Next Article in Journal
Isolation and Characterization of Pseudomonas sp. HX1, Streptomyces luteogriseus HR40, and Streptomyces flavofungini HR77 as Promising Biocontrol Agents Against Verticillium Wilt in Hops Affected by Verticillium nonalfalfae
Next Article in Special Issue
Genome-Wide Analysis of Mlo Genes and Functional Characterization of Cm-mlo38 and Cm-mlo44 in Regulating Powdery Mildew Resistance in Melon
Previous Article in Journal
Effects of Drought Stress on Photosynthetic Characteristics and Endogenous Hormone Levels in the Sweet Potato (Ipomoea batatas)
Previous Article in Special Issue
Genome-Wide Identification of the SmHD-zip Genes That Respond to Multiple Ripening-Related Signals in Eggplant Fruit
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genome-Wide Identification and Expression Analysis of UBP Genes in Peppers (Capsicum annuum L.)

1
College of Horticulture, Shanxi Agricultural University, Jinzhong 030801, China
2
Shanxi Key Laboratory of Germplasm Resources Innovation and Utilization of Vegetable and Flower, College of Horticulture, Shanxi Agricultural University, Taigu 030801, China
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Horticulturae 2025, 11(5), 458; https://doi.org/10.3390/horticulturae11050458
Submission received: 25 March 2025 / Revised: 16 April 2025 / Accepted: 24 April 2025 / Published: 25 April 2025
(This article belongs to the Special Issue Genomics and Genetic Diversity in Vegetable Crops)

Abstract

The ubiquitin-specific protease (UBP) family constitutes the largest group within the deubiquitinating enzymes (DUBs) and plays a crucial role in regulating the cell cycle, growth, and developmental processes in living organisms. By utilizing genomic and transcriptomic databases, we employed bioinformatics tools to identify UBP family members within pepper genomes and to analyze the expression profiles of CaUBP genes under various abiotic stresses, as well as in different tissues and organs. Our findings revealed the presence of 40 CaUBPs in peppers, exhibiting significant variation in their physicochemical properties. Subcellular localization studies indicated that all CaUBPs are localized in the nucleus. Phylogenetic analysis categorized the 40 CaUBPs into 11 distinct subfamilies (G1–G11), with the largest subfamily comprising seven members. Members within the same subfamily displayed similar domain and motif structures. The promoter regions of CaUBP genes were found to be enriched with elements responsive to light, stress, and hormones. Syntenic analysis revealed that 12 CaUBPs were mapped to the Arabidopsis thaliana genome, suggesting potential functional conservation. Additionally, tandem duplications were observed in the alignment of two sets of genes within the pepper genome. CaUBPs were implicated in the stress response and organ growth, with CaUBP17/34/35 showing significant changes in expression under heat stress. While most genes were not expressed in leaves, the expression of several genes (CaUBP3/17/27/32/35/38) in flowers was significantly altered. This study establishes a foundation for further exploration of the roles of CaUBPs in pepper growth, development, and stress response mechanisms.

