Evaluation of Silymarin–L-Carnitine as a Dietary Supplement on Growth Performance, Antioxidants and Immunity, Gut/Liver Health, and Gene Expression in Nile Tilapia (Oreochromis niloticus)

Abstract

Silymarin and L-carnitine are individually used in fish diets, yet whether they exert interactive or additive effects when combined remains unclear. This study aimed to investigate the individual and combined impacts of dietary silymarin (S), L-carnitine (LC), and their combination (S + LC) on growth performance, digestive enzyme activity, antioxidant status, immune response, and gene expression in Nile tilapia. A total of 360 fish (initial body weight: 10.01 ± 0.03 g) were randomly allocated into 12 fiberglass tanks (30 fish/tank) and fed one of four diets for 84 days: control (basal diet), S (850 mg/kg), LC (500 mg/kg), and S + LC (425 mg/kg S + 250 mg/kg LC). Fish fed S and S + LC diets exhibited significantly higher final body weight, weight gain, and specific growth rate (SGR), along with improved feed conversion ratio (FCR) compared to the control (p < 0.05). All supplemented groups exhibited enhanced digestive enzyme activities (amylase, lipase, protease), with the S + LC group showing the highest values. Serum biochemical profiles revealed increased total protein and globulin and reduced glucose and cortisol levels. Innate immune responses (IgM, lysozyme activity, NBT%, and bactericidal activity) were significantly elevated, especially in the S + LC group. Antioxidant enzyme activities (SOD, CAT, GPx) increased, while malondialdehyde (MDA) levels declined. Gene expression analysis showed significant upregulation of IGF-1, IFNA-1, SOD, CAT, and Gsr, with the greatest expression in the S + LC group. These findings indicate that dietary silymarin and L-carnitine, particularly when provided together, produced complementary and enhanced effects on growth, immune competence, antioxidant capacity, and gene regulation in Nile tilapia.

1. Introduction

The global demand for high-quality animal protein continues to rise in response to population growth, environmental constraints on terrestrial agriculture, and the nutritional importance of aquatic products [1]. Aquaculture, as the fastest-growing food production sector, is crucial to meeting this demand [2]. Among aquaculture species, Oreochromis niloticus has emerged as a cornerstone species due to its fast growth rate, adaptability to varying environmental conditions, tolerance to high stocking densities, and its ability to utilize plant-based diets [3]. The intensification of production systems, while economically beneficial, exposes fish to chronic stressors such as overcrowding, fluctuating water quality, oxidative imbalance, and pathogen exposure. These factors often result in suppressed growth, compromised feed efficiency, compromised immunity, and elevated mortality rates [4].

To mitigate these negative impacts and support the sustainability of intensive aquaculture, research has increasingly focused on the development of functional feeds that incorporate natural bioactive compounds. These nutraceuticals are valued for their capacity to enhance fish health by modulating oxidative stress, metabolic activity, immune response, and tissue integrity [5]. Among such candidates, silymarin and L-carnitine are of particular interest due to their complementary physiological effects (hepatoprotection and metabolic enhancement) and natural origin [6].

Silymarin (S), a standardized extract derived from the seeds of Silybum marianum (milk thistle), is composed of flavonolignans such as silybin, silydianin, and silychristin, which collectively exhibit potent antioxidants, anti-inflammatory, hepatoprotective, and immunomodulatory activities [7,8]. These compounds function by scavenging reactive oxygen species (ROS), stabilizing hepatocyte membranes, upregulating phase II detoxifying enzymes, and modulating nuclear transcription factors such as Nrf2 and NF-κB, which are central to antioxidants and inflammatory pathways [7,9]. In aquaculture species, silymarin has been reported to improve serum biochemical parameters (e.g., albumin, total protein, ALT, AST), enhance antioxidant enzyme activity (e.g., SOD, CAT, GPx), and increase the expression of immune-related genes such as IgM, IL-10, and IFN-γ [5,7,10,11].

L-carnitine (β-hydroxy-γ-trimethylaminobutyric acid, LC) is an endogenous compound synthesized from lysine and methionine, primarily in the liver and kidney. It plays a central role in energy metabolism, specifically in the transport of long-chain fatty acids across the mitochondrial membrane for β-oxidation, thus facilitating ATP production from long-chain fatty acid oxidation [12]. In aquafeeds, L-carnitine is often included as a supplement to improve lipid utilization, reduce hepatic lipid accumulation, and enhance muscle energy reserves, particularly under high-energy dietary regimes [13]. Additionally, L-carnitine has been shown to exert antioxidant and anti-inflammatory effects by inhibiting ROS production, preserving mitochondrial membrane potential, and modulating cytokine gene expression (e.g., IL-1β, TNF-α) [14]. Several studies in fish species, including tilapia [15], common carp [16,17], giant grouper [18] and rainbow trout [19] have demonstrated that dietary L-carnitine improves growth rate, feed efficiency, immune parameters (e.g., lysozyme, phagocytic index), and reduces stress-related cortisol levels [12].

Despite the well-established individual benefits of silymarin and L-carnitine in aquafeeds, their potential interactive or combined effects when administered together remain largely unexplored. Understanding such combined actions is essential for developing optimized dietary strategies that maximize physiological benefits while avoiding nutrient–nutrient interference. Given their distinct but complementary roles, silymarin as a hepatoprotective antioxidant and L-carnitine as a mitochondrial energy enhancer, it is hypothesized that their co-supplementation may produce enhanced and complementary effects that improve metabolic efficiency, immune response, oxidative stress resilience, and growth performance in farmed fish.

To test this hypothesis, the present study investigated the individual and combined effects of dietary silymarin and L-carnitine on Oreochromis niloticus, evaluating a comprehensive set of physiological, biochemical, histological, and molecular parameters. These included growth performance, feed conversion ratio, digestive enzyme activity, serum biochemical and antioxidant profiles, innate immune markers, liver and intestinal histomorphology, and the expression of genes related to growth (IGF-1), oxidative defense (SOD, CAT, GPx, Gsr), and immunity (IFNA-1). This integrative approach aims to provide mechanistic insights into the efficacy of silymarin and L-carnitine as functional feed additives for promoting fish health, productivity, and resilience in intensive aquaculture systems.

2. Materials and Methods

2.1. Fish Collection, Acclimation, Experimental Design, and Rearing Conditions

A total of 360 healthy juvenile (Oreochromis niloticus), averaging approximately 10 g in initial body weight, were obtained from Bughaz El-Burullus (Kafr El-Sheikh, Egypt). The fish were transported with care to the experimental facility at CLAR, Abbassa, Abo-Hammad, Sharqia, Egypt, in well-aerated containers to minimize handling stress. Upon arrival, the fish underwent a 14-day acclimation period in fiberglass tanks maintained under controlled conditions. During acclimation, they were fed a commercial basal diet twice daily to support health and adaptation. Afterward, fish were randomly assigned to 12 fiberglass tanks (100 L capacity each) equipped with continuous aeration using air stones connected to a central blower system, with 30 individuals per tank. The experimental setup consisted of four dietary treatments, each with three replicates. Throughout the 84-day feeding period, fish were offered feed to apparent satiation three times daily at 08:00, 13:00, and 17:00. Water quality was consistently monitored and maintained within optimal ranges: temperature at 26.7 ± 0.33 °C (digital thermometer), dissolved oxygen at 6.78 ± 0.67 mg/L (DO meter), pH at 7.68 ± 0.33 (pH meter), and total ammonia levels below 0.05 mg/L (spectrophotometric method). To preserve water quality and reduce waste accumulation, approximately two-thirds of the water in each tank was replaced every 48 h.

2.2. Diet Preparation and Nutritional Composition

Four isonitrogenous and isolipidic experimental diets were formulated for the 84-day feeding trial (

Table 1. Formulation and proximate nutritional composition of the basal diet (g/kg dry weight; n = 3).

