Generating Novel Tomato Germplasm Using the Ancestral Wild Relative of Solanum pimpinellifolium

Abstract

To create novel tomato (Solanum lycopersicum) germplasm, a wild tomato relative, S. pimpinellifolium (a red-fruited LA1585 accession), was used as the male parent to cross with the yellow-fruited tomato mutant, e9292 (S. lycopersicum). Forty-four morphological characteristics were examined in the present study; 22 S. pimpinellifolium (LA1585) traits and six S. lycopersicum (e9292) traits were dominant in the hybrids (first generation, F₁); 10 were intermediate types, and the remaining six resulted in a nonmorphological difference. Ten representative lines were chosen from 1338 line of the second generation of the hybrid (e9292 × LA1585). The ascorbic acid content was higher in three F₂ hybrids than in LA1585, which had higher parental levels, as well as the lycopene content in two of the hybrid lines. The fructose and glucose contents were higher in five F₂ hybrids compared to e9292, and the sugar/acid value was higher in three hybrid lines. The broad-sense heritability values ranged from 75.06% for total soluble solids to 99.92% for ascorbic acid, and the average value was 92.66% for 15 quality traits. When seedlings were exposed to NaCl and mannitol, the tolerance of high salt concentrations and drought was enhanced in two hybrid lines (F₂-266 and F₂-299) compared with else tomatoes (e9292, LA1585, F₁ hybrids, and F₂-332). We created novel tomato germplasm resources with horticulturally desirable quality traits and abiotic stress tolerance, thus offering a methodology for novel tomato germplasm creation and evaluation.

1. Introduction

Tomato (Solanum lycopersicum) is an economically important crop, reflecting its horticultural significance, value to human health as a dietary component, and potential as a model plant targeted for scientific research [1,2,3,4]. According to the FAO (Food and Agriculture Organization), tomato production reached 186.82 million tons, worth USD 92.83 billion, in 2020 (http://www.fao.org/faostat/en/#data/QV (accessed on 1 September 2022)). Tomato is used as a model in several scientific disciplines such as genetics, developmental biology, and molecular biology, especially with regard to studies on the regulation of ethylene signaling transduction in fruits that exhibit climacteric ripening [5,6,7]. Tomato fruit contains a spectrum of nutrients that are beneficial for human health, such as ascorbic acid, amino acids, minerals, and carotenoid pigments. Carotenoids in particular serve as antioxidants that protect against certain degenerative diseases, such as macular degeneration of the eye, a leading cause of age-related blindness, as well as cardiovascular and cerebrovascular diseases, and cancers, such as prostate cancer [8,9,10,11].

To date, tomato production has met worldwide consumer demand largely through breeding-driven improvements in yield, shelf-life, and tolerance to biotic and abiotic stresses [12,13,14,15,16,17,18]. However, it is more difficult to satisfy consumer demand related to tomato quality, as this involves diverse traits, including taste, aroma, and flavor associated with sugars, organic acids, volatile substance, and secondary metabolites. The quality improvement of the cultivated tomato has been limited by germplasm diversity, which declined during domestication and dispersal from the New World to the Old World, as well as during modern breeding over the last 100 years [19]. Wild tomato relatives show ample genetic diversity and have the potential to improve tomato quality [20,21,22], although there are limitations due to reproductive barriers in interspecific hybridizations, hybrid progeny with severe separation, and linkage drag [23,24]. In contrast to other wild tomato relatives, S. pimpinellifolium is the wild progenitor of the cultivated tomato; it inhabits the coastal regions of Ecuador, Peru, and northern Chile, and it is fully cross-compatible with cultivated tomato (S. lycopersicum) [25]. As an immediate ancestor species, S. pimpinellifolium was successively domesticated in S. lycopersicum var. cerasiforme and is a cultivated tomato in the Andean region and Mesoamerica [25]. Furthermore, S. pimpinellifolium is also regarded as a largely unexploited genetic reservoir for tomato improvement. Pseudomonas syringae pv. tomato (Pto) was the first resistance (R) gene isolated from S. pimpinellifolium using a map-based cloning technique in tomato clade, and it has been introgressed into cultivated tomatoes to protect against tomato bacterial speck [26,27,28]. Later, an encoding coiled-coil nucleotide-binding leucine-rich repeat (CC-NBS-LRR) protein Ph-3 gene was isolated from S. pimpinellifolium, conferring resistance to Phytophthora infestans in tomato [29]. The genomic data revealed that S. pimpinellifolium has the potential to improve the tolerance of the cultivated tomato to abiotic or biotic stresses such as diseases and salinity, as well as important quality traits such as lycopene accumulation and flavonoid biosynthesis [29,30,31,32,33]. Therefore, S. pimpinellifolium has been frequently used as an important germplasm donor in modern tomato breeding. Several important genes associated with fruit quality and resistance to abiotic or biotic stresses in S. pimpinellifolium have been identified or predicted by genomic sequencing for introduction into cultivars. However, the inadequate development of elite germplasms has limited the improvement of cultivated tomato using S. pimpinellifolium. In particular, S. pimpinellifolium has the potential to improve tomato qualities such as the contents of carotenoids, total soluble solids, and ascorbic acid [34,35,36,37]. These characteristics can provide a valuable germplasm to satisfy the demand from both breeders and consumers for tomato quality improvement. To create a new interspecies germplasm resource, the red-fruited accession of S. pimpinellifolium LA1585 was used as the male parent, while the yft3 (yellow-fruited tomato 3, e9292) mutant, generated via ethyl methane sulfonate (EMS) treatment of S. lycopersicum M82 seeds, served as the female parent in a cross to produce a first generation (F₁, yft3 × LA1585) population. The yellow-fruited yft3 has the phenotype of lycopene accumulation deficiency, which allows easy distinction from its wild relative LA1585 based on lycopene accumulation. Individuals of the F₁ population were used to generate an F₂ segregating population through self-pollination. The phenotype, quality traits, and abiotic stress tolerance of the F₂ lines were analyzed and compared among the three different generations (parental, F₁, and F₂ lines), with a focus on the carotenoid content and the expression of key genes potentially involved in quality traits.