1. Introduction

Deubiquitination is a highly specific process mediated by deubiquitinating enzymes (DUBs), which cleave ubiquitin moieties from ubiquitin-conjugated protein substrates. DUBs catalyze the hydrolysis of isopeptide bonds—both between ubiquitin and target proteins and within polyubiquitin chains—thereby releasing free ubiquitin. This action modulates signal transduction across various cellular contexts, thereby altering the ubiquitination status of the target proteins [1]. The catalytic activity of DUBs is regulated by substrate- or scaffold-induced conformational changes, as demonstrated in multiple studies [2,3,4]. There are five distinct classes of DUBs: UBPs/USPs (ubiquitin-specific proteases), OTUs (ovarian tumor proteases), UCHs (ubiquitin carboxy-terminal hydrolases), JAMMs (enzymes with JAB1/MPN/Mov34 motifs), and MJDs (Machado–Joseph disease protein domain proteases, also known as josheppins) [5,6]. Among these, the UBP family is the largest and plays a pivotal role in regulating the dynamic balance of protein ubiquitination and deubiquitination [7]. Members of the UBP family possess two similar catalytic triads, each containing two short and highly conserved cysteine and histidine boxes, which constitute the core components of the catalytic site. The region encompassing the cysteine and histidine boxes is referred to as the UCH domain. This domain is spatially and structurally conserved, though the amino acid sequences of the UCH domains vary significantly among different members, with substantial differences in both the types and numbers of amino acids present [8].
Genetic and biochemical studies have identified that UBP plays a crucial role in plant development, including the regulation of the lant cell cycle, organ growth, embryonic development, flowering period, root growth, circadian rhythms, and responses to environmental stress [9]. Current analyses of UBP genes have primarily focused on elucidating the biological functions of individual genes. For instance, in maize (Zea mays L.), studies have revealed that under drought stress in primary roots, the expression levels of all ZmUBP genes were significantly reduced except for ZmUBP35 and ZmUBP17. Following high-temperature stress, the expression of ZmUBP37, ZmUBP42, ZmUBP7, ZmUBP29, ZmUBP31, and ZmUBP30 was markedly upregulated. Under low-temperature stress, different maize cultivars exhibited significant induction of ZmUBP16, ZmUBP6, ZmUBP33, ZmUBP11, and ZmUBP17. Additionally, ZmUBPs showed the highest expression levels in maize roots and embryos, while their expression was lowest in leaves. Notably, ZmUBP42 was not expressed in mature pollen but was highly expressed in all other tissues, whereas ZmUBP1 was expressed at high levels only in the root cortex and at low levels in other tissues. These findings suggest that ZmUBPs play diverse roles in plant abiotic stress responses and growth development [10]. Just as the ZmUBPs in maize exhibit diverse functions in abiotic stress responses and growth development, the UBP genes in Arabidopsis also play crucial and distinct roles. In Arabidopsis, the loss of function of AtUBP1 and AtUBP2 results in hypersensitivity to amino acid analogues, severe dwarfism, stunted root growth, and leaf yellowing [11].
The pepper species (Capsicum annuum L.), indigenous to Bolivia and regions of Central and South America [12], is an ancient cultivated plant revered for its rich nutritional value and a globally cherished vegetable. It has reigned as the world’s most popular condiment for over two centuries and remains the most widely consumed spicy seasoning worldwide. In its natural habitat, pepper is exposed to a myriad of adverse stresses, encompassing both biotic challenges (e.g., pests, diseases) and abiotic stressors (e.g., drought, extreme temperatures). The ubiquitin-specific protease (UBP) gene family is recognized for its significance in plant development and stress resistance. However, research on UBP genes in pepper has remained largely unexplored. To deepen our understanding of UBP’s role in abiotic stress responses and pepper growth, we systematically identified the UBP gene family across the entire pepper genome. Subsequent analyses of gene structures, physicochemical properties, conserved motifs, and expression patterns were instrumental in elucidating the biological functions of the CaUBP genes in pepper. In addition, by using leaves subjected to high-temperature treatment and flowers at different developmental stages as research subjects, the experimental design incorporating time gradients and temperature treatments enables dynamic tracking of the regulatory role of the CaUBP gene family in heat stress responses, while also revealing its expression patterns during flower development.

2. Materials and Methods

2.1. Plant Material, Growing Conditions, and Stress Treatments

The pepper cultivar ‘6421’ [13], generously supplied by the Hunan Vegetable Research Institute, served as the primary plant material for our experiments. The cultivar ‘6421’ has the characteristics of heat resistance, waterlogging tolerance, drought resistance, and disease resistance. The experimental specimens encompassed pepper leaves at various time intervals post heat stress treatment, specifically at 0, 1, 1.5, 3, 6, 12, and 24 h, at an elevated temperature of 40 °C. Additionally, we examined flowers (designated as F1–F9) across different developmental stages, ranging from the bud to the full bloom. A total of 3 biological replicates were set up in this experiment.

