. Deacetylation of HSD17B10 by SIRT3 regulates cell growth and cell resistance under oxidative and starvation stresses. Cell Death Dis. 2020, 11, 563. [Google Scholar] [CrossRef] [Scilit]
- Heidi, K.; Marion, A.; Jenni, M.; Pauliina, D.; Damdimopoulos, A.E.; Juha, K.; Outi, H.; Laajala, T.D.; Tero, A.; Jerzy, A. The Hydroxysteroid (17β) Dehydrogenase Family Gene HSD17B12 Is Involved in the Prostaglandin Synthesis Pathway, the Ovarian Function, and Regulation of Fertility. Endocrinology 2016, 157, 3719–3730. [Google Scholar] [CrossRef] [Scilit]
- Shu, T. Mechanisms by Which Sex Steroid Hormones Regulate Sex Differentiation and Gonadal Development in Cyprinid Fish Based on cyp17a1 Knockout. Ph.D. Thesis, University of Chinese Academy of Sciences, Beijing, China, 2023. [Google Scholar]
- Pan, Q.; Kay, T.; Depincé, A.; Adolfi, M.; Schartl, M.; Guiguen, Y.; Herpin, A. Evolution of master sex determiners: TGF-β signalling pathways at regulatory crossroads. Philos. Trans. R. Soc. B Biol. Sci. 2021, 376, 20200091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Richter, A.; Mörl, H.; Thielemann, M.; Kleemann, M.; Geißen, R.; Schwarz, R.; Albertz, C.; Koch, P.; Petzold, A.; Kroll, T.; et al. The master male sex determinant Gdf6Y of the turquoise killifish arose through allelic neofunctionalization. Nat. Commun. 2025, 16, 540. [Google Scholar] [CrossRef] [Scilit]
- Cui, F.; Wang, Y.; Liang, H.; Yang, Y.; Jiang, Z.; Song, J.; Liu, C.; Wu, Y.; Mu, X.; Liu, Y. Comparative Transcriptomic Analysis of Male and Female Gonads in the Zig-Zag Eel (Mastacembelus armatus). Fishes 2025, 10, 117. [Google Scholar] [CrossRef] [Scilit]
- He, Z.; Ye, L.; Yang, D.; Ma, Z.; Deng, F.; He, Z.; Hu, J.; Chen, H.; Zheng, L.; Pu, Y.; et al. Identification, characterization and functional analysis of gonadal long noncoding RNAs in a protogynous hermaphroditic teleost fish, the ricefield eel (Monopterus albus). BMC Genom. 2022, 23, 450. [Google Scholar] [CrossRef] [Scilit]
- Goikoetxea, A.; Todd, E.V.; Gemmell, N.J. Stress and sex: Does cortisol mediate sex change in fish? Reproduction 2017, 154, R149–R160. [Google Scholar] [CrossRef] [Scilit]
- Qi, P.P.; Chen, M.; Yu, Y. Effects of high temperature and cortisol on sex differentiation of yellow catfish (Tachysurus fulvidraco). Acta Hydrobiol. Sin. 2021, 45, 106–117. [Google Scholar] [CrossRef]
- Mascoli, A.; Zapater, C.; Ibañez, S.; Adolfi, M.C.; Schartl, M.; Gómez, A. A Novel Steroidogenic Action of Anti-Müllerian Hormone in Teleosts: Evidence from the European Sea Bass Male (Dicentrarchus labrax). Int. J. Mol. Sci. 2025, 26, 7554. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, J.; Wang, J.; Zhang, W.; Lin, J.; Yang, J.; Peng, J.; Peng, S.; Li, S.; Zhang, Y.; Peng, C. Identification and functional analysis of insulin-like 3 during gonad development in the hermaphroditic orange-spotted grouper, Epinephelus coioides. Aquaculture 2024, 584, 740635. [Google Scholar] [CrossRef] [Scilit]








| Purpose | Samples | Gonadal Development Period |
|---|---|---|
| histological observation | F7, F8, F9 | I |
| M7, M8, M9 | ||
| F10, F11, F12 | II | |
| M10, M11, M12 | ||
| F13, F14, F15 | III | |