2. Materials and Methods

2.1. Creation of an Interspecific Cross Population

The red-fruited S. pimpinellifolium accession LA1585 was used as the male parent, in a cross with the e9292 mutant (yellow-fruited tomato 3, yft3) as the female parent, which was derived from EMS mutagenesis of S. lycopersicum M82 [38]. LA1585 and yft3 were provided by Professor Roger T. Chetelat (Tomato Genetics Resource Center, University of California, Davis) and Professor Dani Zamir (Hebrew University of Jerusalem, http://zamir.sgn.cornell.edu/mutants (accessed on 1 September 2022)), respectively. One day before anthesis, yft3 flower buds were emasculated and then pollinated on the same day using LA1585 pollen. F₁ generation (yft3 × LA1585) seeds were collected from ripe fruit derived from the manually pollinated flowers, sown and grown in a greenhouse, and the resulting plants were self-pollinated to produce the population of the F₂ generation (total 1338 lines). All F₂ seeds were sown, and the resulting plants were grown in a greenhouse; then, five representatives each of yellow- or red-fruited plants were selected, and the associated seeds were sown and grown in a greenhouse to generate ten F₃ populations, which were then used to assess the phenotypes.

2.2. Growth Conditions and Identification of Hybridization Attributes

Tomato seeds from 13 genotypes, i.e., e9292, LA1585, F₁ (e9292 × LA1585), and ten F₂ lines (e9292 × LA1585, five yellow and five red-fruited), were stirred in water that was initially 50 °C and then left until room temperature was reached, before germinating in a constant-temperature and -humidity incubator (Tencheng Laboratory Instrument Co., Ltd., Shanghai, China) in the dark at 25 °C. The germinated seeds were sown in plastic plug flats with 60 cells (Qihang Horticultural Experimental Farm, Shanghai, China) and moist seedling soil (Pinshi Tuopu Horticultural nurseries Co., Ltd., Suqian, China). The seedlings were grown in a helio-greenhouse at the Shanghai Jiao Tong University experimental farm at Pujiang (121°30′10.89” E, 31°3′5.20” N, altitude 5 m) until they had 4–5 true leaves and were then transplanted to the field and cultivated using standard field management practices.

On the basis of the TOMATO-EXPEN 2000 (https://solgenomics.net/ (accessed on 1 September 2022)) tomato genomic resource database, the TG294 DNA sequence located on chromosome 8 was chosen to design a CAPS (cleaved amplified polymorphic sequence) marker. Tomato leaf genomic DNA was extracted as described [39], and two specific primers, TG294F (5′−attggctgcaatgatggatt−3′) and TG294R (5′−ctaagcaggacggccatcta−3′), were used for PCR amplification. The sequencing results of the PCR products allowed for the design of restriction endonuclease sites, such as XmnI. Electrophoretic separation of the enzymatically digested PCR products was used to identify parents and hybridization properties of different e9292 × LA1585 generations.

2.3. Phenotypes and Heritability

The morphological phenotypes, including 19 qualitative and 25 quantitative traits, were investigated and measured at the RR/YR (red/yellow ripening) stage of the first fruit from the second truss of 13 genotypes, i.e., e9292, LA1585, F₁, and 10 F₂ generation lines, as previously described [40]. Ten biological replicates were used for the examinations. The broad-sense heritability (hB) and coefficient of variation (Cv) for key morphological phenotypes were calculated using the SPSS (Statistical Product and Service Solutions) software package (Chicago, IL, USA), according to Equations (1) and (4). As a function of the morphological phenotypes, a heatmap based on a cluster analysis was drawn using the heatmap.2 function in the gplots (R 3.2.2 version) software package (http://mirror.bjtu.edu.cn/cran/ (accessed on 1 September 2022) and help file http://docs.ggplot2.org/current/index.html (accessed on 1 September 2022)).

$$h{B}^2=\frac{Vg}{Vg+Ve}\times 100\%,$$

(1)

$$Vg=\frac{MSg-MSe}{n0},$$

(2)

$$n0=\frac{Total number of observations }{The number of materials },$$

(3)

where MSg is the mean squares between groups, MSe is the mean squares within a group, n₀ is the replication number of effective observations, Vg is the genetic variance, and Ve = MSe is the environmental variance.

$$Cv=\frac{\mathsf{\sigma }}{ \mathsf{\mu }}\times 100\%,$$

(4)

where C_v is the coefficient of variation, σ is the standard error of the mean, and μ is the average value.