2.2. Data Preparation

The reference genome sequence of pepper (Zunla-1) was retrieved from the website (http://peppersequence.genomics.cn/) (accessed on 21 July 2024), and 27 identified UBP protein sequences of Arabidopsis were downloaded from Tair (https://www.arabidopsis.org/) (accessed on 23 July 2024).

2.3. Identification and Sequence Analysis of UBP Gene Family Members in Peppers

To accurately identify the UBP family members in pepper, a dual-method approach was employed. The initial method involved downloading the HMM model file for the conserved domain UCH of the UBP family from the InterPro database (https://www.ebi.ac.uk/interpro/entry/pfam/#table) (accessed on 23 July 2024), with the accession number PF00443. HMMSEARCH (v.3.2.1) was then utilized to retrieve candidate pepper sequences (with an E-value threshold of less than 1 × 10−5) that contain the UCH-conserved domain. The second method relied on BLASTp; BioEdit was used to construct a local protein database from Zunla-1 protein sequences, and 27 Arabidopsis UBP protein sequences served as the query sequences (also with an E-value threshold of less than 1 × 10−5). BLAST (v2.2.25) searches were conducted within the Zunla-1 local protein database to identify all candidate UBP family members in peppers. The results from both methods were then integrated. To confirm the conserved domains of the candidate members, SMART (http://smart.embl-heidelberg.de/) (accessed on 20 July 2024) and CDD (https://www.ncbi.nlm.nih.gov/cdd/) (accessed on 20 July 2024) were employed, retaining only those protein sequences that contained the UCH domain, thus identifying the UBP family members in peppers. Additionally, the online software ExPASy (https://www.expasy.org/) (accessed on 21 July 2024) was utilized to predict the molecular weight, pI (isoelectric point), instability index, aliphatic index, and grand average of hydropathicity for the CaUBP proteins. The subcellular localization of the members of the UBP family in pepper was predicted through the Plant-mPLoc website (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/) (accessed on 23 July 2024).

2.4. Phylogenetic Tree Construction

Clustal X (v.1.83) was utilized to align the pepper CaUBP protein sequences against 27 well-characterized Arabidopsis UBP protein sequences. Subsequently, a phylogenetic tree was constructed using the neighbor-joining method with 1000 bootstrap replicates, implemented in MEGA-X software (v.10.2.6).

2.5. Analysis of the Chromosomal Mapping, Gene Structure, Conserved Motif, and Cis-Acting Element of UBP Members in Peppers

The chromosome localization of the identified CaUBP genes was mapped using the online tool MG2C (http://mg2c.iask.in/mg2c_v2.1/index_cn.html) (accessed on 23 July 2024). The exon–intron architecture of the CaUBP genes was elucidated with the aid of TBtools (v.2.104). The MEME online tool (http://meme-suite.org/tools/meme) (accessed on 24 July 2024) was employed to search for the composition of conserved motifs within the CaUBP proteins, with a maximum motif limit set to 10. The 2.0 kb upstream sequences of the CaUBP genes, extracted using TBtools, were utilized to identify potential cis-acting elements. The PlantCARE database (http://bioinformatics.psb.ugent.be/webtools/plantcare/html/) (accessed on 24 July 2024) was then applied to predict these cis-acting elements in the promoters of the CaUBP genes. Following the screening process, the potential cis-acting elements were visualized using TBtools.

2.6. Collinearity Analysis of the UBP Gene Family

Genomic synteny analysis was conducted using the One Step MCScanX Fast plugin within the TBtools (v2.210) software suite to explore and visualize the homology of UBP genes across and within species, providing insights into their evolutionary relationships.

