A Novel Target (Oxidation Resistant 2) in Arabidopsis thaliana to Reduce Clubroot Disease Symptoms via the Salicylic Acid Pathway without Growth Penalties
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant and Pathogen Materials
2.2. Plant Growth and Infection Procedure
2.3. RNA Isolation and Analysis
2.4. Sequence Alignment and Phylogenetic Tree Analysis
2.5. Transcriptional Expression Analysis Using Publicly Available Datasets and Bioinformatics Online Tools
2.6. Statistical Analysis
3. Results
3.1. OXR2 Overexpressing Arabidopsis Thaliana Plants Are More Resistant to Clubroot
3.2. Some Molecular Characteristics of OXR2-OE Plants
3.3. Homologs of the AtOXR2 Protein Are Also Present in Other Brassica Species
3.4. Interaction between the AtOXR2 Pathway and Publicly Available Clubroot Transcriptome Datasets
| AtOXR2-OE Downregulated [39] | AtOXR2-OE Upregulated [39] | |
|---|---|---|
| Siemens et al. [51] | ||
| Key outcome:Role of cytokinins | ||
| Microarray: 10, 23 dai1 | ||
| 10 dai downregulated | n.s.2 | 12 < 0.001 |
| 23 dai downregulated | n.s. | 18 < 0.001 |
| 23 dai upregulated | 12 < 0.001 | 12 (0.001) |
| Agarwal et al. [24] | ||
| Key outcome:Role of defense genes | ||
| Microarray: 4, 7, 10 dai | ||
| 4 dai downregulated | 14 < 0.001 | n.s. |
| 10 dai downregulated | 4 (0.003) | n.s. |
| 4 dai upregulated | n.s. | 23 (0.008) |
| 7 dai upregulated | 23 (0.002) | n.s. |
| Jubault et al. [54] | ||
| Key outcome:Ecotype Bur-0 (partially resistant phenotype) -> activation of SA pathway | ||
| Microarray: 24, 48 h, 7 dai | ||
| 1 dai upregulated | n.s. | 12 < 0.001 |
| 2 dai upregulated | n.s. | 7 < 0.001 |
| 7 dai upregulated | n.s. | 14 < 0.001 |
| 7 dai eH/e2 downregulated | n.s. | 9 < 0.001 |
| e2 specific repression | n.s. | 8 < 0.001 |
| Siemens [52] | ||
| Key outcome:Ecotype Tsu-0 (resistant phenotype) that shows HR reactions | ||
| Microarray: 10, 14, 23 dai | ||
| 10 dai downregulated | 54 < 0.001 | 59 < 0.001 |
| 10 dai upregulated | 89 < 0.001 | n.s. |
| 14 dai downregulated | 85 < 0.001 | 74 < 0.001 |
| 14 dai upregulated | n.s. | 104 (0.002) |
| Irani et al. [55] | ||
| Key outcome:Role of phenylpropanoid metabolism | ||
| RNAseq: 17, 20, 24 dai | ||
| 17, 20, 24 dai downregulated | n.s. | 6 (0.003) |
| 17, 20, 24 dai upregulated | 16 < 0.001 | n.s. |
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dixon, G.R. Plasmodiophora brassicae (Clubroot): A Plant Pathogen that Alters Host Growth and Productivity. J. Plant Growth Regul. 2009, 28, 193. [Google Scholar] [CrossRef] [Scilit]
- Jahn, L.; Mucha, S.; Bergmann, S.; Horn, C.; Staswick, P.; Steffens, B.; Siemens, J.; Ludwig-Müller, J. The Clubroot Pathogen (Plasmodiophora brassicae) Influences Auxin Signaling to Regulate Auxin Homeostasis in Arabidopsis. Plants 2013, 2, 726–749. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Robin, A.H.K.; Hossain, M.R.; Kim, H.-T.; Nou, I.-S.; Park, J.-I. Role of Cytokinins in Clubroot Disease Development. Plant Breed. Biotechnol. 2019, 7, 73–82. [Google Scholar] [CrossRef] [Scilit]
- Schuller, A.; Kehr, J.; Ludwig-Müller, J. Laser Microdissection Coupled to Transcriptional Profiling of Arabidopsis Roots Inoculated by Plasmodiophora brassicae Indicates a Role for Brassinosteroids in Clubroot Formation. Plant Cell Physiol. 2013, 55, 392–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malinowski, R.; Truman, W.; Blicharz, S. Genius Architect or Clever Thief—How Plasmodiophora brassicae Reprograms Host Development to Establish a Pathogen-Oriented Physiological Sink. Mol. Plant-Microbe Interact. 2019, 32, 1259–1266. [Google Scholar] [CrossRef] [Scilit]
- Zhang, W.; Wang, S.; Yu, F.; Tang, J.; Yu, L.; Wang, H.; Li, J. Genome-Wide Identification and Expression Profiling of Sugar Transporter Protein (STP) Family Genes in Cabbage (Brassica oleracea var. capitata L.) Reveals their Involvement in Clubroot Disease Responses. Genes 2019, 10, 71. [Google Scholar] [CrossRef] [Scilit]