2.4. Quality Traits

Tomato fruit pericarp was sampled at RR/YR (red/yellow ripening). The ascorbic acid (vitamin C, Vc) content of tomato fruit was determined using the 2, 6-dichloroindo-phenol titration method [41]. The total soluble solid (TSS) content was measured using a portable refractometer (PAL-1, ATAGO, Japan). Tomato fruit firmness (TFF) was examined using a texture analyzer (model TA.XT Plus, SMSTA, UK) fitted with a 6 mm cylindrical plunger (model SMS P/5). Each tomato fruit was examined at five points: the top, the pedicle, and three points with 120° intervals around the equatorial zone (n = 5). Each measuring point was compressed to 11 mm at a speed of 100 mm/min with a trigger force of 0.3 N. The firmness value was determined as the maximum force developed during the test. The carotenoid content was determined using HPLC (high-performance liquid chromatography) as described in [42]. Lastly, the contents of sugars, such as glucose, fructose, and sucrose, and organic acids, including citric acid, malic acid, quininic acid, and succinic acid, were determined using GC–TOF-MS (gas chromatography/time-of-flight mass spectrometry) as described in [43]. Three biological replicates were used for those experiments, except for TSS, where five biological replicates were used.

2.5. Expression of Genes Involved in Carotenoid Synthesis

Total RNA was extracted from ripening equatorial zone pericarp (breaker stage, BR) of e9292, LA1585, F₁ (e9292 × LA1585), and F₂ (e9292 × LA1585) using a plant RNA extraction kit (Tiangen Bio-technology Co., Ltd., Beijing, China) in three biological replicates. In total, 1 μg of RNA was used to synthesize complementary DNA (cDNA) using 5× PrimeScript RT Master Mix (TAKARA, Dalian, China), and a 50-fold dilution of the reverse transcription product was used as the template to conduct real-time (RT) quantitative (q)PCR analysis. According to the method described [42], the expression of genes involved in carotenoid synthesis (CRTISO (CAROTENOID ISOMERASE), CYCB (LYCOPENE β-CYCLASE), DXR (1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE), DXS (1-DEOXY-D-XYLULOSE 5-PHOSPHATE SYNTHASE), HDR (4-HYDROXY-3-METHYLBUT-2-ENYL DIPHOSPHATE REDUCTASE), IDI1 (ISOPENTENYL DIPHOSPHATE Δ-ISOMERASE 1), LCYE (LYCOPENE Ε-CYCLASE), and PSY1 (PHYTOENE SYNTHASE 1)) was analyzed using ACTIN (GenBank accession: BT013524) as the endogenous reference gene. All primers are listed in Table S1.

2.6. Response to Drought and Salt Stresses

Seeds collected from six tomato genotypes, i.e., e9292, LA1585, F₁, F₂-266, F₂-299, and F₂-332, were sterilized by immersion in 75% ethanol (v/v) for 1 min and then 20% bleach (sodium hypochlorite, w/v) for 10 min, before rinsing five times with ddH₂O to remove trace sodium hypochlorite. Seeds were then placed on moist sterile 3 M filter paper overlaying MS solid medium (4.41 g/L MS, 30% sucrose, and 0.26% Phytagel, pH = 5.8) for germination. Germinated seeds with a similar appearance were placed in square petri dishes with MS solid medium, containing different mannitol (0 mM, 50 mM, 100 mM, and 150 mM) and NaCl (0 mM, 50 mM, 100 mM, and 150 mM) concentrations. Five biological replicates were analyzed. The square petri dishes were placed vertically in an illuminating incubator (16 h light/8 h dark) at 25 °C, and the lengths of the hypocotyls and roots were measured using ImageJ software at the same timepoint for six consecutive days. Images were taken using a Cannon EOS 800D (Canon, Japan) camera.

3. Results

3.1. Identification of Hybridization between e9292 and LA1585

The female parent (yellow-fruited tomato mutant e9292) and male parent (red-fruited LA1585) produced a red-fruited F₁ (e9292 × LA1585) generation, while there was color segregation in the F₂ generation (Figure 1a). To identify the nature of the interspecific hybrids between e9292 and LA1585, a CAPS marker was designed corresponding to the TG294 DNA segment on chromosome 8. The resulting PCR products exhibited a single-nucleotide polymorphism (SNP) between e9292 (G) and LA1585 (C) when amplified using the TG294F and TG294R primer set (Figure 1b), and distinct e9292 and LA1585 bands were produced when the PCR product was digested by XmnI (Figure 1c). This CPAS maker was competent to distinguish all interspecific hybrids of both F₁ and F₂ and confirmed their hybrid nature.