2.7. GO and Protein–Protein Interaction Network Analysis

The functional analysis of the UBP gene family members was carried out utilizing the online platform Blast2GO (http://www.blast2go.com) (accessed on 28 July 2024), which is designed to provide comprehensive functional annotation of genes. Additionally, the micro-bioinformatics-online bioinformatics analysis visualization cloud platform (https://www.bioinformatics.com.cn) (accessed on 28 July 2024) was employed for the collation and mapping of the data. To investigate the protein interaction network, the STRING database (https://cn.string-db.org/) (accessed on 28 July 2024) was engaged, with Arabidopsis selected as the reference species and an interaction score threshold set at 0.400 to filter significant interactions.

2.8. Expression Profile Analysis of UBP Family Members

The expression data of stress treatments (cold stress, heat stress, salt stress, ABA, GA3, H2O2, IAA), flower and fruit (pulp, placenta and seed, seed, placenta) development were downloaded from the PepperHub database (http://lifenglab.hzau.edu.cn/PepperHub/index.php) (accessed on 30 July 2024). The expression HeatMap of the CaUBP family gene was drawn using TBtools software.

2.9. RT-qPCR Analysis

The total RNA was extracted using the polysaccharide polyphenol plant total RNA extraction kit (spin column type) (Tiangen Biochemical Technology, Beijing, China). To accurately quantify the RNA, a NanoDrop spectrophotometer was employed. Since nucleic acids have a maximum absorption peak at 260 nm, the concentration of RNA was calculated based on this absorbance value, with the results presented in ng/μL. Additionally, the ratio of absorbance at 260 nm to 280 nm (A260/A280) was determined to assess the purity of the RNA. For this experiment, pure RNA samples with an A260/A280 ratio between 1.8 and 2.0 were considered suitable for further analysis. The first strand of cDNA was synthesized using the UnionScript First-strand cDNA Synthesis Mix for qPCR (Jinsha Biotechnology Beijing, China), with a final cDNA concentration of 1000–1500 ng/μL. The cDNA was stored at −20 °C for later use. The forward and reverse primers for the gene were designed using Primer 5.0 software (Table 1). β-Actin was used as the internal reference gene and was synthesized by Shanghai Biotech (Shanghai, China). Quantitative analysis was performed using the AceQ qPCR SYBR Green Master Mix from Novozan Bio (Thermo Fisher Scientific, Waltham, MA, USA), with calibration curves generated for validation. For the heat stress treatment, we employed a time-course approach. Pepper plants of the ‘6421’ cultivar were exposed to sustained heat stress at 40 °C. Leaf samples were then collected at 0 h, 1 h, 1.5 h, 3 h, 6 h, 12 h, and 24 h post-treatment. In the floral development study, flowers were sampled at nine distinct developmental stages (F1–F9). Three biological replicates were included for each treatment group. The reaction system consisted of 2 µL cDNA, 0.4 μL forward primer (10 μM), 0.4 μL reverse primer (10 μM), 10 µL Taq SYBR RT-qPCR master mixture, and 7.2 µL ddH2O. A total of 3 biological replicates were set up in this experiment. The relative expression levels of different genes were calculated using the 2−ΔΔCT method [14]. One-way analysis of variance (ANOVA) was performed to determine whether significant differences existed in the relative expression levels of target genes. If ANOVA indicated significant overall differences, Tukey’s honestly significant difference (HSD) post hoc test was subsequently conducted. Excel software was used to organize the analysis, and GraphPad Prism 9 was used to draw histograms. Significant differences were analyzed (p < 0.05).