- Dixon, G.R. The Occurrence and Economic Impact of Plasmodiophora brassicae and Clubroot Disease. J. Plant Growth Regul. 2009, 28, 194–202. [Google Scholar] [CrossRef] [Scilit]
- Dixon, G.R. Plasmodiophora brassicae in its Environment. J. Plant Growth Regul. 2009, 28, 212–228. [Google Scholar] [CrossRef] [Scilit]
- Hwang, S.F.; Ahmed, H.U.; Zhou, Q.; Rashid, A.; Strelkov, S.E.; Gossen, B.D.; Peng, G.; Turnbull, G.D. Effect of susceptible and resistant canola plants on Plasmodiophora brassicae resting spore populations in the soil. Plant Pathol. 2013, 62, 404–412. [Google Scholar] [CrossRef] [Scilit]
- Liu, L.; Qin, L.; Zhou, Z.; Hendriks, W.G.H.M.; Liu, S.; Wei, Y. Refining the Life Cycle of Plasmodiophora brassicae. Phytopathology 2020, 110, 1704–1712. [Google Scholar] [CrossRef] [Scilit]
- Fredua-Agyeman, R.; Hwang, S.-F.; Strelkov, S.E.; Zhou, Q.; Feindel, D. Assessment of resistance to ‘new’ virulent populations of Plasmodiophora brassicae reveals potential loss of clubroot resistance genes from donor parent Brassica rapa L. ssp. rapifera (ECD 04) during doubled haploid production. Plant Pathol. 2017, 67, 892–901. [Google Scholar] [CrossRef] [Scilit]
- Sedaghatkish, A.; Gossen, B.D.; Yu, F.; Torkamaneh, D.; McDonald, M.R. Whole-genome DNA similarity and population structure of Plasmodiophora brassicae strains from Canada. BMC Genom. 2019, 20, 744–814. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pang, W.; Liang, Y.; Zhan, Z.; Li, X.; Piao, Z. Development of a Sinitic Clubroot Differential Set for the Pathotype Classification of Plasmodiophora brassicae. Front. Plant Sci. 2020, 11, 568771. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zamani-Noor, N. Variation in pathotypes and virulence of Plasmodiophora brassicae populations in Germany. Plant Pathol. 2017, 66, 316–324. [Google Scholar] [CrossRef] [Scilit]
- Daval, S.; Gazengel, K.; Belcour, A.; Linglin, J.; Sarniguet, A.; Manzanares-Dauleux, M.J.; Mougel, C. Soil microbiota influences clubroot disease by modulating Plasmodiophora brassicae and Brassica napus transcriptomes. Microbial Biotechnol. 2020, 13, 1648–1672. [Google Scholar] [CrossRef] [Scilit]
- Hayat, S.; Irfan, M.; Wani, A.S.; Alyemeni, M.N.; Ahmad, A. Salicylic acids: Local, systemic or inter-systemic regulators? Plant Sign. Behav. 2012, 7, 93–102. [Google Scholar] [CrossRef] [Scilit]
- Loake, G.; Grant, M. Salicylic acid in plant defence—The players and protagonists. Curr. Opin. Plant Biol. 2007, 10, 466–472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lemarié, S.; Robert-Seilaniantz, A.; Lariagon, C.; Lemoine, J.; Marnet, N.; Jubault, M.; Manzanares-Dauleux, M.J.; Gravot, A. Both the jasmonic acid and the salicylic acid pathways contribute to resistance to the biotrophic clubroot agent Plasmodiophora brassicae in Arabidopsis. Plant Cell Physiol. 2015, 56, 2158–2168. [Google Scholar]
- Manoharan, R.K.; Shanmugam, A.; Hwang, I.; Park, J.-I.; Nou, I.-S. Expression of salicylic acid-related genes in Brassica oleracea var. capitata during Plasmodiophora brassicae infection. Genome 2016, 59, 379–391. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Prerostova, S.; Dobrev, P.I.; Konradyova, V.; Knirsch, V.; Gaudinova, A.; Kramna, B.; Kazda, J.; Ludwig-Müller, J.; Vankova, R. Hormonal Responses to Plasmodiophora brassicae Infection in Brassica napus Cultivars Differing in Their Pathogen Resistance. Int. J. Mol. Sci. 2018, 19, 4024. [Google Scholar] [CrossRef] [Scilit]