3.2. Genetic Analysis of Phenotypes

After assessing 44 phenotypes/morphological traits in different genetic backgrounds (e9292, LA1585, F₁, and 10 F₂ lines (F₂-253, F₂-259, F₂-266, F₂-280, F₂-292, F₂-299, F₂-318, F₂-328, F₂-330, and F₂-332)), we found that 38 phenotypes presented a morphological difference, while the remaining six phenotypes (leaf color, leaf vein color, inflorescence type, flower cluster, corolla color, and pedicel abscission layer) did not. Twenty-two out of the 38 morphological traits in S. pimpinellifolium (LA1585) were dominant in the hybrids: plant type, growth type, leaf attitude, style type, pubescence on fruit surface, fruit apex shape, flesh color, fruit color, fruit shape, fruit surface furrow, plant height, leaf length, leaf width, anther number, anther length, petal number, calyx number, calyx length, fruit shape index, locule number, seed length, and seed thickness. Six phenotypic traits of S. lycopersicum (e9292) were dominant in the hybrids: leaf shape, number of leaves under the first inflorescence, number of leaves under the second inflorescence, petal length, flower number in single inflorescences, and pedicel length from the abscission layer. The remaining 10 phenotypes were intermediate between e9292 and LA1585: leaf division, glandular hairs on the leaf/steam, stem diameter, style length, fruit weight, pericarp thickness, fruit longitudinal diameter, fruit transverse diameter, seed width, and 1000-seed weight. Lastly, we found four phenotypes with traits superior to the parent with the highest/best trait values (plant height, number of leaves under the first inflorescence, number of leaves under the second inflorescence node, and pedicel length from the abscission layer) and five phenotypes with lower values than the parent with the lowest values (leaf length, average flower number per inflorescence, anther length, petal length, and seed length) in the present evaluation (Tables S2 and S3). Details of the different categories are given in the table legends. These results showed that a novel tomato germplasm was created via an interspecific approach using cultivated tomato and a wild relative.

On the basis of the polymorphisms of the 37 phenotypic characteristics derived from the 13 genotypes, cluster analysis was performed, and a heatmap was created. The 13 genotype tomatoes were divided into two groups: the first comprised e9292, F₂-328, F₂-318, F₂-253, and F₂-266, while the second comprised the remaining nine genotypes (Figure 2). In the F₁ hybrids, 22 of the 37 polymorphic traits were predominantly associated with S. pimpinellifolium LA1585, while six traits were similar to those of S. lycopersicum e9292, and the remaining nine phenotypes were of an intermediate type (Table S3).

3.3. Tomato Quality Traits

We found that the various quality traits of the progeny of the interspecific hybrid (e9292 × LA1585) were significantly greater than those of either parent. Among all 13 genotypes, the Vc content ranged from 14.21 mg/100 g FW (e9292) to 55.28 mg/100 g FW (F2-280), and the average value (33.05 mg/100 g FW) of the F1 (e9292 × LA1585) population was closer to that of LA1585 (43.93 mg/100 g FW) than to that of e9292, while it even appeared superior to the parent, LA1585, with the highest levels in F2-280, F2-299, and F2-332 (

Table 1. Analysis of ripening fruit quality in different genotypes.

Genotype	AA (mg/100 g FW)	TSS (°Brix)	LF (N)	TF (N)	Lycopene (μg/g FW)	α-Carotene (μg/g FW)	β-Carotene (μg/g FW)	Lutein (μg/g FW)	TC (μg/g FW)	Fructose (mg/g FW)	Glucose (mg/g FW)	L-Malic Acid (mg/g FW)	CA (mg/g FW)	Quinic Acid (mg/g FW)	Sugar/Acid
e9292	14.21 ± 0.23	4.44 ± 0.24	11.31 ± 1.15	10.71 ± 1.04	27.84 ± 0.27	12.59 ± 1.47	5.29 ± 0.61	6.21 ± 0.61	51.93 ± 2.96	18.10 ± 0.93	12.12 ± 0.24	0.26 ± 0.01	2.80 ± 0.26	0.05 ± 0.01	9.70
LA1585	43.93 ± 0.28	8.12 ± 1.45	3.28 ± 0.27	3.13 ± 0.58	174.39 ± 1.70	4.85 ± 0.48	18.55 ± 0.84	2.69 ± 0.39	200.48 ± 3.41	9.45 ± 0.74	9.48 ± 0.16	0.42 ± 0.04	4.83 ± 0.44	0.04 ± 0.00	3.57
F1	33.05 ± 0.26	6.86 ± 0.15	11.57 ± 0.25	11.02 ± 0.24	109.51 ± 2.75	6.76 ± 0.72	8.84 ± 0.45	2.00 ± 0.28	127.11 ± 4.20	8.98 ± 0.374	10.43 ± 0.70	0.31 ± 0.02	5.01 ± 0.27	0.04 ± 0.00	3.62
F2-253	40.32 ± 0.33	6.04 ± 0.32	12.63 ± 0.83	8.90 ± 0.78	34.84 ± 2.55	17.70 ± 2.40	16.62 ± 2.88	3.07 ± 0.44	72.23 ± 8.27	16.39 ± 1.34	12.17 ± 1.04	0.27 ± 0.07	2.55 ± 0.34	0.04 ± 0.01	9.98
F2-259	33.11 ± 0.37	4.52 ± 0.08	8.59 ± 0.76	5.54 ± 0.61	160.54 ± 1.18	20.98 ± 3.58	7.03 ± 1.72	0.47 ± 0.02	189.02 ± 6.50	19.73 ± 0.53	9.96 ± 0.44	0.28 ± 0.02	2.58 ± 0.11	0.02 ± 0.00	10.32
F2-266	43.02 ± 0.30	6.24 ± 0.54	5.05 ± 0.77	4.83 ± 0.56	45.99 ± 2.70	20.32 ± 2.00	18.79 ± 2.85	2.00 ± 0.07	87.1 ± 7.62	21.65 ± 0.67	10.64 ± 0.08	0.32 ± 0.00	4.92 ± 0.12	0.02 ± 0.00	6.14
F2-280	53.28 ± 0.39	6.64 ± 0.41	4.92 ± 0.54	4.84 ± 0.71	203.55 ± 6.28	1.37 ± 0.08	27.00 ± 5.89	3.53 ± 0.39	235.45 ± 12.64	20.43 ± 1.20	12.51 ± 0.48	0.22 ± 0.02	4.53 ± 0.62	0.02 ± 0.00	6.90
F2-292	33.45 ± 0.14	6.64 ± 0.37	5.39 ± 0.66	4.14 ± 0.74	170.63 ± 4.93	5.37 ± 0.60	15.21 ± 0.86	2.57 ± 0.22	193.78 ± 6.61	26.48 ± 0.84	16.76 ± 1.45	0.27 ± 0.03	4.13 ± 0.04	0.05 ± 0.01	9.71
F2-299	55.12 ± 0.50	7.22 ± 0.13	4.63 ± 0.69	4.66 ± 0.85	34.71 ± 2.03	21.82 ± 3.63	22.54 ± 3.27	3.46 ± 0.42	82.53 ± 9.35	21.93 ± 0.66	14.16 ± 0.04	0.24 ± 0.01	3.63 ± 0.19	0.00 ± 0.00	9.32
F2-318	32.46 ± 0.17	5.42 ± 0.13	13.02 ± 0.82	8.34 ± 0.84	114.01 ± 3.90	16.79 ± 0.42	4.21 ± 0.16	nd	135.01 ± 4.48	17.78 ± 1.06	12.77 ± 0.27	0.34 ± 0.02	3.43 ± 0.31	0.15 ± 0.01	7.78
F2-328	37.62 ± 0.29	6.50 ± 0.48	7.15 ± 0.77	7.47 ± 0.64	47.49 ± 4.21	20.76 ± 3.81	5.51 ± 1.65	3.01 ± 0.57	76.77 ± 10.24	21.76 ± 1.33	16.60 ± 1.19	0.16 ± 0.01	2.83 ± 0.32	0.06 ± 0.00	12.56
F2-330	35.40 ± 0.23	7.04 ± 1.05	5.21 ± 0.28	3.91 ± 0.82	36.35 ± 0.85	17.89 ± 2.25	24.76 ± 2.79	6.08 ± 0.10	85.08 ± 5.99	10.14 ± 0.47	10.17 ± 0.42	0.13 ± 0.02	4.73 ± 0.57	0.07 ± 0.01	4.12
F2-332	44.95 ± 0.22	5.82 ± 0.33	7.64 ± 0.99	6.09 ± 0.97	251.30 ± 6.23	5.45 ± 0.25	10.19 ± 1.85	0.69 ± 0.12	267.63 ± 8.45	26.86 ± 2.06	18.44 ± 0.76	0.26 ± 0.03	3.77 ± 0.39	0.08 ± 0.01	11.01