3. Results

3.1. UBP Gene Family Member Identification, Physicochemical Characterization, and Subcellular Localization in Peppers

To identify UBP gene family members in peppers, we performed conserved domain analysis using the Conserved Domain Database (CDD) and Simple Modular Architecture Research Tool (SMART) and retained only sequences containing the UCH domain for further study. Through this rigorous screening, 40 CaUBP genes were identified. Through this rigorous screening, we identified 40 CaUBP genes. These genes were systematically designated as CaUBP1 to CaUBP40, based on their respective chromosomal locations.
Detailed information on the CaUBP genes is summarized in Table S1, including gene names, ID numbers, conserved domains, molecular weights, isoelectric points (pI), instability indices, aliphatic indices, grand average of hydropathicity (GRAVY), and subcellular localizations. In addition to the UCH domain, other conserved domains characteristic of the UBP family were identified, such as zf-UBP, zf-MYND, USP7_C2, USP7_ICP0_bdg, DUSP, ZnF_UBP, MATH, DUF627, and ZnF_C2H2. The amino acid lengths of CaUBP proteins ranged from 115 to 1694 residues. Their molecular weights varied from 13.11 kDa to 191.53 kDa, with isoelectric points ranging from 4.71 to 9.62. The instability index (a predictor of protein stability) ranged from 32.74 to 63.15, except for CaUBP12, CaUBP14, CaUBP20, CaUBP29, CaUBP37, and CaUBP39, which were classified as stable. The aliphatic index (an indicator of thermostability) spanned 64.65 to 106.44. Based on GRAVY values, all proteins were hydrophilic except CaUBP19, CaUBP21, and CaUBP38. Subcellular localization predictions indicated that all 40 CaUBP proteins were nuclear-localized.

3.2. Chromosomal Location, Gene Structure, and Conserved Motif Analysis of CaUBPs

The 40 CaUBP genes are asymmetrically distributed across 11 chromosomes (Figure 1). Chromosomes 0 and 1 exhibit the highest density, each containing 7 CaUBP genes, collectively accounting for 35% of the total. Chromosomes 3 and 12 rank second with 6 genes each (15% per chromosome), followed by chromosome 6 (3 genes, 7.5%). The remaining chromosomes (2, 4, 5, 7, 8, 9, 10, and 11) harbor 1–2 CaUBP genes each, indicating limited expansion of this gene family in these regions.
Conserved motif analysis identified 10 distinct motifs (designated Motif 1–10) within the CaUBP gene family (Figure 2A). Notably, CaUBP7, CaUBP25, CaUBP27, and CaUBP40 exhibit the highest motif complexity, each containing all 10 motifs. CaUBP13 exclusively retains Motif 1 and Motif 6, whereas Motif 7 is detected in six members (CaUBP7, CaUBP16, CaUBP25, CaUBP27, CaUBP33, CaUBP40). Both Motifs 8 and 9 are present in five distinct CaUBP genes. Phylogenetic analysis reveals the clustering of proteins sharing conserved motif patterns within the same clades, indicating functional conservation across evolutionarily related CaUBP members.
Gene structure analysis revealed substantial variation in exon numbers across the CaUBP family (Figure 2B), ranging from 2 to 32 exons per gene. CaUBP40 exhibits the highest exon count (32), followed closely by CaUBP27 and CaUBP33 with 31 exons each. In contrast, CaUBP20, CaUBP24, and CaUBP39 display the simplest architectures, containing only two exons. Notably, over 70% of CaUBP genes possess fewer than 20 exons, demonstrating significant structural diversity within this gene family.

3.3. Phylogenetic Analysis

A phylogenetic analysis was performed to elucidate the evolutionary relationships within the CaUBP gene family, incorporating 27 Arabidopsis UBP proteins and 40 pepper UBP proteins, as illustrated in Figure 3. The resulting phylogenetic tree categorized all protein sequences into 11 distinct subfamilies, labeled G1 through G11, with at least one CaUBP member present in each subfamily. The G1 subfamily includes CaUBP17 and CaUBP28, while the G2 subfamily encompasses CaUBP7, CaUBP16, CaUBP25, CaUBP27, CaUBP33, and CaUBP40. The G3 subfamily is unique, containing only the CaUBP36 protein. The G4 subfamily comprises CaUBP4, CaUBP5, CaUBP11, CaUBP15, and CaUBP34, whereas the G5 subfamily consists of CaUBP8, CaUBP26, CaUBP31, and CaUBP32. The G6 subfamily is composed of CaUBP30 and CaUBP37, and the G7 subfamily includes CaUBP13, CaUBP18, and CaUBP38. The G8 subfamily contains CaUBP22, CaUBP24, and CaUBP39; the G9 subfamily includes CaUBP3, CaUBP6, CaUBP23, and CaUBP35; and the G10 subfamily consists of CaUBP2, CaUBP10, and CaUBP29. The G11 subfamily is the most populous, containing seven proteins: CaUBP1, CaUBP9, CaUBP12, CaUBP14, CaUBP19, CaUBP20, and CaUBP21.