- Ciaghi, S.; Schwelm, A.; Neuhauser, S. Transcriptomic response in symptomless roots of clubroot infected kohlrabi (Brassica oleracea var. gongylodes) mirrors resistant plants. BMC Plant Biol. 2019, 19, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Galindo-González, L.; Manolii, V.; Hwang, S.-F.; Strelkov, S.E. Response of Brassica napus to Plasmodiophora brassicae Involves Salicylic Acid-Mediated Immunity: An RNA-Seq-Based Study. Front. Plant Sci. 2020, 11, 1025. [Google Scholar] [CrossRef] [Scilit]
- Zhou, Q.; Galindo-González, L.; Manolii, V.; Hwang, S.-F.; Strelkov, S. Comparative Transcriptome Analysis of Rutabaga (Brassica napus) Cultivars Indicates Activation of Salicylic Acid and Ethylene-Mediated Defenses in Response to Plasmodiophora brassicae. Int. J. Mol. Sci. 2020, 21, 8381. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agarwal, A.; Kaul, V.; Faggian, R.; Rookes, J.E.; Ludwig-Müller, J.; Cahill, D.M. Analysis of global host gene expression during the primary phase of the Arabidopsis thaliana–Plasmodiophora brassicae interaction. Funct. Plant Biol. 2011, 38, 462–478. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lovelock, D.A.; Donald, C.E.; Conlan, X.A.; Cahill, D.M. Salicylic acid suppression of clubroot in broccoli (Brassica oleracea var. italica) caused by the obligate biotroph Plasmodiophora brassicae. Australas. Plant Pathol. 2013, 42, 141–153. [Google Scholar] [CrossRef] [Scilit]
- Lovelock, D.A.; Sola, I.; Marschollek, S.; Donald, C.E.; Rusak, G.; van Pée, K.H.; Ludwig-Müller, J.; Cahill, D.M. Analysis of salicylic acid-dependent pathways in Arabidopsis thaliana following infection with Plasmodiophora brassicae and the influence of salicylic acid on disease. Mol. Plant Pathol. 2016, 7, 1237–1251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, J.; Piao, Y.; Liu, Y.; Li, X.; Piao, Z. Genome-wide identification and expression analysis of chitinase gene family in Brassica rapa reveals its role in clubroot resistance. Plant Sci. 2018, 270, 257–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ludwig-Müller, J.; Thermann, P.; Pieper, K.; Hilgenberg, W. Peroxidase and chitinase isoenzyme activities during root infection of Chinese cabbage with Plasmodiophora brassicae. Physiol. Plant. 1994, 90, 661–670. [Google Scholar] [CrossRef] [Scilit]
- Ludwig-Müller, J.; Jülke, S.; Geiß, K.; Richter, F.; Mithöfer, A.; Šola, I.; Rusak, G.; Keenan, S.; Bulman, S. A novel methyltransferase from the intracellular pathogen Plasmodiophora brassicae methylates salicylic acid. Mol. Plant Pathol. 2014, 16, 349–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Djavaheri, M.; Ma, L.; Klessig, D.F.; Mithöfer, A.; Gropp, G.; Borhan, H. Mimicking the Host Regulation of Salicylic Acid: A Virulence Strategy by the Clubroot Pathogen Plasmodiophora brassicae. Mol. Plant-Microbe Interact. 2019, 32, 296–305. [Google Scholar] [CrossRef] [Scilit]
- Bulman, S.; Richter, F.; Marschollek, S.; Benade, F.; Jülke, S.; Ludwig-Müller, J. Arabidopsis thaliana expressing PbBSMT, a gene encoding a SABATH-type methyltransferase from the plant pathogenic protist Plasmodiophora brassicae, show leaf chlorosis and altered host susceptibility. Plant Biol. 2019, 21, 120–130. [Google Scholar] [CrossRef] [Scilit]
- Badstöber, J.; Gachon, C.M.M.; Ludwig-Müller, J.; Sandbichler, A.M.; Neuhauser, S. Demystifying biotrophs: FISHing for mRNAs to decipher plant and algal pathogen–host interaction at the single cell level. Sci. Rep. 2020, 10, 14269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wildermuth, M.C.; Dewdney, J.; Wu, G.; Ausubel, F.M. Isochorismate synthase is required to synthesize salicylic acid for plant defence. Nature 2001, 414, 562–565. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bowling, S.A.; Guo, A.; Cao, H.; Gordon, S.; Klessig, D.; Dong, X. A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 1994, 6, 1845–1857. [Google Scholar] [PubMed]