Note: Values shown in the table are the mean ± sd (standard deviation). Three biological replicates were used for the analysis of quality traits, except for TSS, where five biological replicates were used. Sucrose and succinic acid are not listed in the table due to a very low content that could not be detected. AA/Vc, ascorbic acid/vitamin C; CA, citric acid; FW, fresh weight; LF, longitudinal firmness; N, newton; nd, not detected; sd, standard deviation; TC, total carotenoid; TF, transverse firmness; TSS, total soluble solids.

). The TSS content ranged from 4.44° Brix (e9292) to 8.12° Brix (LA1585), and the mean value in the F1 generation was 6.86° Brix, which was closer to the LA1585 value, and ranged from 4.52 Brix (F2-259) to 7.22 Brix (F2-299) in F2 lines (Table 1). Fruit firmness (fruit apex, 11.57 N; equatorial plane 11.02 N) in F1 tomatoes was similar to that of the e9292 parent (fruit apex, 11.31 N; equatorial plane 10.71 N), while the F2 generation showed considerable diversity, ranging from 4.63 N (F2-299) to 13.02 N (F2-318) at the fruit apex and from 3.91 N (F2-330) to 8.90 N (F2-253) at the equatorial plane (Table 1).

The mean lycopene content of the F₁ fruit (109.51 μg/g FW) was between the values for e9292 (27.84 μg/g FW) and LA1585 (174.39 μg/g FW), whereas the content in F₂-280 and F₂-332 fruit reached 203.55 μg/g FW and 251.30 μg/g FW, respectively. However, the lycopene contents of F₂-299 and F₂-253 were 34.71 μg/g FW and 34.84 μg/g FW, respectively, which were lower than that of the parent with the lower content, e9292. The α-carotene level in e9292 (12.59 μg/g FW) was significantly higher than that in LA1585 (4.85 μg/g FW), while the F₁ tomatoes (6.76 μg/g FW) exhibited mid-parental levels. Interestingly, the α-carotene content in seven F₂ lines (F₂-253, F₂-259, F₂-266, F₂-299, F₂-328, F₂-328, and F₂-300) was higher than that in e9292, while F₂-280 (1.37 μg/g FW) had lower levels than the LA1585 parent. The β-carotene content in the cultivated e9292 tomato (5.29 μg/g FW) was significantly lower than that in the wild LA1585 tomato (18.55 μg/g FW), while the F₁ hybrid had levels between those of e9292 and LA1585, albeit nearer to the e9292 level, and four F₂ lines (F₂-266 (18.79 μg/g FW), F₂-280 (27.00 μg/g FW), F₂-299 (22.54 μg/g FW), and F₂-330 (24.76 μg/g FW)) had higher levels than that of LA1585. Interestingly, an F₂ line, F₂-318, had a lower content (4.21 μg/g FW) than the parent with lower amounts, i.e., e9292. The total carotenoid levels in the F₁ hybrid (e9292 × LA1585, 127.11 μg/g FW) were between the values for e9292 (51.93 μg/g FW) and LA1585 (200.48 μg/g FW), while the total carotenoid levels in F₂-280 (235.45 μg/g FW) and F₂-332 (267.63 μg/g FW) were higher than that in the parent with the higher level, i.e., LA1585 (Table 1).