Formulation (g/kg) 1	Experimental Diets
	Control	S	LC	S + LC
Fish meal, 65%	60	60	60	60
Meat meal, 50%	28	28	28	28
Corn	180	180	180	180
Rice bran	120	120	120	120
Wheat bran	100	100	100	100
Soybean meal, 48%	400	400	400	400
Corn gluten	50	50	50	50
Mono calcium	15	15	15	15
Premix 2	15	15	15	15
Sunflower Oil	30	30	30	30
Vitamin C	2	2	2	2
Total	1000	1000	1000	1000
Silymarin 3 levels (S, mg/kg)	0	850	0	425
L-Carnitine 4 (LC, mg/kg)	0	0	500	250
Nutritional profile (%)
Dry matter (%, DM)	90.12 ± 0.35	90.28 ± 0.41	90.05 ± 0.39	90.24 ± 0.32
Crude protein (CP, % DM basis)	30.64 ± 0.55	30.09 ± 0.69	31.01 ± 1.01	30.89 ± 0.551
Crude lipid (CL, % DM basis)	3.75 ± 0.33	3.80 ± 0.15	3.16 ± 0.54	3.77 ± 0.25
Ash (% DM basis)	4.17 ± 0.62	4.44 ± 0.29	4.16 ± 0.05	4.19 ± 0.22
Crude fiber (CF, % DM basis)	3.52 ± 0.43	3.91 ± 0.42	3.96 ± 0.62	3.86 ± 0.51

¹ Feed Control Co., Ltd., based in Damro, Sidi Salem, Kafrelsheikh, Egypt, provided the ingredients. ² Premix (vitamins and minerals) formulated based on Shehata, et al. [3]. ³ Silymarin (98% purity) was sourced from Legalon^® 140 mg (Madaus GmbH & Co., Köln, Germany). ⁴ L-carnitine (dietary grade, (≥98% purity) was obtained from a local supplier in Alexandria City, Egypt.

): a control diet (basal, without additives), a silymarin-supplemented diet (S; 850 mg/kg) [8], an L-carnitine-supplemented diet (LC; 500 mg/kg) [15,20], and a combined diet (S + LC; 425 mg/kg silymarin and 250 mg/kg L-carnitine). All diets contained approximately 30.64 ± 0.55% crude protein and 3.75 ± 0.33% crude lipid. The ingredients were uniformly mixed, mechanically pelleted into 1–2 mm sizes, air-dried at room temperature, and stored at 4 °C to maintain nutritional integrity.

The proximate composition of the experimental diets was assessed using standard methods outlined by the Association of Official Analytical Chemists [21]. Moisture was measured by drying samples in an oven at 105 °C until a constant weight was achieved, while ash content was determined by combustion in a muffle furnace at 550 °C. Crude lipid was extracted using the Soxhlet method with petroleum ether, crude protein was quantified via the Kjeldahl technique, and crude fiber was analyzed through sequential acid and alkaline digestion.

2.3. Sampling and Performance Metrics

2.3.1. Growth and Biometric Analysis

Before final measurements, fish were fasted for 24 h to ensure uniform gut clearance. Anesthesia was applied using tricaine methanesulfonate (MS-222) at a concentration of 100 mg/L. Following sedation, fish from each replicate were individually counted and weighed to evaluate growth and survival. Biometric parameters, including total length and the weights of the liver, viscera, and intestine, were also recorded. Based on these data, the following indices were calculated:

Weight gain (WG, g/fish) = FBW − IBW

$$\mathrm{S}\mathrm{p}\mathrm{e}\mathrm{c}\mathrm{i}\mathrm{f}\mathrm{i}\mathrm{c}\mathrm{g}\mathrm{r}\mathrm{o}\mathrm{w}\mathrm{t}\mathrm{h}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{e}(\mathrm{S}\mathrm{G}\mathrm{R},\%/\mathrm{d}\mathrm{a}\mathrm{y})={\displaystyle \frac{\mathrm{L}\mathrm{n}\mathrm{F}\mathrm{B}\mathrm{W}-\mathrm{L}\mathrm{n}\mathrm{I}\mathrm{B}\mathrm{W}}{\mathrm{T}\mathrm{i}\mathrm{m}\mathrm{e},\mathrm{d}\mathrm{a}\mathrm{y}}}\times 100$$

$$\mathrm{S}\mathrm{u}\mathrm{r}\mathrm{v}\mathrm{i}\mathrm{v}\mathrm{a}\mathrm{l}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{e}\left(\mathrm{S}\mathrm{R},\%\right)={\displaystyle \frac{\mathrm{F}\mathrm{i}\mathrm{n}\mathrm{a}\mathrm{l}\mathrm{f}\mathrm{i}\mathrm{s}\mathrm{h}\mathrm{c}\mathrm{o}\mathrm{u}\mathrm{n}\mathrm{t}}{\mathrm{I}\mathrm{n}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{a}\mathrm{l}\mathrm{f}\mathrm{i}\mathrm{s}\mathrm{h}\mathrm{c}\mathrm{o}\mathrm{u}\mathrm{n}\mathrm{t}}}\times 100$$

$$\mathrm{C}\mathrm{o}\mathrm{n}\mathrm{d}\mathrm{i}\mathrm{t}\mathrm{i}\mathrm{o}\mathrm{n}\mathrm{f}\mathrm{a}\mathrm{c}\mathrm{t}\mathrm{o}\mathrm{r}(\mathrm{C}\mathrm{F})={\displaystyle \frac{\mathrm{B}\mathrm{o}\mathrm{d}\mathrm{y}\mathrm{w}\mathrm{e}\mathrm{i}\mathrm{g}\mathrm{h}\mathrm{t}}{{\mathrm{L}\mathrm{e}\mathrm{n}\mathrm{g}\mathrm{t}\mathrm{h}}^3}}\times 100$$

$$\mathrm{F}\mathrm{e}\mathrm{e}\mathrm{d}\mathrm{c}\mathrm{o}\mathrm{n}\mathrm{v}\mathrm{e}\mathrm{r}\mathrm{s}\mathrm{i}\mathrm{o}\mathrm{n}\mathrm{r}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{o}(\mathrm{F}\mathrm{C}\mathrm{R})={\displaystyle \frac{\mathrm{F}\mathrm{I},\mathrm{g}}{\mathrm{W}\mathrm{G},\mathrm{g}}}$$

$$\mathrm{H}\mathrm{e}\mathrm{p}\mathrm{a}\mathrm{t}\mathrm{o}\mathrm{s}\mathrm{o}\mathrm{m}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{c}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}\left(\mathrm{H}\mathrm{S}\mathrm{I},\%\right)={\displaystyle \frac{\mathrm{L}\mathrm{W},\mathrm{g}}{\mathrm{F}\mathrm{B}\mathrm{W},\mathrm{g}}}\times 100$$

$$\mathrm{V}\mathrm{i}\mathrm{s}\mathrm{c}\mathrm{e}\mathrm{r}\mathrm{o}\mathrm{s}\mathrm{o}\mathrm{m}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{c}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}\left(\mathrm{V}\mathrm{S}\mathrm{I},\%\right)={\displaystyle \frac{\mathrm{V}\mathrm{W},\mathrm{g}}{\mathrm{F}\mathrm{B}\mathrm{W},\mathrm{g}}}\times 100$$

$$\mathrm{I}\mathrm{n}\mathrm{t}\mathrm{e}\mathrm{s}\mathrm{t}\mathrm{i}\mathrm{n}\mathrm{o}\mathrm{s}\mathrm{o}\mathrm{m}\mathrm{a}\mathrm{t}\mathrm{i}\mathrm{c}\mathrm{i}\mathrm{n}\mathrm{d}\mathrm{e}\mathrm{x}\left(\mathrm{I}\mathrm{S}\mathrm{I},\%\right)={\displaystyle \frac{\mathrm{I}\mathrm{W},\mathrm{g}}{\mathrm{F}\mathrm{B}\mathrm{W},\mathrm{g}}}\times 100$$

where: IBW = initial body weight, FBW = final body weight, TL = total length, FI = feed intake, VW = weight of the viscera, LW = weight of the liver, and IW = weight of the intestines.