3.4. Analysis of Cis-Acting Elements in the Promoter Region of CaUBP Genes

We identified potential cis-regulatory elements within the 2.0 kb upstream regions of the CaUBPs using the PlantCARE database. The analysis revealed a total of 33 distinct cis-acting elements across the 40 CaUBP genes. These elements included the GATA-motif, TCCC-motif, AE-box, GT1-motif, G-box, I-box, 3-AF1 binding site, TCT-motif, ATI-motif, ATC-motif, Sp1, and elements associated with the light response, such as the ACE. Additionally, we detected elements involved in the hormone response, including the TCA-element, P-box, TGACG-motif, CGTCA-motif, ABRE, TATC-box, and GARE-motif. Stress response elements included MYC, MBS, ARE GC-motif, LTR, and TC-rich repeats, with the ARE (Antioxidant Responsive Element) being the most prevalent, constituting 11.7% of the total. Elements related to growth and development comprised the A-box, O2-site, RY-element, HD-Zip 1, and CCAAT-box. The circadian element, associated with circadian rhythms and a component of the conserved DNA module array (CMA3), was linked to a 3-AF3 binding site, as shown in Figure 4. The promoters of the CaUBP gene family members varied in the types and quantities of cis-acting elements they contained. Further analysis indicated the presence of HSE-like (Heat Shock Element-like) elements, such as the CCAAT-box, in the promoter regions of CaUBP genes, suggesting that the expression of these genes may be modulated by heat-responsive elements and proteins.

3.5. Collinearity Analysis

The primary mechanisms driving the expansion of plant gene families include tandem and segmental duplications. Using TBtools, we performed collinearity analysis of the CaUBP gene family (Figure 5). The 40 CaUBP genes are asymmetrically distributed across 11 chromosomes, showing no significant correlation with chromosome size. Within the CaUBP family, two segmental duplication events were identified: (1) CaUBP25 (chromosome 5) and CaUBP40 (chromosome 12) and (2) CaUBP9 and CaUBP13 (chromosome 1). Additionally, synteny analysis between Capsicum annuum and Arabidopsis thaliana revealed 12 orthologous gene pairs (Figure 6).

3.6. GO Analysis and Protein–Protein Interaction Network Analysis

Blast2GO was employed to annotate the CaUBP gene family, as shown in Figure 7. The annotation results indicated that a total of 11 genes were involved in biological processes (GO:0008150), 6 genes are associated with cellular metabolic processes (GO:0044237), and 10 genes participate in the metabolism of organic substances (GO:0071704). Regarding cellular components, 13 UBP genes were found to be localized within cells (GO:0005622). A minority of UBP genes were identified in the nucleus (GO:0005730) and associated with membrane-bound organelles. In terms of molecular function (MF), one UBP gene was annotated with protein binding activity (GO:0005515).
The analysis of the protein–protein interaction network revealed that a total of 21 proteins within the UBP family are involved in interactions (Figure 8). Notably, UBP3, UBP6, UBP12, UBP13, UBP24, UBP26, and UBP27 exhibited the highest interaction strengths, with line darkness proportional to interaction intensity. The network comprised 21 nodes, 54 edges, an average node degree of 5.14, and an average local clustering coefficient of 0.599.