Soluble sugars in ripening tomato fruit mainly consist of fructose and glucose, while the sucrose content is relatively low. In e9292 fruits, the fructose and glucose contents (18.10 mg/g FW and 12.12 mg/g FW, respectively) were significantly higher than those in LA1585 (9.45 mg/g FW and 9.48 mg/g FW, respectively), while F₁ fruit had values between those of the parents, albeit closer to the LA1585 level. The fructose and glucose levels in five F₂ lines (F₂-280, F₂-292, F₂-299, F₂-328, and F₂-332) were higher than those in e9292 (Table 1).

Citric acid is one of the most important organic acids that contribute to the taste of tomato. Here, we observed that the citric acid levels in the F₁ hybrid were slightly higher than those in the parent with the higher content, LA1585. The citric acid levels in most of the F₂ lines were between those in e9292 and LA1585, with the exception of F₂-253, F₂-259, and F₂-266, of which F₂-253 and F₂-259 had lower levels than e9292, while F₂-266 had higher levels than LA1585 (Table 1).

The broad-sense heritability (hB2, Equation (1)) of 15 traits associated with tomato quality ranged from 75.06% (TSS) to 99.99% (Vc), with an average value of 92.66%. The coefficient of variation (Cv, Equation (4)) varied from 18% (TSS) to 68.82% (lycopene), with an average value of 41.73% (

Table 2. Broad-sense heritability and the coefficient of variation of quality traits in tomatoes with different genetic backgrounds.

Quality Traits	gv	ev	Mean	sd	hb	Cv
TSS	1.01	0.34	6.27	1.13	75.06%	18.10%
Fruit apex firmness	11.31	0.52	7.72	3.34	95.56%	43.19%
Equatorial plane firmness	6.71	0.56	6.43	2.62	92.29%	40.72%
AA	109.20	0.09	38.46	10.18	99.92%	26.46%
α-Carotene	54.39	4.52	13.28	7.49	92.33%	56.37%
β-Carotene	59.81	6.21	14.20	7.93	90.59%	55.85%
Lycopene	5877.49	12.78	108.55	74.71	99.78%	68.82%
Lutein	3.50	0.12	2.75	1.85	96.77%	67.39%
Succinic acid	ld	ld	ld	ld	89.12%	36.81%
Malic acid	0.01	ld	0.27	0.08	88.59%	28.68%
Citric acid	0.83	0.12	3.83	0.95	87.31%	24.91%
Quinic acid	ld	nd	0.05	0.04	97.10%	73.49%
Fructose	34.55	1.08	18.44	5.81	96.98%	31.54%
Glucose	8.26	0.49	12.78	2.88	94.36%	22.56%
Sucrose	ld	ld	ld	ld	ld	ld

Note: AA, ascorbic acid; Cv, coefficient of variation; ev, environmental variance; gv, genetic variance; ld, very low detection level; hb, broad-sense heritability; nd, not detected; sd, standard deviation; TSS, total soluble solids. Sucrose and succinic acid are not listed in the table due to a very low content that could not be detected.

). These results implied that the quality traits were mainly regulated by genetic factors, while the effects derived from environmental factors were less important. There were differences in Cv values between the different genotypes, as well as between different generations, implying that ample genetic diversity existed between the parents and between different hybrid offspring. Taken together, the results showed the considerable potential for creating novel germplasm and improving quality traits using wild tomato relatives for breeding.

3.4. Expression of Genes Associated with Carotenoid Synthesis

To reveal how carotenoid synthesis was regulated in the interspecific cross (e9292 × LA1585), seven genotypes (e9292, LA1585, F₁, and four F₂ lines (yellow-fruited F₂-266 and F₂-299, and red-fruited F₂-318 and F₂-332)) were chosen to evaluate the transcription of the DXS, DXR, HDR, and IDI1 genes involved in the methylerythritol 4-phosphate pathway (MEP) and the PSY1, LCYE, CRTISO, and CYCB genes involved in the carotenoid synthesis pathway (Figure S1).