2.3.2. Tissue and Blood Collection

For molecular analysis, liver samples were promptly collected, preserved in RNAlater solution at 4 °C for 24 h, and then stored at −18 °C until use. For histological evaluation, liver and intestinal tissues were rinsed with cold phosphate-buffered saline (PBS, pH 7.4) and fixed in 10% neutral buffered formalin for 48 h. Blood was drawn from the caudal vein of seven fish per replicate (n = 21 per treatment), allowed to coagulate for 30 min at room temperature (approximately 25 °C), and centrifuged at 1400× g for 10 min at 4 °C to separate serum, which was stored at −20 °C for biochemical analysis. Digestive tissues were collected immediately after dissection to assess enzymatic activity. Intestinal samples were flushed with ice-cold PBS (pH 7.5; 1:10 w/v), homogenized on ice, and centrifuged at 5000× g for 5 min at 4 °C. The resulting supernatants were stored at 4 °C for later use. For antioxidant assays, liver tissues were homogenized (1:9 w/v) in cold 0.86% saline and centrifuged at 13,600× g for 10 min at 4 °C. All procedures were conducted aseptically, with samples coded anonymously to minimize bias.

2.4. Digestive Enzyme Activity

Digestive enzyme activities were determined using validated and standardized analytical protocols. Protease activity was measured employing a commercial kit (Sigma-Aldrich, St. Louis, MO, USA), utilizing casein as the specific substrate [22]. Lipase and amylase activities were measured spectrophotometrically using kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Amylase was quantified at an absorbance of 660 nm (AMS, Cat. No. C016-1-1), while lipase activity was measured at 420 nm (LPS, Cat. No. A054-1-1).

2.5. Biochemical, Antioxidant, and Innate Immune Parameters

Serum biochemical indicators, including glucose (Cat. No. GL 13 20), total protein (Cat. No. TP 20 20), albumin (Cat. No. AB 10 10), calculated globulin, total cholesterol (Cat. No. TC 20 10), triglycerides (Cat. No. TG 20 11), alanine aminotransferase (ALT, Cat. No. AT 10 34), aspartate aminotransferase (AST, Cat. No. AT 10 45), urea (Cat. No. UR 21 10), and creatinine (Cat. No. CR 12 50) were measured using commercial diagnostic kits (Bio-Diagnostic Co., Giza, Egypt), following the manufacturer’s protocols. Cortisol levels were determined via enzyme-linked immunosorbent assay (ELISA) using a commercial kit (Calbiotech Inc., El Cajon, CA, USA; Cat. No. CO368S).

Antioxidant status was assessed by quantifying the activities of superoxide dismutase (SOD; WST-1 method, absorbance at 450 nm, Cat. No. A001-3-2), catalase (CAT; 405 nm, Cat. No. A007-1-1), and glutathione peroxidase (GPx; 412 nm, Cat. No. A005-1), along with malondialdehyde (MDA; 532 nm, Cat. No. A003-1) concentrations. All assays were conducted using kits from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

Innate immune responses were evaluated by measuring lysozyme activity using the turbidimetric method, bactericidal activity against Streptococcus agalactiae, and neutrophil respiratory burst through the nitroblue tetrazolium (NBT) reduction assay [23].

2.6. Histomorphological Analysis

At the end of the experimental period, liver and intestinal tissues were harvested for histological examination following established procedures [24]. Samples were initially fixed in 10% neutral buffered formalin, then dehydrated through an ascending ethanol series (70% to 100%), cleared in xylene, and embedded in paraffin wax. Thin tissue sections (5 µm) were prepared using a rotary microtome (Leica RM2035, Leica Microsystems GmbH, Wetzlar, Germany), mounted on adhesive-coated slides, and stained with hematoxylin and eosin (H&E) according to the protocol described by Bancroft and Gamble [25]. Microscopic evaluation was performed using a Leica DM500 light microscope equipped with a Leica EC3 digital camera (Leica Microsystems GmbH, Wetzlar, Germany). Representative photomicrographs were taken to assess and compare structural alterations among treatment groups. Morphometric parameters, including villus height, width, and muscularis thickness, were measured in micrometers (µm) using ImageJ software (version 1.53t, National Institutes of Health, Bethesda, MD, USA). Goblet cell numbers were counted, and data were analyzed statistically. Hepatic lesions were assessed semi-quantitatively as per Gibson-Corley et al. [26]. Five high-power fields (40×) per slide were examined blindly by a pathologist. Lesions, such as hepatic steatosis and vacuolation, were scored on a 0–4 scale (0 = normal, 4 = severe), and mean scores were calculated.

2.7. RNA Extraction and Quantitative Gene Expression

Liver tissues preserved in RNAlater (Sigma-Aldrich, St. Louis, MO, USA) at 4 °C for 24 h and stored at −18 °C were used for total RNA extraction. RNA was isolated using the A.B.T.™ RNA Purification Kit (Applied Biotechnology Co., Giza, Egypt), and its purity and concentration were evaluated with a NanoDrop spectrophotometer (BioDrop µLite, BioDrop Ltd., Cambridge, UK). The RNA purity ranged between 1.9–2.0 (A260/280) and 2.0–2.2 (A260/230), indicating high purity. Samples were then standardized to a final concentration of 50 ng/μL. Gene-specific primers (

Table 2. Gene-specific primers used for quantitative real-time PCR (RT-qPCR) analysis.

Gene Name	Primer sequences (5′–3′) Forward (F) and Reverse (R)		Amplicon Size (bp)	Tm (°C)	Primer Efficiency (%)	GenBank Accession No	Reference
IGF-1	F	GTGGACGAGTGCTGCTTC	139	58	98	XM_019346352.2	[28]
	R	TGCTACTAACCTTGGGTGC
IFNA-1	F	ATGGGAGGAGAACACAGTGG	94	59	100	XM_005466659.4	[29]
	R	TGTCGTATTGCTGTGGCTTC
CAT	F	ATGAGGAGGAGCGACAGAGA	90	61	97	JF801726.1
	R	AATTCTCGACCATGCGTTTC
SOD	F	GGAGGTGAACCACAAGGAGA	99	61	99	XM_003449940.5
	R	TACAGCCACCGTAACAGCAG
Gsr	F	TCTGCACGATCATGGTGATT	104	60	100	XM_013271309.3
	R	TGCGATTTAGGTGACTGACG
β-actin	F	GATATCATTTGCCTGAAACCGTTT	77	59	100	XM_003443127.5	[30]
	R	CGATTTCATCTTCCATGGCTTT

IGF-1: Insulin-like growth factor 1; IFNA-1: Interferon alpha-like 1; CAT: Catalase; SOD: Superoxide dismutase; Gsr: Glutathione reductase.

) were designed using Primer 5.0 software and employed in one-step reverse transcription quantitative PCR (RT-qPCR) using SYBR Green chemistry. Each qPCR reaction (20 µL total volume) contained 10 µL SYBR Green Master Mix, 1 µL forward and reverse primers (10 µM each), 2 µL cDNA template, and 6 µL nuclease-free water. The thermal cycling conditions included: reverse transcription at 50 °C for 30 min, initial denaturation at 95 °C for 10 min, followed by 45 cycles of denaturation at 95 °C for 5 s and annealing/extension at 60 °C for 30 s. β-actin served as the reference gene. Melt curve analysis was performed to verify the specificity of amplification. Relative gene expression was calculated using the 2^−ΔΔCt method [27].

2.8. Statistical Analysis

Statistical analyses were performed using SPSS software (version 20.0; IBM Corp., USA). Data were first checked for normality (Shapiro–Wilk test) and homogeneity of variances (Levene’s test). A one-way analysis of variance (ANOVA) was then applied, with the tank serving as the experimental unit. Pre-specified a priori contrasts were defined according to the main biological hypotheses: (i) S + LC vs. S, (ii) S + LC vs. LC, (iii) S vs. Control, and (iv) LC vs. Control. For overall group comparisons, the Tukey–HSD post hoc test was used to provide conservative control of the familywise error rate. For families of related endpoints (e.g., biochemical, immune, or antioxidant variables), p-values were further adjusted using the Benjamini–Hochberg false discovery rate (FDR) procedure. Statistical significance was accepted at p_adj < 0.05. All results are expressed as the mean ± standard error (SE).

3. Results

3.1. Growth Parameters

Table 3. Growth performance, feed conversion ratio, organ indices, and survival of Oreochromis niloticus fed diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC).