- Yu, I.-C.; Parker, J.; Bent, A.F. Gene-for-gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. USA 1998, 95, 7819–7824. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Clough, S.J.; Fengler, K.A.; Yu, I.; Lippok, B.; Smith, R.K., Jr.; Bent, A.F. The Arabidopis sdnd1 “defense, no death” gene encodes a mutated cyclic nucleotide-gated ion channel. Proc. Natl. Acad. Sci. USA 2000, 97, 9323–9328. [Google Scholar] [CrossRef] [Scilit]
- Canet, J.V.; Dobón, A.; Ibáñez, F.; Perales, L.; Tornero, P. Resistance and biomass in Arabidopsis: A new model for Salicylic Acid perception. Plant Biotechnol. J. 2010, 8, 126–141. [Google Scholar] [CrossRef] [Scilit]
- Rivas-San Vicente, M.; Plasencia, J. Salicylic acid beyond defence: Its role in plant growth and development. J. Exp. Bot. 2011, 62, 3321–3338. [Google Scholar] [CrossRef] [Scilit]
- Colombatti, F.; Mencia, R.; Garcia, L.; Mansilla, N.; Alemano, S.; Andrade, A.M.; Gonzalez, D.H.; Welchen, E. The mitochondrial oxidation resistance protein AtOXR2 increases plant biomass and tolerance to oxidative stress. J. Exp. Bot. 2019, 70, 3177–3195. [Google Scholar] [CrossRef] [Scilit]
- Mencia, R.; Céccoli, G.; Fabro, G.; Torti, P.; Colombatti, F.; Ludwig-Müller, J.; Alvarez, M.E.; Welchen, E. OXR2 Increases Plant Defense against a Hemibiotrophic Pathogen via the Salicylic Acid Pathway. Plant Physiol. 2020, 184, 1112–1127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mhamdi, A. NPR1 Has Everything under Control. Plant Physiol. 2019, 181, 6–7. [Google Scholar] [CrossRef] [Scilit]
- Fähling, M.; Graf, H.; Siemens, J. Pathotype Separation of Plasmodiophora brassicae by the Host Plant. J. Phytopathol. 2003, 151, 425–430. [Google Scholar] [CrossRef] [Scilit]
- Siemens, J.; Nagel, M.; Ludwig-Müller, J.; Sacristán, M.D. The interaction of Plasmodiophora brassicae and Arabidopsis thaliana: Parameters for disease quantification and screening of mutant lines. J. Phytopathol. 2002, 150, 592–605. [Google Scholar] [CrossRef] [Scilit]
- Klewer, A.; Luerßen, H.; Graf, H.; Siemens, J. RFLP markers to characterize Plasmodiophora brassicae single-spore-isolates with different virulence patterns. J. Phytopathol. 2001, 149, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−ΔΔCt) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Gish, W.; Miller, W.; Myers, E.W.; Lipman, D.J. Basic local alignment search tool. J. Mol. Biol. 1990, 215, 403–410. [Google Scholar] [CrossRef]
- Gish, W.; States, D.J. Identification of protein coding regions by database similarity search. Nat. Genet. 1993, 3, 266–272. [Google Scholar] [CrossRef] [Scilit]
- Gouy, M.; Guindon, S.; Gascuel, O. SeaView Version 4: A Multiplatform Graphical User Interface for Sequence Alignment and Phylogenetic Tree Building. Mol. Biol. Evol. 2009, 27, 221–224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Katari, M.; Nowicki, S.D.; Aceituno, F.F.; Nero, D.; Kelfer, J.; Thompson, L.P.; Cabello, J.M.; Davidson, R.S.; Goldberg, A.P.; Shasha, D.E.; et al. VirtualPlant: A Software Platform to Support Systems Biology Research. Plant Physiol. 2009, 152, 500–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heberle, H.; Meirelles, G.V.; Da Silva, F.R.; Telles, G.P.; Minghim, R. InteractiVenn: A web-based tool for the analysis of sets through Venn diagrams. BMC Bioinform. 2015, 16, 169. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Siemens, J.; Keller, I.; Sarx, J.; Kunz, S.; Schuller, A.; Nagel, W.; Schmülling, T.; Parniske, M.; Ludwig-Müller, J. Transcriptome Analysis of Arabidopsis Clubroots Indicate a Key Role for Cytokinins in Disease Development. Mol. Plant-Microbe Interact. 2006, 19, 480–494. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- NASC’s International Affymetrix Service. Available online: http://arabidopsis.info/affy/link_to_iplant.html (accessed on 9 October 2021).