DXR, HDR, and IDI1 expressions in the MEP pathway were similar in e9292 and LA1585 during the ripening stage (yellow/red ripening), while DXS expression was significantly lower in e9292 than in LA1585. However, DXS and DXR expressions were substantially higher in F₁ fruits than in either of the parents (Figure 3). These results implied that the interspecific hybrid promoted MEP synthesis through the condensation and intramolecular rearrangement catalyzed by DXS and DXR [44]. We also found that HDR and IDI1 expressions in F₂-332 were significantly higher than those in the remaining six genotypes (e9292, LA1585, F₁ hybrid, and three F₂ families, F₂-266, F₂-299, and F₂-318) (Figure 3). An increase in the expressions of HDR and IDI1 in line F₂-332 would likely accelerate the catalytic process carried out by isopentenyl diphosphate (IPP)/dimethylallyl diphosphate (DMAPP) in the MEP pathway, a step that is located upstream from the carotenoid biosynthetic pathway (CBP), which provides it with precursors. The results showed that HDR and IDI1 regulate CBP and affect the synthesis of secondary metabolites, such as lycopene, the content of which reached 251.30 μg/g FW in F₂-332, approximately 1.5-fold greater than that in LA1585 (174.39 μg/g FW) (Table 1). In the CBP itself, PSY1, LCYE, and CYCB expressions were significantly higher in F₁ fruits than in both parents. The lycopene content in F₁ fruits (109.51 μg/g FW) was between the e9292 and LA1585 levels but closer to LA1585. Furthermore, F₂-332 CRTISO and CYCB expressions were significantly higher than those in the other six genotypes. The encoding enzymes promote the conversion of all-trans-lycopene from 7,7′,9,9′-tetra-cis-lycopene and trans-carotenoid cyclization, thereby increasing the lycopene content in F₂-332 fruit (Figure 3 and Table 1). These results indicated that the expression of genes resulting in improved lycopene synthesis was additive in F₂-332.

3.5. Response to Drought and Salt Stresses

Germinated seeds of e9292, LA1585, F₁ hybrids, F₂-266, F₂-299, and F₂-332 were sown on MS₀ medium with mannitol (final concentration: 0 mM, 50 mM, 100 mM, and 150 mM) or NaCl (final concentration: 0 mM, 50 mM, 100 mM, and 150 mM), and then the root and hypocotyl lengths were measured every 24 h between the 24 h and 144 h timepoints (Tables S4 and S5).

Low mannitol concentrations (50 mM) promoted root elongation at early timepoints. Root elongation in F₂-226, in particular, was accelerated under supplied mannitol concentrations of 50 mM, 100 mM, and 150 mM compared with the control (0 mM supplement). However, the root elongation of F₁ and all F₂ lines was suppressed except for F₂-226, and this suppression was enhanced with the addition of mannitol, especially in F₁ and F₂-332 (Figure 4, Table S4). Hypocotyl elongation was inhibited with mannitol supplementation, and this effect increased with both concentration and over time. However, the hypocotyl elongation of F₂-299 was accelerated with supplementation of low mannitol concentrations, as well as 100 mM and 150 mM at the early timepoints (Figure 4 and Table S5).

In the salt stress assay, root elongation was promoted by supplementation of 50 mM and 100 mM NaCl compared with the control of 0 mM NaCl, with the exception of the F₂-332 line, where it was suppressed at these concentrations at later timepoints. Root elongation was suppressed in all six genotypes when supplemented with 150 mM NaCl (Figure 5 and Table S4).

Salt stress inhibited hypocotyl growth in tomato seedlings, and this effect was exacerbated with NaCl concentration and over time. Hypocotyl growth was promoted with a low NaCl concentration of 50 mM in F₁ and F₂-299, while the hypocotyl growth of the e9292 and F₁ plants was suppressed under high salt stress (100 mM and 150 mM NaCl). This effect was not observed for F₂-299, especially at the early timepoints of NaCl treatment (Figure 5 and Table S5).

4. Discussion

The genetic improvement of yield, stress tolerance, and quantity is a critical consideration for consumers and tomato breeders [45]. However, the genetic diversity of the cultivated tomato has been narrowed due to loss during domestication and the spread from South America to Europe [25], as well as during the selection imposed by modern breeding. As a direct ancestor of cultivated tomato, cherry tomato (S. lycopersicum var. cerasiforme), was domesticated from S. pimpinellifolium, in the Andes region, before migrating into Mesoamerica, where the cherry tomato was domesticated into the cultivated tomato, and then transported back to Europe by Spanish colonists [19,46]. The genetic diversity of cultivated tomato markedly declined during the migration to Mesoamerica from the Peruvian and Ecuadorian Amazon region [25,30,46]. Moreover, this loss became more severe with selection stress during modern tomato breeding. However, the ancestral wild relative of cultivated tomato, S. pimpinellifolium, was naturally distributed in contrasting environments, such as the northern coastal Ecuadorian tropical rainforests and the Peruvian coastal desert, and it evolved into several ecotypes with genetic differentiation in response to the climate [25]. Accordingly, S. pimpinellifolium is regarded as a largely unexploited genetic reservoir, which has the potential to improve the cultivated tomato [20,21,22,47]. The reproductive barriers between tomato and its wild species severely limit the use of those wild relatives, including generated descendants, with severe separating and linkage drag. However, as the wild progenitor of cultivated tomato [2], S. pimpinellifolium (accession number, LA1585) is fully cross-compatible with cultivated tomato (e9292); hence, we selected the red-fruited LA1585 as a pollen parent to cross with yellow-fruited e9292. This allowed us to track genetic improvement effects using S. pimpinellifolium and dissect the molecular mechanisms for quality improvement such as carotenoid synthesis in hybrid progenies.

As a progenitor species of cultivated tomato, S. pimpinellifolium is a potential genetic resource to improve tomato fruit quality related to the content of total solids [34], volatile compounds [31], fruit color [48], and resistance against bio-stress such as tomato leaf curl virus [49], Alternaria solani, Fusarium oxysporum, Phytophthora infestans, or Cladosporium fulvum [30].