Variables	Experimental Groups
	Control	S	LC	S + LC	p_adj Values
IBW (g)	10.02 ± 0.07	10.01 ± 0.02	10.01 ± 0.07	10.00 ± 0.06	0.996
FBW (g)	44.64 ± 1.23 c	54.52 ± 1.01 a	49.98 ± 1.51 b	56.49 ± 1.47 a	0.001
WG (g)	34.62 ± 1.25 c	44.51 ± 1.02 a	39.96 ± 1.57 b	46.49 ± 1.43 a	0.001
SGR (%/d)	1.78 ± 0.04 c	2.02 ± 0.02 ab	1.92 ± 0.04 b	2.06 ± 0.03 a	0.002
FCR	1.79 ± 0.04 a	1.49 ± 0.01 b	1.59 ± 0.06 b	1.50 ± 0.02 b	0.003
SR (%)	95.55 ± 2.22	96.67 ± 1.93	96.67 ± 1.93	97.78 ± 1.11	0.864
HSI (%)	1.81 ± 0.02	1.75 ± 0.23	2.21 ± 0.25	1.80 ± 0.13	0.284
ISI (%)	4.19 ± 0.26	5.00 ± 0.3	4.62 ± 0.27	4.71 ± 0.17	0.193
VSI (%)	9.88 ± 0.7	10.09 ± 0.67	9.65 ± 0.49	9.87 ± 0.64	0.969
CF	2.16 ± 0.11	2.32 ± 0.09	2.23 ± 0.03	2.18 ± 0.08	0.502

IBW: initial body weight; FBW: final body weight; WG: weight gain; SGR: specific growth rate; FCR: feed conversion ratio; SR: survival rate; HSI: hepatosomatic index; ISI: intestinosomatic index; VSI: viscerosomatic index; CF: Condition factor. Values represent the mean ± SE. Superscript letters denote significant differences among treatments based on the Tukey–HSD test (p_adj < 0.05).

presents the influences of dietary augmentation with silymarin (S), L-carnitine (LC), and their combination (S + LC) on growth performance, FCR, organ indices, and survival rate of O. niloticus. Significant improvements were observed in FBW, WG, and SGR in the treated groups compared to the control. The highest FBW and WG were recorded in the S + LC and S groups, with values of 56.49 ± 1.47 g and 54.52 ± 1.01 g for FBW, and 46.49 ± 1.43 g and 44.51 ± 1.02 g for WG, respectively, which were significantly higher (p < 0.05) than those in the control and LC groups. Similarly, SGR followed the same trend, with the S + LC group achieving the highest value (2.06 ± 0.03%/d), significantly surpassing the control (1.78 ± 0.04%/d). Feed conversion ratio (FCR) was significantly improved (lower values) in all enriched groups compared to the control, with the S group exhibiting the most efficient feed utilization (1.49 ± 0.01). Survival rate (SR) remained high and comparable across all groups (p > 0.05), ranging from 95.55% to 97.78%, with no significant differences observed. Condition factor (CF), hepatosomatic index (HSI), intestinosomatic index (ISI), and viscerosomatic index (VSI) showed no changes (p > 0.05) among the groups, though a slight increase in ISI was noted in the S group (5.00 ± 0.3%).

3.2. Digestive Tract Health

Table 4. Digestive enzyme activities of Oreochromis niloticus fed diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC).

Enzyme (U/mg)	Experimental Groups
	Control	S	LC	S + LC	p_adj Values
Amylase	10.54 ± 0.4 c	15.69 ± 0.29 a	12.68 ± 0.42 b	16.31 ± 0.35 a	0.001
Lipase	15.48 ± 0.4 c	21.99 ± 0.57 b	22.53 ± 0.39 b	24.55 ± 0.89 a	0.001
Protease	15.37 ± 0.64 b	18.68 ± 0.44 a	18.55 ± 0.46 a	18.43 ± 0.68 a	0.009

Values represent the mean ± SE. Superscript letters denote significant differences among treatments based on the Tukey–HSD test (p_adj < 0.05).

displays the impacts of dietary enrichment with silymarin (S), L-carnitine (LC), and their combination (S + LC) on the digestive enzyme activities of O. niloticus. Significant enhancements in enzymatic activity were observed in all treated groups compared to the control. Amylase activity was markedly increased in the S and S + LC groups (15.69 ± 0.29 and 16.31 ± 0.35 U/mg, respectively), both of which were higher (p < 0.05) than the LC group (12.68 ± 0.42 U/mg) and the control (10.54 ± 0.4 U/mg). Similarly, lipase activity was markedly elevated in all supplemented groups. The highest lipase level was recorded in the S + LC group (24.55 ± 0.89 U/mg), followed by LC (22.53 ± 0.39 U/mg) and S (21.99 ± 0.57 U/mg), all significantly higher than the control (15.48 ± 0.4 U/mg). Protease activity also showed significant improvement in the treated groups, with no significant differences among the S (18.68 ± 0.44 U/mg), LC (18.55 ± 0.46 U/mg), and S + LC (18.43 ± 0.68 U/mg) groups, although all were significantly greater than the control (15.37 ± 0.64 U/mg).

3.3. Intestine and Hepatic Histology

Histological test of the intestine in O. niloticus revealed well-preserved intestinal villi supported by the submucosa, with the intestinal wall externally covered by the adventitia. The villi were lined with simple columnar epithelial cells, interspersed with goblet cells (Figure 1). These features appeared largely normal, with only slight epithelial vacuolation observed in the control group (Figure 1A). In groups supplemented with silymarin and/or L-carnitine, the villous structure exhibited notable improvements in both height and morphology (Figure 1B–D).

Table 5. Intestinal morphometry and hepatic histopathological scores of Oreochromis niloticus fed diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC).

Variables	Experimental Groups				p_adj Values
	Control	S	LC	S + LC
Intestinal Morphometry
Villus height (μm)	162.47 ± 2.58 c	236.03 ± 3.85 b	305.07 ± 6.66 a	306.63 ± 15.10 a	0.001
Villus width (μm)	59.34 ± 5.75 c	69.56 ± 7.08 ab	75.02 ± 1.76 ab	85.76 ± 9.81 a	0.120
Crept depth (μm)	18.78 ± 2.79 b	36.33 ± 1.97 a	33.73 ± 3.13 a	32.74 ± 2.26 a	0.005
Muscularis thickness (μm)	19.64 ± 0.89 c	24.98 ± 3.09 ab	28.08 ± 0.45 ab	22.64 ± 0.70 a	0.037
Goblet cells	7.33 ± 1.45 c	17.33 ± 1.20 b	18.00 ± 1.73 b	23.00 ± 1.15 a	0.001
Hepatic Histopathological Scores
Hepatic steatosis score	2.00 ± 0.01 ab	2.67 ± 0.33 a	1.33 ± 0.33 bc	0.67 ± 0.33 c	0.006
Hepatic vacuolation score	2.33 ± 0.33 b	1.67 ± 0.33 a	1.33 ± 0.33 b	0.33 ± 0.33 a	0.017

Values represent the mean ± SE. Superscript letters denote significant differences among treatments based on the Tukey–HSD test (p_adj < 0.05).

demonstrates significant differences in intestinal morphometry of Oreochromis niloticus fed diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC). Villus height, crept depth, and goblet cell numbers were significantly increased in the S + LC group compared to the control, with the highest villus height (306.63 µm) and goblet cell count (23.00 cells) observed in this group (p-values: 0.001 and 0.001, respectively). Muscularis thickness was significantly greater in the LC group (28.08 µm) compared to the control (19.64 µm) (p = 0.037).

The hepatic tissue displayed clearly differentiated hepatic and pancreatic components (Figure 2). Hepatocytes were arranged in cords between blood sinusoids radiating from central veins and appeared as polyhedral cells with centrally located nuclei. The pancreatic region consisted of acinar cell clusters containing basophilic zymogen granules (Figure 2A). In the groups treated with silymarin and/or L-carnitine (Figure 2B–D), the hepatic tissue maintained a well-organized architecture, with no evidence of inflammation or vacuolation, and showed only minimal steatosis, particularly in the group receiving both silymarin and L-carnitine (Figure 2D). Regarding hepatic histopathology (Table 5), the hepatic steatosis score was significantly lower in the S + LC group (0.67) compared to the control (2.00), indicating improved liver health (p = 0.006). Hepatic vacuolation was also significantly reduced in the S + LC group (0.33) compared to the control (2.33) (p = 0.017), highlighting the potential beneficial effects of combined Silymarin and L-carnitine supplementation.