- Kobelt, P.; Siemens, J.; Sacristán, M.D. Histological Characterisation of the Incompatible Interaction between Arabidopsis Thaliana and the Obligate Biotrophic Pathogen Plasmodiophora brassicae. Mycol. Res. 2000, 104, 220–225. [Google Scholar] [CrossRef] [Scilit]
- Jubault, M.; Lariagon, C.; Taconnat, L.; Renou, J.-P.; Gravot, A.; Delourme, R.; Manzanares-Dauleux, M.J. Partial resistance to clubroot in Arabidopsis is based on changes in the host primary metabolism and targeted cell division and expansion capacity. Funct. Integr. Genom. 2013, 13, 191–205. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Irani, S.; Trost, B.; Waldner, M.; Nayidu, N.; Tu, J.; Kusalik, A.J.; Todd, C.D.; Wei, Y.; Bonham-Smith, P.C. Transcriptome analysis of response to Plasmodiophora brassicae infection in the Arabidopsis shoot and root. BMC Genom. 2018, 19, 1–19. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.; Li, Y.; Yan, R.; Ren, L.; Liu, F.; Zeng, L.; Sun, S.; Yang, H.; Chen, K.; Xu, L.; et al. SnRK1.1-mediated resistance of Arabidopsis thaliana to clubroot disease is inhibited by the novel Plasmodiophora brassicae effector PBZF1. Mol. Plant Pathol. 2021, 22, 1057–1069. [Google Scholar] [CrossRef] [Scilit]
- Baena-González, E.; Rolland, F.; Thevelein, J.; Sheen, J. A central integrator of transcription networks in plant stress and energy signalling. Nature 2007, 448, 938–942. [Google Scholar] [CrossRef] [Scilit]
- Liu, Y.; Xu, A.; Liang, F.; Yao, X.; Wang, Y.; Liu, X.; Zhang, Y.; Dalelhan, J.; Zhang, B.; Qin, M.; et al. Screening of clubroot-resistant varieties and transfer of clubroot resistance genes to Brassica napus using distant hybridization. Breed. Sci. 2018, 68, 258–267. [Google Scholar] [CrossRef] [Scilit]
- Mehraj, H.; Akter, A.; Miyaji, N.; Miyazaki, J.; Shea, D.J.; Fujimoto, R.; Doullah, A.-U. Genetics of Clubroot and Fusarium Wilt Disease Resistance in Brassica Vegetables: The Application of Marker Assisted Breeding for Disease Resistance. Plants 2020, 9, 726. [Google Scholar] [CrossRef] [Scilit]
- Dakouri, A.; Lamara, M.; Karim, M.; Wang, J.; Chen, Q.; Gossen, B.D.; Strelkov, S.E.; Hwang, S.-F.; Peng, G.; Yu, F. Identification of resistance loci against new pathotypes of Plasmodiophora brassicae in Brassica napus based on genome-wide association mapping. Sci. Rep. 2021, 11, 6599. [Google Scholar] [CrossRef] [Scilit]
- Schwelm, A.; Ludwig-Müller, J. Molecular pathotyping of Plasmodiophora brassicae—Genomes, marker genes and obstacles. Pathogens 2021, 10, 259. [Google Scholar] [CrossRef] [Scilit]
- Fredua-Agyeman, R.; Jiang, J.; Hwang, S.-F.; Strelkov, S.E. QTL Mapping and Inheritance of Clubroot Resistance Genes Derived From Brassica rapa subsp. rapifera (ECD 02) Reveals Resistance Loci and Distorted Segregation Ratios in Two F2 Populations of Different Crosses. Front. Plant Sci. 2020, 11, 899. [Google Scholar] [CrossRef] [Scilit]
- Wagner, G.; Laperche, A.; Lariagon, C.; Marnet, N.; Renault, D.; Guitton, Y.; Bouchereau, A.; Delourme, R.; Manzanares-Dauleux, M.J.; Gravot, A. Resolution of quantitative resistance to clubroot into QTL-specific metabolic modules. J. Exp. Bot. 2019, 70, 5375–5390. [Google Scholar] [CrossRef] [Scilit]