In the present study, as representatives, 10 F₂ lines (five each for yellow/red fruited lines) were randomly selected to examine their phenotypes, and some were also used to assess possible improvements (four for quality and three for abiotic stresses) for tomato. The Vc content in three F₂ lines (e9292 × LA1585) was higher than that in the LA1585 parent, which had a higher content than e9292. The TSS content in two F₂ lines was similar to that in LA1585 and 1.6-fold higher than that in e9292. In particular, lycopene contents in two F₂ lines (F₂-280 and F₂-332) were dramatically higher than in the LA1585 parent, and even ninefold higher than in e9292 (Table 1). To dissect lycopene accumulation in the inter-specific hybrid, the expression of key genes associated with lycopene synthesis was examined, which showed that the distant interspecific hybridization between e9292 and LA1585 resulted in elevated expressions of DXS, DXR, PSY1, LCYE, and CYCB in the F₁ generation, while the HDR, IDI1, CRTISO, and CYCB expression levels were higher in the F₂-332 line (Figure 3). These results implied that the interspecific hybridization event increased the expressions of genes associated with carotenoid synthesis and its upstream 2-C-methyl-d-erythritol 4-phosphate (MEP) pathway, as well as promoted lycopene accumulation in hybrid tomatoes, especially some lines in the F₂ generation.

Glucose and fructose are the principal components of the total soluble sugars associated with tomato flavor [31], and their contents in five of the F₂ lines were higher than those in the parent with a higher content, i.e., e9292, in present study (Table 1). For citric acid, F₁ and one F₂ lines had a higher content than LA1585, which had the higher content of the two parents. Among all 13 genotypes, the sugar–acid ratio ranged from 3.573 in LA1585 to 12.556 in the F₂-328 line. e9292 had the higher levels of the two parents, while five F₂ lines had a higher ratio (Table 1). Both monosaccharides and organic acids are known to be associated with tomato flavor; hence, on the basis of the fruit quality data, we ranked the 13 genotypes (e9292, LA1585, F₁ hybrid, and 10 F₂ families) by flavor, from best (1) to worst (13). e9292 and LA1585 were ranked 13 and 4, respectively, while the F₁ hybrid was placed at rank 11, and the F₂-332 line had the fruit with the best quality (

Table 3. Quality ranking of tomatoes with different genetic backgrounds.

Genotypes	Vitamin C	Total Soluble Solids	Carotenoids	Sugar/Acid Ratio	Total Score	Ranking
e9292	13	13	13	6	45	13
LA1585	4	1	3	13	21	4
F1	11	4	7	12	34	11
F2-253	6	9	12	4	31	10
F2-259	10	12	5	3	30	7
F2-266	5	8	8	10	31	9
F2-280	2	5	2	9	18	2
F2-292	9	6	4	5	24	5
F2-299	1	2	10	7	20	3
F2-318	12	11	6	8	37	12
F2-328	7	7	11	1	26	6
F2-330	8	3	9	11	31	8
F2-332	3	10	1	2	16	1

Note: The ranking was assigned on the basis of each quality content, whereby 1 is the highest and 13 is the lowest; the total score was aggregated using values derived from each quality trait, and the final ranking was estimated according to the total score.

). In the present study, a novel tomato genotype F₂-332 was successfully created, which had better-quality fruit than the parental cultivated tomato e9292, as well as some excellent quality traits of LA1585 related to the Vc and carotenoid contents. These results implied that S. pimpinellifolium has the potential to create novel valuable germplasm and improve fruit quality for cultivated tomato breeding.

In addition, S. pimpinellifolium also exhibited potential to tolerate abiotic stress. We found that both salt and mannitol stress substantially suppressed the elongation of roots and hypocotyls in both parent seedlings, while more tolerant lines were developed in the F₂ generation.

We successfully introgressed elite genes associated with fruit quality and resistance to abiotic stress into the cultivated tomato e9292 from S. pimpinellifolium, and we created a series of valuable novel tomato resources through an interspecific cross approach. However, the remarkable linkage drag, e.g., the small fruit trait, is difficult to eliminate from the progenies of the interspecific hybrid. The average single fruit weight was 6.53 g in the F₁ hybrid and 8.51 g in the F₂ lines. The single-fruit weight was similar to that of the cherry tomato (S. lycopersicum var. cerasiforme), which is extensively planted around the world. Nevertheless, the small-fruited trait can still be improved by genetic manipulation/editing or backcrossing with large tomatoes. Previous studies revealed that the fruit weight trait of tomato is associated with genes such as CELL SIZE REGULATOR (CSR) [50], EXCESSIVE NUMBER OF FLORAL ORGANS(ENO) [51], and fw2.2 [52,53], and these alleles exhibit DNA fragment deletion in both CRS (1.4 kb) and ENO (85 bp in promoter region), while the recessive fw2.2 allele in cultivated tomato is associated with a larger fruit compared with S. pimpinellifolium with a small fruit [33,52]. Therefore, the linkage drag of small fruit can be removed from interspecific progenies between e9292 and LA1585 through genetic manipulation. Here, we must point out that only 10 F₂ lines were assessed in the present study, implying that a more desirable germplasm can potentially be obtained from a larger F₂ population upon assessing a broader range of characteristics.

Taken together, the results in the present study provide a valid approach to create novel germplasm for cultivated tomato improvement using wild tomato relatives and a practical evaluation method. Furthermore, valuable novel germplasm resources were created for the improvement of fruit quality and resistance to abiotic stresses in cultivated tomatoes using S. pimpinellifolium. In particular, this study provided insight into the creation of novel resources for tomato genetic improvement and breeding with wild relatives.