3.4. Blood Composition

Table 6. Blood biochemical parameters of Oreochromis niloticus fed diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC).

Variables	Experimental Groups				p_adj Values
	Control	S	LC	S + LC
Total protein (g/dL)	3.3 ± 0.08 c	4.01 ± 0.05 ab	3.97 ± 0.09 b	4.22 ± 0.05 a	0.001
Albumin (g/dL)	1.27 ± 0.02	1.29 ± 0.06	1.31 ± 0.06	1.29 ± 0.04	0.950
Globulin (g/dL)	2.03 ± 0.08 b	2.72 ± 0.11 a	2.67 ± 0.05 a	2.93 ± 0.05 a	0.001
Glucose (mg/dL)	90.27 ± 1.32 a	84.65 ± 0.84 b	81.05 ± 1.08 c	76.84 ± 0.78 d	0.001
Cortisol (ng/mL)	38.14 ± 0.61 a	31.41 ± 1.18 b	31.02 ± 0.87 bc	28.24 ± 0.82 c	0.001
Total cholesterol (mg/dL)	125.6 ± 3.6 a	117.12 ± 3.21 a	95.94 ± 2.64 b	87.9 ± 3.25 b	0.001
Triglyceride (mg/dL)	113.39 ± 3.05	117.68 ± 2.78	116.65 ± 1.66	117.63 ± 1.79	0.572
ALT (IU/L)	6.15 ± 0.32	6.19 ± 0.16	6.17 ± 0.43	6.19 ± 0.15	1.000
AST (IU/L)	41 ± 2.52	41.67 ± 1.86	42 ± 2.52	42.33 ± 1.67	0.975
Urea (mg/dL)	5.53 ± 0.28	5.3 ± 0.44	5.32 ± 0.43	5.21 ± 0.04	0.921
Creatinine (mg/dL)	0.33 ± 0.03	0.34 ± 0.04	0.34 ± 0.04	0.32 ± 0.03	0.962

ALT: Alanine Aminotransferase; AST: Aspartate Aminotransferase. Values represent the mean ± SE. Superscript letters denote significant differences among treatments based on the Tukey–HSD test (p_adj < 0.05).

presents serum biochemical components of Oreochromis niloticus fed diets enriched with silymarin (S), L-carnitine (LC), or their combination (S + LC) for 84 days. Total protein levels were noticeably elevated in all treated groups compared to the control (p < 0.05), with the highest value recorded in the S + LC group (4.22 ± 0.05 g/dL). Although albumin levels did not differ among groups (p > 0.05), globulin concentrations were significantly increased in all supplemented groups, with the S + LC group showing the highest value (2.93 ± 0.05 g/dL). Blood glucose levels were significantly reduced in treated fish, with the lowest level observed in the S + LC group (76.84 ± 0.78 mg/dL), followed by LC (81.05 ± 1.08 mg/dL) and S (84.65±0.84 mg/dL), compared to the control (90.27 ± 1.32 mg/dL). Similarly, cortisol levels were significantly lower in the S + LC group (28.24 ± 0.82 ng/mL), with intermediate values in the S and LC groups, and the highest level in the control (38.14 ± 0.61 ng/mL). Total cholesterol was also significantly decreased in the LC (95.94 ± 2.64 mg/dL) and S + LC (87.9 ± 3.25 mg/dL) groups compared to the control (125.6 ± 3.6 mg/dL), while no difference (p > 0.05) was noted between the S group and the control. Triglyceride, ALT, AST, urea, and creatinine levels remained statistically unchanged among all groups.

3.5. Immune Responses

Figure 3 illustrates the immune responses of Oreochromis niloticus following 84 days of dietary supplementation with silymarin (S), L-carnitine (LC), or their combination (S + LC). Immunoglobulin M (IgM) levels were markedly elevated in all augmented groups compared to the control, with the S, LC, and S + LC groups showing statistically similar but higher IgM concentrations. Lysozyme activity was markedly increased in all treated groups. The S + LC group displayed the highest lysozyme activity, followed closely by LC and S, all significantly higher than the control group. Similarly, nitroblue tetrazolium (NBT) reduction percentage was significantly enhanced in the treated groups, with the S + LC group showing the greatest response, followed by S and LC, and the control showing the lowest value. Furthermore, serum bactericidal activity against Streptococcus agalactiae was significantly improved in the LC and S + LC groups compared to the control, while the S group showed a moderate but still significant increase. The highest percentage inhibition was recorded in the S + LC group.

3.6. Antioxidant Enzyme Activities

Figure 4 demonstrates the antioxidant enzyme and lipid peroxidation levels in the liver of O. niloticus after 84 days of feeding with diets supplemented with silymarin (S), L-carnitine (LC), or their combination (S + LC). The activities of SOD, CAT, and GPx were significantly enhanced in all treated groups compared to the control, with the most pronounced increases observed in the S + LC group. Specifically, SOD activity reached its highest level in the LC and S + LC groups, significantly exceeding that of the S group and the control. Catalase activity was also elevated (p < 0.05) in the S, LC, and S + LC groups relative to the control, with no significant differences among the supplemented groups. GPx activity showed a clear dose-related increase, with the highest value recorded in the S + LC group, followed by the S and LC groups, all significantly higher than the control. Malondialdehyde (MDA) levels were reduced (p > 0.05) in the LC and S + LC groups. The S group also showed a moderate but significant reduction compared to the control, which exhibited the highest MDA levels.

3.7. Gene Expression

Figure 5 and Figure 6 present the mRNA expression profiles of growth-related, immune, and antioxidant-related genes in the liver of Oreochromis niloticus after 84 days of dietary supplementation with silymarin (S), L-carnitine (LC), or their combination (S + LC). As illustrated in Figure 5, the expression level of IGF-1 was upregulated (p < 0.05) in all supplemented groups compared to the control. The S and S + LC groups showed the highest IGF-1 expression. Similarly, the expression of IFNA-1 was markedly elevated in all treatment groups. The LC group exhibited the highest upregulation, followed by the S + LC and S groups, all significantly higher than the control, indicating an immunostimulatory role of these supplements, particularly LC.

Figure 6 demonstrates the transcriptional responses of key antioxidant-related genes. The expression of SOD, CAT, and Gsr genes was significantly upregulated in all treated groups compared to the control. The S + LC group consistently showed the highest expression across all three genes, followed by the LC and S groups. This suggests that the combined supplementation most effectively enhanced antioxidant gene expression, potentially improving cellular oxidative stress resistance.

4. Discussion

4.1. Growth Performance, Feed Utilization, Survival and Somatic Indices

The present study showed that dietary supplementation with silymarin (S), L-carnitine (LC), and particularly their combination (S + LC) significantly enhanced the growth performance of Oreochromis niloticus over an 84-day feeding trial. The notable improvements in final body weight (FBW), weight gain (WG), and specific growth rate (SGR) observed in the S and S + LC groups, compared to the control, support the hypothesis that these functional additives positively influence metabolic efficiency and somatic growth in Nile tilapia. These findings are consistent with several studies that have demonstrated the growth-promoting potential of plant-derived bioactive compounds, such as silymarin, in aquafeeds [31].

The enhanced growth performance in the silymarin-supplemented group may be attributed to silymarin’s well-documented hepatoprotective and antioxidant activities, which improve nutrient assimilation and liver function [7,9]. Silymarin enhances hepatic detoxification and stabilizes cell membranes, thereby promoting optimal nutrient metabolism and protein synthesis [8]. These effects have likely contributed to the observed increase in body mass and growth rates in the S and S + LC groups. Similar findings were reported by Chaklader, et al. [5], who observed improved growth in Labeo rohita fed silymarin-enriched diets, and by Ahmadi, et al. [32], who documented enhanced growth in Oncorhynchus mykiss.