- Zamani-Noor, N.; Hornbacher, J.; Comel, C.; Papenbrock, J. Variation of Glucosinolate Contents in Clubroot-Resistant and Susceptible Brassica napus Cultivars in Response to Virulence of Plasmodiophora brassicae. Pathogens 2021, 10, 563. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ludwig-Müller, J. Belowground defence strategies against clubroot (Plasmodiophora brassicae). In Belowground Defence Strategies in Plants; Series: Signaling and communication in plants; Vos, C., Kamal, K., Eds.; Springer: Berlin/Heidelberg, Germany, 2016; pp. 195–219. [Google Scholar]
- Yang, L.; Li, B.; Zheng, X.-Y.; Li, J.; Yang, M.; Dong, X.; He, G.; An, C.; Deng, X.W. Salicylic acid biosynthesis is enhanced and contributes to increased biotrophic pathogen resistance in Arabidopsis hybrids. Nat. Commun. 2015, 6, 7309. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qi, G.; Chen, J.; Chang, M.; Chen, H.; Hall, K.; Korin, J.; Liu, F.; Wang, D.; Fu, Z.Q. Pandemonium BreaksOut: Disruption of salicylic acid-mediated defense by plant pathogens. Mol. Plant. 2018, 11, 1427–1439. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaffney, T.; Friedrich, L.; Vernooij, B.; Negrotto, D.; Nye, G.; Uknes, S.; Ward, E.; Kessmann, H.; Ryals, J. Requirement of Salicylic Acid for the Induction of Systemic Acquired Resistance. Science 1993, 261, 754–756. [Google Scholar] [CrossRef] [Scilit]
- Rabe, F.; Ajami-Rashidi, Z.; Doehlemann, G.; Kahmann, R.; Djamei, A. Degradation of the plant defence hormone salicylic acid by the biotrophic fungus Ustilago maydis. Mol. Microbiol. 2013, 89, 179–188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, T.; Song, T.; Zhang, X.; Yuan, H.; Su, L.; Li, W.; Xu, J.; Liu, S.; Chen, L.; Chen, T.; et al. Unconventionally secreted effectors of two filamentous pathogens target plant salicylate biosynthesis. Nat. Commun. 2014, 5, 4686. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Xue, B.; Dai, J.; Qin, X.; Liu, L.; Chi, Y.; Jones, J.T.; Li, H. A novel Meloidogyne incognita chorismate mutase effector suppresses plant immunity by manipulating the salicylic acid pathway and functions mainly during the early stages of nematode parasitism. Plant Pathol. 2018, 67, 1436–1448. [Google Scholar] [CrossRef] [Scilit]
- Pérez-López, E.; Waldner, M.; Hossain, M.; Kusalik, A.J.; Wei, Y.; Bonham-Smith, P.C.; Todd, C.D. Identification of Plasmodiophora brassicae effectors—A challenging goal. Virulence 2018, 9, 1344–1353. [Google Scholar] [CrossRef] [Scilit]
- Pérez-López, E.; Hossain, M.; Tu, J.; Waldner, M.; Todd, C.D.; Kusalik, A.J.; Wei, Y.; Bonham-Smith, P.C. Transcriptome Analysis Identifies Plasmodiophora brassicae Secondary Infection Effector Candidates. J. Eukaryot. Microbiol. 2020, 67, 337–351. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yu, F.; Wang, S.; Zhang, W.; Tang, J.; Wang, H.; Yu, L.; Zhang, X.; Fei, Z.; Li, J. Genome-wide identification of genes encoding putative secreted E3 ubiquitin ligases and functional characterization of PbRING1 in the biotrophic protist Plasmodiophora brassicae. Curr. Genet. 2019, 65, 1355–1365. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pérez-López, E.; Hossain, M.M.; Wei, Y.; Todd, C.D.; Bonham-Smith, P.C. A clubroot pathogen effector targets cruciferous cysteine proteases to suppress plant immunity. Virulence 2021, 12, 2327–2340. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hossain, M.; Pérez-López, E.; Todd, C.D.; Wei, Y.; Bonham-Smith, P.C. Endomembrane-Targeting Plasmodiophora brassicae Effectors Modulate PAMP Triggered Immune Responses in Plants. Front. Microbiol. 2021, 12, 651279. [Google Scholar] [CrossRef] [Scilit]
- Feng, J.; Hwang, R.; Hwang, S.-F.; Strelkov, S.E.; Gossen, B.D.; Zhou, Q.-X.; Peng, G. Molecular characterization of a serine protease Pro1 from Plasmodiophora brassicae that stimulates resting spore germination. Mol. Plant Pathol. 2010, 11, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Hulsmans, S.; Rodriguez, M.S.; De Coninck, B.; Rolland, F. The SnRK1 Energy Sensor in Plant Biotic Interactions. Trends Plant Sci. 2016, 21, 648–661. [Google Scholar] [CrossRef] [Scilit]
- Margalha, L.; Confraria, A.; Baena-González, E. SnRK1 and TOR: Modulating growth–defense trade-offs in plant stress responses. J. Exp. Bot. 2019, 70, 2261–2274. [Google Scholar] [CrossRef] [Scilit]
- Filipe, O.; De Vleesschauwer, D.; Haeck, A.; Demeestere, K.; Höfte, M. The energy sensor OsSnRK1a confers broad-spectrum disease resistance in rice. Sci. Rep. 2018, 8, 3864. [Google Scholar] [CrossRef] [Scilit]








| Gene Name | 5′ Sequence | 3′ Sequence | References |
|---|---|---|---|
| AtActin8 | GTATGTTGCCATTCAAGCTGTTCTA | GAGCTTGGTTTTCGAGGTCTCC | [26,29,31] |
| AtYLS8 | TTACTGTTTCGGTTGTTCTCCATTT | CACTGAATCATGTTCGAAGCAAGT | [26] |
| AtEF2 | TACTCTTATGGTATGACGGATTGTG | ATATGAATGATCGGAAGAGAAAAGA | S. Auer, this manuscript |
| AtSID2 | CTTGGCTAGCACAGTTACAGC | ACTGCAGACACCTAATTGAGTC | [40] |
| PbActin | ATGTCCAACTCGGAGCAGTC | GGACTCGTTGCCGATCAT | [26,29,31] |
| PbBSMT | GACCTTGCAGAACACGGATT | TGGTGACGTGCTCGGGGAAC | [29] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mencia, R.; Welchen, E.; Auer, S.; Ludwig-Müller, J. A Novel Target (Oxidation Resistant 2) in Arabidopsis thaliana to Reduce Clubroot Disease Symptoms via the Salicylic Acid Pathway without Growth Penalties. Horticulturae 2022, 8, 9. https://doi.org/10.3390/horticulturae8010009
Mencia R, Welchen E, Auer S, Ludwig-Müller J. A Novel Target (Oxidation Resistant 2) in Arabidopsis thaliana to Reduce Clubroot Disease Symptoms via the Salicylic Acid Pathway without Growth Penalties. Horticulturae. 2022; 8(1):9. https://doi.org/10.3390/horticulturae8010009
Chicago/Turabian StyleMencia, Regina, Elina Welchen, Susann Auer, and Jutta Ludwig-Müller. 2022. "A Novel Target (Oxidation Resistant 2) in Arabidopsis thaliana to Reduce Clubroot Disease Symptoms via the Salicylic Acid Pathway without Growth Penalties" Horticulturae 8, no. 1: 9. https://doi.org/10.3390/horticulturae8010009
APA StyleMencia, R., Welchen, E., Auer, S., & Ludwig-Müller, J. (2022). A Novel Target (Oxidation Resistant 2) in Arabidopsis thaliana to Reduce Clubroot Disease Symptoms via the Salicylic Acid Pathway without Growth Penalties. Horticulturae, 8(1), 9. https://doi.org/10.3390/horticulturae8010009