| M13, M14, M15 | ||
| F1, F2, F3 | IV | |
| M1, M2, M3 | ||
| RNA-seq | F1, F2, F3 | IV |
| M1, M2, M3 | ||
| RT-qPCR | F4, F5, F6 | IV |
| M4, M5, M6 |
| Gene | Sequences from (5′-3′) |
|---|---|
| β-actin | F:AGGTTCTATTTTGTGGGTTTTCGG R:ATGCTTTCGCTTTCGTCCGTCTTG |
| inha | F:TCTGTGGACTTCTGGTTT R:GCGTTTAGATGGTCTTTG |
| amh | F:TAAACAACAGTGAAGGGGAAAATCGC R:GATGAAAACTGGGAATAACGCACGCC |
| insl3 | F:AAGGGATTTGGGGAAAAGATGC R:TTCAGATTGGAAAACAGATCAC |
| cyp11a | F:TTTATGGCGAGCGTATTG R:TGGTGTGTAGAAGCGGAG |
| gata4 | F:TGCCACACCACAACCACC R:CGCGTCTGAATACCTTCC |
| hsd11b1 | F:GCTATGGAAAAAATCAAA R:AGAAGGTGTACCAGGGGT |
| zp3 | F:AGTTCGTGTGCTTTTGGC R:AGGATGTGCTGGCTTGTT |
| gdf9 | F:CGCCTTCAGACAAGCACA R:ACATCCACCTCCACCCAC |
| figla | F:GACCGAAAGCCCAGTAAA R:GCAATGTGAAAAAATCCT |
| fgf11 | F:GTCCACTCTGTATCGTCA R:GCAGGGTTTGGTTTTCTT |
| Item | F1 | F2 | F3 | M1 | M2 | M3 | |
|---|---|---|---|---|---|---|---|
| Raw Data | Reads | 55,788,208 | 49,012,700 | 43,174,888 | 50,192,800 | 43,958,014 | 61,066,286 |
| GC (%) | 50.01 | 49.89 | 49.8 | 47.28 | 46.95 | 48.18 | |
| Q20 (%) | 99.02 | 98.44 | 98.42 | 98.13 | 98.12 | 98.14 | |
| Q30 (%) | 97.04 | 95.33 | 95.31 | 94.59 | 94.62 | 94.61 | |
| Clean Data | Reads | 54,909,012 | 48,190,012 | 42,492,510 | 49,522,198 | 43,329,690 | 60,142,156 |
| GC (%) | 49.98 | 49.87 | 49.77 | 47.25 | 46.91 | 48.15 | |
| Q20 (%) | 99.18 | 98.62 | 98.62 | 98.35 | 98.37 | 98.38 | |
| Q30 (%) | 97.33 | 95.64 | 95.65 | 94.97 | 95.05 | 95.04 | |
| Total reads | 54,909,012 | 48,190,012 | 42,492,510 | 49,522,198 | 43,329,690 | 60,142,156 | |
| Total mapped reads | 53,034,203 | 46,523,398 | 40,955,533 | 46,490,848 | 40,140,992 | 56,450,980 | |
| Reads mapped to exon | 51,999,383 | 45,642,221 | 40,117,981 | 43,754,912 | 38,205,337 | 54,337,808 | |
| Percent of reads mapped to exon of genome | 94.70% | 94.71% | 94.41% | 88.35% | 88.17% | 90.35% | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2026 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license.
Share and Cite
Zhao, K.; Wang, Y.; Yang, Y.; Liu, Y.; Liu, C.; Zhu, S.; Sun, J.; Mu, X. Gonadal Transcriptome Analysis Identifies Sex-Related Genes and Regulatory Pathways in Spotted Longbarbel Catfish (Hemibagrus guttatus). Fishes 2026, 11, 43. https://doi.org/10.3390/fishes11010043
Zhao K, Wang Y, Yang Y, Liu Y, Liu C, Zhu S, Sun J, Mu X. Gonadal Transcriptome Analysis Identifies Sex-Related Genes and Regulatory Pathways in Spotted Longbarbel Catfish (Hemibagrus guttatus). Fishes. 2026; 11(1):43. https://doi.org/10.3390/fishes11010043
Chicago/Turabian StyleZhao, Kun, Yuanyuan Wang, Yexin Yang, Yi Liu, Chao Liu, Shandian Zhu, Jinhui Sun, and Xidong Mu. 2026. "Gonadal Transcriptome Analysis Identifies Sex-Related Genes and Regulatory Pathways in Spotted Longbarbel Catfish (Hemibagrus guttatus)" Fishes 11, no. 1: 43. https://doi.org/10.3390/fishes11010043
APA StyleZhao, K., Wang, Y., Yang, Y., Liu, Y., Liu, C., Zhu, S., Sun, J., & Mu, X. (2026). Gonadal Transcriptome Analysis Identifies Sex-Related Genes and Regulatory Pathways in Spotted Longbarbel Catfish (Hemibagrus guttatus). Fishes, 11(1), 43. https://doi.org/10.3390/fishes11010043