The role of L-carnitine, although more modest when administered alone, was still evident in the improved FCR compared to the control. L-carnitine is involved in mitochondrial β-oxidation of long-chain fatty acids, facilitating more efficient energy production and protein sparing [14,33]. Its ability to enhance energy availability from lipids likely contributed to better feed utilization efficiency. Nevertheless, the lack of significant increase in WG and FBW in the LC group compared to S and S + LC suggests that L-carnitine’s anabolic effects may be more pronounced when coupled with other bioactives like silymarin, which also reduce oxidative stress and inflammation that could otherwise impede growth [34,35].

The combined supplementation of silymarin and L-carnitine produced more pronounced effects in the S + LC group compared to individual supplementation, which achieved the highest values for WG and SGR. This suggests that the simultaneous enhancement of liver function (via silymarin) and lipid metabolism (via L-carnitine) may complementarily boost nutrient absorption, energy efficiency, and overall somatic growth. These findings are consistent with those reported by Ayyat, et al. [36], who observed enhanced growth performance and feed efficiency in Nile tilapia supplemented with L-carnitine in combination with other metabolic enhancers. Similarly, Shehata, et al. [8] demonstrated that the administration of silymarin alongside other metabolic enhancers produced comparable improvements, suggesting that the combined use of these bioactive compounds is more effective than their individual application.

The FCR was improved in all supplemented groups, with the lowest value observed in the S group (1.49 ± 0.01). This enhancement indicates more efficient feed utilization, likely attributed to improved digestion, nutrient absorption, and metabolic conversion, further corroborated by the elevated digestive enzyme activity discussed later in this study. These findings align with previous reports emphasizing the efficacy of phytogenics and metabolic enhancers in enhancing feed efficiency through gut health modulation and the reduction of oxidative stress [37].

Survival rates remained consistently high across all treatment groups, indicating that the inclusion of silymarin and/or L-carnitine at the tested levels was safe and well tolerated. These findings are consistent with several prior studies that reported no adverse effects of silymarin or L-carnitine supplementation on fish health or survival [5,10,15].

The organosomatic indices HSI, VSI, and ISI showed no statistically significant differences among groups, suggesting that neither silymarin nor L-carnitine supplementation induced undesirable organ hypertrophy or metabolic imbalance. Nevertheless, a slight increase in the ISI in the S group may reflect enhanced intestinal development, potentially linked to improved mucosal health and nutrient absorption capacity. This is supported by previous histological and enzymatic findings showing that silymarin can promote enterocyte integrity and intestinal enzyme activity [38]. Fulton’s condition factor (K) remained statistically unchanged across all treatment groups, indicating that the dietary supplementation with silymarin and/or L-carnitine did not adversely affect the overall body conformation or nutritional status of the fish. This stability in K values suggests that the observed improvements in growth performance were primarily attributable to enhanced nutrient assimilation and metabolic efficiency rather than alterations in somatic conditions. Similar conclusions have been reported in previous reports, where stable condition factor values accompanied improved growth metrics following dietary interventions [8,16].

4.2. Digestive Tract Health: Enzymatic Activity and Histomorphology

The digestive capacity of fish plays a critical role in determining growth performance and feed efficiency. In the present study, the activities of key digestive enzymes amylase, lipase, and protease were significantly enhanced in Nile tilapia (O. niloticus) fed diets supplemented with S, LC, and their combination (S + LC), with the S + LC group exhibiting the most consistent improvements across all enzyme types. These enhancements in enzymatic function were paralleled by notable histomorphological improvements in the intestinal and hepatic tissues. The observed elevation in amylase activity, particularly in the S and S + LC groups, suggests that silymarin significantly stimulates carbohydrate digestion. This aligns with previous findings by Citarasu [37] and Chakraborty, et al. [31], who reported enhanced amylase secretion in fish fed phytogenic compounds, attributed to improved gut epithelial health and enzymatic stimulation by flavonoids and phenolic compounds. Flavonolignans in Silybum marianum, especially silybin, are known to stimulate hepatic and intestinal secretory function [39], potentially explaining the improved enzymatic profiles.

The significant increases in lipase activity in all treated groups, particularly the S + LC group, reflect an enhanced capacity for lipid digestion. This is not surprising considering L-carnitine’s primary role in mitochondrial fatty acid transport and β-oxidation [13,33]. The presence of L-carnitine may upregulate lipid metabolism, thereby promoting a positive feedback loop that increases intestinal lipase production to meet energy demands [17]. Silymarin, as an antioxidant and hepatoprotectant, may also support lipid digestion by maintaining pancreatic and intestinal integrity [11].

The uniform elevation in protease activity observed across all supplemented groups suggests enhanced protein hydrolysis, which is likely to contribute directly to improved tissue accretion and feed conversion efficiency. Although the differences in protease activity among the S, LC, and S + LC groups were not statistically significant, each group exhibited higher activity levels compared to the control, indicating that both silymarin and L-carnitine positively influence proteolytic function. These findings are consistent with previous research demonstrating that phytogenic compounds and metabolic enhancers can stimulate digestive enzyme activity by promoting intestinal integrity, preserving the gut epithelium, and enhancing mucosal cell renewal [37].

Histological analysis of the intestinal tissue further supports the biochemical findings [40]. Fish from all treated groups showed improved villous architecture, including increased villus height and better organization of columnar epithelial cells. Goblet cells, essential for mucin production and gut protection, were well distributed and intact. These morphological improvements are crucial, as enhanced villus structure is associated with greater absorptive surface area and improved nutrient uptake [5,10]. Slight epithelial vacuolation was observed only in the control group, suggesting a mild level of cellular stress or degeneration in the absence of supplementation. In contrast, the enhanced villi in the supplemented groups may result from silymarin’s anti-inflammatory and cytoprotective effects on intestinal tissues [41]. In addition, L-carnitine has been shown to improve gut integrity and reduce oxidative stress in intestinal epithelial cells, thereby preserving histological structure [17,35,42].

The liver and hepatopancreatic tissues of the supplemented groups exhibited well-preserved histoarchitecture, characterized by clearly defined hepatic cords and morphologically intact hepatocytes, with no evidence of pathological alterations [43]. Minimal hepatic steatosis was observed only in the S + LC group, indicating robust hepatocellular protection under the combined supplementation regimen. These observations align with the well-documented hepatoprotective properties of silymarin, which include stabilization of cellular membranes, inhibition of lipid peroxidation, and enhancement of endogenous antioxidant enzyme activity [10,41]. Furthermore, L-carnitine has also been shown to support hepatic function through similar mechanisms, contributing to membrane stabilization, attenuation of oxidative stress, and improved mitochondrial efficiency [14].

The pancreatic component also appeared healthy, with visible acinar cell clusters rich in zymogen granules, indicating an active digestive secretory function. This observation supports the enzymatic findings and further suggests that dietary supplementation enhanced both exocrine (digestive enzyme) and endocrine (metabolic) function in the liver–pancreas axis. Taken together, the observed enhancement in digestive enzyme activity and the histological integrity of the intestinal and hepatic tissues indicate that dietary supplementation with silymarin, L-carnitine, and especially their combination significantly improved the digestive health of Nile tilapia. The biochemical improvements were reinforced by histological evidence, suggesting a complementary interaction between the hepatoprotective and metabolic roles of silymarin and L-carnitine. These findings provide a strong rationale for the inclusion of these additives in functional aquafeeds to promote digestive efficiency, nutrient absorption, and tissue health under intensive culture conditions.

4.3. Blood Biochemical Profile

Blood biochemical parameters serve as reliable indicators of the physiological condition, nutritional status, stress response, and immune competence in fish. In the present study, dietary supplementation with S, LC, and their combination (S + LC) significantly modulated several key blood constituents in Oreochromis niloticus after 84 days, demonstrating the systemic benefits of these bioactive compounds. A notable increase in total protein concentrations was observed in all treated groups, with the S + LC group exhibiting the highest levels. This elevation reflects improved hepatic protein synthesis and suggests a positive influence on immune preparedness. These results are in agreement with earlier studies indicating that phytogenic feed additives such as silymarin stimulate hepatic ribosomal activity, DNA synthesis, and protein metabolism, ultimately boosting serum protein content [32]. The additive or complementary effects observed in the S + LC group may be attributed to improved nutrient absorption and metabolic utilization facilitated by both additives.

While albumin levels remained unchanged across treatments, globulin levels increased significantly in all supplemented groups, with the highest value again in the S + LC group. Since globulins play an essential role in immune defense, particularly as precursors to immunoglobulins, their elevation suggests enhanced humoral immunity [8]. These findings reinforce the immunostimulatory potential of silymarin and L-carnitine, which may support enhanced lymphoid organ function and protein synthesis. Concomitant with improved protein status, all supplemented groups showed significant reductions in serum glucose and cortisol, key biomarkers of stress in teleosts [14,39]. The lowest glucose level was recorded in the S + LC group, suggesting enhanced glucose utilization and improved energy regulation. This hypoglycemic effect is likely related to reduced gluconeogenesis and increased cellular uptake of glucose, possibly mediated by improved hepatic and mitochondrial function [36]. The marked decrease in cortisol, particularly in the S + LC group, confirms an attenuation of the physiological stress response. This may be attributed to the combined antioxidative and anti-inflammatory properties of silymarin and the mitochondrial protective role of L-carnitine [6,35]. Such modulation of the hypothalamic–pituitary–interrenal (HPI) axis could enhance stress tolerance, especially under intensive aquaculture conditions.

In terms of lipid metabolism, a significant reduction in serum cholesterol was observed in the LC and S + LC groups, with the lowest concentration recorded in the latter. This finding supports previous research demonstrating that L-carnitine promotes lipid mobilization and oxidation by facilitating the mitochondrial transport of long-chain fatty acids [34]. The cholesterol-lowering effect may also involve enhanced hepatic clearance of lipoproteins or inhibition of endogenous cholesterol biosynthesis. Triglyceride levels did not differ significantly among groups, suggesting that the lipid-lowering effect of L-carnitine is more specific to cholesterol pathways. Silymarin supplementation alone did not significantly alter cholesterol or triglyceride levels, a result consistent with variable effects reported in the literature, depending on dietary lipid content and fish species [5,39].

The liver enzymes ALT (alanine aminotransferase) and AST (aspartate aminotransferase) used to assess hepatocellular integrity did not show significant differences between treatments [44]. The numerically lower values observed in the S and S + LC groups may suggest a trend toward hepatoprotection. This is supported by silymarin’s ability to stabilize cellular membranes and reduce lipid peroxidation, thereby limiting the leakage of transaminases into the bloodstream [7,11]. These results imply a potential protective effect of silymarin on liver tissue, even under unstressed conditions. Additionally, no significant differences were observed in serum urea and creatinine levels across all groups, indicating that neither silymarin nor L-carnitine adversely affected renal function at the inclusion levels used. This supports previous findings suggesting these additives are safe and do not impair nitrogen excretion or glomerular function [6,8,14]. The maintenance of normal renal indicators also reinforces the overall physiological safety and tolerability of the tested diets.

Collectively, the results from the blood biochemical analysis reinforce the beneficial effects of dietary S and LC individually and in combination on the metabolic health, immune competence, and stress mitigation in Nile tilapia. The combination of both additives (S + LC) was particularly effective, indicating complementary interactions that optimized protein metabolism, stabilized glucose and cortisol levels, and improved cholesterol handling without compromising hepatic or renal function. These findings further highlight the potential of S and LC as functional feed additives in promoting systemic resilience and metabolic balance in intensively farmed fish.

4.4. Immune Responses

The innate immune system is the fundamental defense mechanism in fish, acting rapidly and non-specifically against pathogens. This is especially important in intensive aquaculture systems where fish are regularly exposed to environmental, nutritional, and handling stressors [45]. In the current study, dietary supplementation with S, LC, and their combination (S + LC) significantly enhanced several innate immune parameters in Oreochromis niloticus, including serum immunoglobulin M (IgM) levels, lysozyme activity, respiratory burst activity (NBT%), and bactericidal activity. These results clearly indicate that both supplements, particularly when combined, modulate and strengthen the fish’s immune response.

Serum IgM concentration, a key marker of humoral immunity, was elevated in all treated groups compared to the control. IgM is the first antibody produced during immune activation and plays a crucial role in pathogen neutralization and opsonization. The increase in IgM levels suggests that both silymarin and L-carnitine enhance humoral immunity, possibly by stimulating lymphocyte proliferation and antibody synthesis [20,39]. Although there were no significant differences among the treated groups, the consistent elevation in IgM reinforces the immunopotentiating potential of both compounds. Silymarin’s effect may be attributed to its flavonolignan content, particularly silybin, known to stimulate cytokine production and lymphoid activity [5,8,10], while L-carnitine contributes through improved mitochondrial function and energy availability in immune cells [42,46].

Lysozyme activity, an essential component of the non-specific immune system [47], was also elevated in all enhanced groups, with the highest values recorded in the S + LC group. Lysozyme functions by breaking down the peptidoglycan layer of bacterial cell walls, providing a rapid defense against Gram-positive and Gram-negative bacteria [48]. The enhanced lysozyme activity observed is likely due to improved immunometabolic and redox conditions facilitated by both additives. L-carnitine’s role in enhancing immune cell energy metabolism [42] Silymarin’s antioxidant effects may contribute to preserving the functionality and activity of immune cells under stress [49].

The respiratory burst activity, measured via the NBT assay, reflects the ability of phagocytes to produce reactive oxygen species (ROS) to kill invading microbes. All treated groups showed significantly elevated NBT activity, with the S + LC group again showing the strongest response. This suggests that dietary silymarin and L-carnitine enhance the oxidative killing potential of neutrophils and macrophages. Importantly, the antioxidants provided by these additives appear to balance ROS production by phagocytes while preventing oxidative damage to host tissues [9,14].

Further supporting these immunological findings, bactericidal activity against Streptococcus agalactiae was significantly improved in the LC and S + LC groups, with the highest inhibition observed in the combined treatment. Although the S group also demonstrated increased activity compared to the control, its effect was less pronounced. The enhanced bactericidal capacity likely results from the combined actions of elevated lysozyme, IgM, and oxidative mechanisms that contribute to pathogen neutralization. L-carnitine’s role in upregulating macrophage and neutrophil responses, along with its anti-inflammatory properties, appears particularly effective in enhancing host defense [50].

Taken together, the consistently improved immune parameters in the S + LC group indicate additive interactions between the two additives. These combined effects likely arises from several complementary mechanisms, enhanced antioxidant defenses that preserve immune cell integrity and reduce damage from excessive ROS [6,11,14] or improved metabolic support, especially mitochondrial function, which provides energy necessary for the activation and proliferation of immune cells [33], or Upregulation of immune-related genes, such as IFN-1, as indicated in the Section 4.6, further reflecting a coordinated immunomodulatory effect at both the cellular and molecular levels.

These findings align with previous reports emphasizing the role of herbal extracts and metabolic enhancers as viable alternatives to antibiotics or synthetic immunostimulants in aquaculture [51]. The ability of silymarin and L-carnitine to safely and effectively enhance innate immunity underscores their potential as functional additives in sustainable fish health management. Dietary inclusion of S and LC, both individually and in combination, significantly enhanced humoral and cellular immune responses in Oreochromis niloticus, as evidenced by elevated IgM levels, lysozyme activity, respiratory burst, and serum bactericidal capacity. The S + LC group consistently outperformed the individual treatments, suggesting an additive effect that amplifies innate immunity. These results demonstrate the potential of these natural compounds to fortify immune defenses, reduce disease susceptibility, and support sustainable fish health management in intensive aquaculture systems.

4.5. Antioxidant Enzyme Activities and Lipid Peroxidation

The antioxidant defense system is key for maintaining cellular homeostasis in fish by neutralizing reactive oxygen species (ROS) produced during metabolism and environmental stress [52]. In this study, dietary supplementation with S, LC, and their combination (S + LC) significantly enhanced hepatic antioxidant enzyme activities SOD, CAT, and GPx and reduced MDA levels, a key biomarker of lipid peroxidation, in Oreochromis niloticus. These findings demonstrate the protective effects of both supplements and reveal a particularly strong additive response when used in combination. SOD activity was significantly elevated in the LC and S + LC groups, confirming L-carnitine’s capacity to stimulate mitochondrial function and upregulate antioxidant defenses. These results are supported by prior studies in which L-carnitine enhanced mitochondrial efficiency, reduced ROS leakage, and activated antioxidant enzyme expression [34,35,36]. Silymarin also improved SOD activity, albeit to a lesser extent, likely due to its flavonolignan components, especially silybin, which scavenge free radicals and activate Nrf2-related transcription of antioxidant genes [5,7,8]. Notably, the S + LC group exhibited the highest SOD activity, suggesting complementary interactions between mitochondrial-targeted and cytosolic antioxidant pathways.

CAT activity was enhanced in all treated groups compared to the control, with no significant changes among the supplement types. CAT plays a pivotal role in converting hydrogen peroxide into water and oxygen, thus acting downstream of SOD. The increase in CAT activity may reflect silymarin’s role in preserving enzyme structure and preventing oxidative degradation [7,8,39] as well as L-carnitine’s ability to limit ROS production at the mitochondrial level [46]. These findings suggest that both supplements contribute independently to hydrogen peroxide detoxification and support hepatic antioxidant resilience. GPx activity, a critical component of the glutathione system, was also significantly elevated in all supplemented groups, with the S + LC group again exhibiting the highest response. GPx detoxifies lipid hydroperoxides and hydrogen peroxide using glutathione, and its activity often correlates with cellular protection from oxidative membrane damage. The observed enhancement aligns with earlier studies showing that silymarin and L-carnitine, individually and in combination, enhance GPx activity in various aquatic species [5,10,36,53]. Furthermore, gene expression analysis (Section 3.7) revealed that hepatic GPx mRNA was significantly upregulated in the S + LC group, indicating transcriptional activation in parallel with enzymatic enhancement. This supports the conclusion that these supplements induce both biochemical and molecular improvements in antioxidant defense.

MDA levels, which reflect lipid peroxidation and cellular membrane damage, were reduced in the LC and S + LC groups, with the S group also showing a moderate but significant decrease. These reductions provide functional evidence that the elevated antioxidant enzyme activities translated into better oxidative stress control. Silymarin’s membrane-stabilizing and radical-scavenging properties [11] and L-carnitine’s capacity to mitigate mitochondrial ROS production [35] likely contributed to this outcome. The integrated antioxidant response observed in the S + LC group, marked by maximal activities of SOD, CAT, and GPx, alongside the lowest MDA levels, highlights the additive potential of combining S and LC. These compounds appear to target distinct but complementary antioxidant pathways: LC enhances mitochondrial metabolism and reduces ROS generation at the source, and S modulates cytosolic antioxidant gene expression and protects cellular membranes [7,39]. This dual-action mechanism may be especially beneficial in counteracting the oxidative stress commonly experienced in intensive aquaculture systems. Collectively, dietary supplementation with S and LC significantly improved the antioxidant status of Nile tilapia by upregulating key hepatic antioxidant enzymes (SOD, CAT, GPx) and reducing lipid peroxidation (MDA). The most pronounced effect was observed in the combination group (S + LC), highlighting a complementary interaction between these compounds in enhancing oxidative defense mechanisms. These results emphasize the potential of incorporating natural antioxidant agents in aquafeeds to improve cellular resilience and systemic health in farmed fish.

4.6. Gene Expression Analysis

Gene expression profiling provides a molecular understanding of how functional feed additives modulate physiological processes such as growth, immunity, and oxidative stress regulation in aquatic animals [54]. In this study, dietary supplementation with S, LC, or their combination (S + LC) significantly upregulated hepatic mRNA expression levels of growth-related (IGF-1), immune-related (IFNA-1), and antioxidant-related genes (SOD, CAT, Gsr) in Oreochromis niloticus. These transcriptional responses support the observed increases in growth performance, immune function, and antioxidant capacity, and reveal the systemic influence of these nutraceuticals at the genetic level.

IGF-1 expression was enhanced in all treated groups, with the most pronounced upregulation observed in the S and S + LC groups. IGF-1 is a key mediator of growth hormone signaling and plays a central role in promoting somatic growth by stimulating muscle cell proliferation, differentiation, and protein synthesis in teleosts [55]. The elevated IGF-1 levels observed in silymarin-supplemented fish may be attributed to its hepatoprotective effects, improved nutrient absorption, and enhanced hepatic metabolic function [39]. Notably, the highest IGF-1 expression in the S + LC group suggests additive interactions, whereby silymarin’s metabolic enhancement is complemented by L-carnitine’s role in supporting mitochondrial ATP production and growth-related anabolic pathways [33]. IFNA-1 (Interferon type I), a pivotal cytokine in the innate immune response and antiviral defense, was upregulated in all enriched groups, with the highest expression observed in the LC group. This highlights L-carnitine’s capacity to stimulate cellular immunity, possibly through modulation of mitochondrial metabolism and cytokine gene regulation in leukocytes [34,35]. Silymarin also induced IFNA-1 expression, though to a lesser extent, likely due to its immunomodulatory and anti-inflammatory properties [5,32]. The S + LC group showed further enhancement in IFNA-1 expression, indicating that the combination of both supplements can more effectively activate immune-related gene transcription and may improve resistance to infections.

The antioxidant defense genes SOD, CAT, and Gsr were upregulated in all treated groups, aligning with the observed biochemical improvements in enzymatic antioxidant activity. These genes encode critical components of the cellular antioxidant machinery that neutralize ROS and protect against oxidative damage [56]. The S + LC group exhibited the highest expression across all three genes, suggesting a complementary enhancement of antioxidant gene networks. Silymarin’s contribution to this upregulation is likely mediated through activation of the Nrf2 signaling pathway, a key regulator of antioxidant gene transcription [53]. L-carnitine, on the other hand, may improve mitochondrial efficiency and reduce intracellular oxidative load, thereby triggering a compensatory upregulation of antioxidant genes [14]. The coordinated increase in SOD, CAT, and GSR mRNA expression supports the idea that both additives function not only as direct antioxidants but also as nutrigenomic modulators of cellular redox balance.

These findings are consistent with earlier research demonstrating that dietary phytogenics and metabolic enhancers can activate antioxidant genes and reduce oxidative stress in fish. For example, Xiao et al. [39] reported similar gene expression responses in fish species supplemented with silymarin and other bioactive compounds. The present results confirm and extend these findings by demonstrating that combined supplementation offers superior benefits over individual treatments, particularly in terms of transcriptional activation of antioxidant and immune-related pathways. Overall, the gene expression data support the biochemical and physiological evidence that S and LC enhance growth, immune function, and oxidative stress resilience in O. niloticus. The most pronounced transcriptional responses were observed in the S + LC group, indicating that co-supplementation exerts complementary effects on the regulation of growth-promoting, immune-modulating, and antioxidant defense genes. These results reinforce the potential of using these natural additives as functional tools in precision aquaculture to promote fish health at both cellular and molecular levels.

5. Conclusions

In conclusion, the present study indicates that dietary supplementation with si-lymarin and L-carnitine, either individually or in combination, influenced several physiological and biochemical responses in Oreochromis niloticus. The combined supplementation (425 mg/kg silymarin + 250 mg/kg L-carnitine) produced the most consistent improvements in growth performance, antioxidant enzyme activities (SOD, CAT, GPx), immune responses (lysozyme, IgM, NBT%, bactericidal activity), and gene expression related to growth (IGF-1), immunity (IFNA-1), and oxidative stress (SOD, CAT, Gsr).

These outcomes suggest that silymarin and L-carnitine supplementation may contribute to improved fish health and performance under intensive aquaculture conditions. The use of such natural bioactive compounds could represent a supportive nutritional approach to enhancing fish resilience and welfare. Nevertheless, further research under commercial production systems is recommended to confirm these effects, determine optimal inclusion levels, and evaluate their long-term impacts on product quality and economic feasibility.