3.7. CaUBP Family Expression Analysis

To elucidate the biological functions of the CaUBP genes, we leveraged the PepperHub database and employed TBtools to investigate the expression patterns of these genes in response to various abiotic stresses, including ABA, cold, GA3, H2O2, heat, IAA, and NaCl, as well as across different tissues and organs, such as leaves, flowers, pulp, placenta and seeds, seeds, and placentas. The findings revealed that CaUBP35 exhibited rapid upregulation (peak at 1–1.5 h), contrasting with its low expression under other stresses (Figure 9). The expression level of CaUBP34 changes significantly under heat stress, and the highest expression level is observed at 24 h. In contrast, the expression levels of CaUBP1, CaUBP2, CaUBP4, CaUBP12, CaUBP13, CaUBP14, CaUBP16, CaUBP17, CaUBP19, CaUBP20, CaUBP24, CaUBP27, and CaUBP38 remained consistently low across all treatments. Conversely, CaUBP7, CaUBP11, CaUBP23, CaUBP29, CaUBP30, and CaUBP36 displayed higher expression levels under a range of stress treatments. The tissue and organ expression patterns (Figure 10) indicated that, except for CaUBP10, CaUBP19, and CaUBP27, the other genes were not expressed in leaves. CaUBP10 was highly expressed, while CaUBP19 and CaUBP27 exhibited low expression levels. CaUBP1, CaUBP4, CaUBP12, CaUBP13, CaUBP14, CaUBP16, CaUBP19, CaUBP20, and CaUBP21 exhibited very low expression in tissues and organs other than leaves, whereas CaUBP7, CaUBP8, CaUBP11, CaUBP23, CaUBP25, CaUBP29, CaUBP30, CaUBP31, CaUBP33, CaUBP36, and CaUBP37 demonstrated higher expression in tissues and organs apart from leaves. Certain genes exhibited distinct expression changes in specific tissues and organs, such as CaUBP35, CaUBP17, CaUBP27, CaUBP28, CaUBP3, CaUBP32, and CaUBP5. The expression level of CaUBP6 fluctuated following the emergence of flower buds, and its expression in fruits varied significantly from 10 to 60 days after pollination.

3.8. Analysis of the Relative Expression of the CaUBP Gene

To investigate the expression patterns of CaUBP in peppers under various stress conditions and across different tissues and organs, a subset of seven genes (CaUBP3, CaUBP17, CaUBP27, CaUBP32, CaUBP34, CaUBP35, and CaUBP38) was selected from the 40 based on their gene expression dynamics. Figure 11 illustrates these patterns; specifically, it shows that CaUBP17 exhibited its highest expression level at 24 h and its lowest at 3 h under heat stress. Statistical analysis revealed that the expression level at 24 h was significantly higher than at other time points (p < 0.05), while no significant differences were observed between 1 h and 6 h or between 1.5 h and 3 h. The expression level of CaUBP34 peaked after 24 h of heat stress treatment, generally displaying a trend of initial decrease followed by an increase. The times 1.5 h and 3 h showed no significant differences (p > 0.05), while significant differences were observed between 0 h and 6 h, 12 h, and 24 h (p < 0.05). The relative expression of the CaUBP34 gene exhibited marked temporal variations, with 24 h displaying statistically significant differences compared to all other time points (p < 0.05). In contrast, CaUBP35 peaked at 1 h under thermal stress, with the expression level at 0 h being the lowest, quantified as only 1, indicating an overall trend of initial increase followed by a decrease. The expression levels at 0 h, 6 h, 12 h, and 24 h all remained relatively low, with each showing significant differences from most other time points (p < 0.05). Notably, the expression at 1 h was significantly higher than all other time points except 1.5 h (no significant difference, p > 0.05), forming a distinct early response peak before subsequent downregulation.
Throughout flower development (as seen in Figure 11), the expression levels of CaUBP3, CaUBP32, and CaUBP38 exhibited fluctuations. Initially, the expression levels of these genes decreased, followed by an increase, and then another decrease, with the expression level of F4 marking the low peak of the initial change. The relative expression levels of CaUBP17, CaUBP27, and CaUBP35 generally followed a downward trend, with significantly higher expression levels observed at 0 h and 1 h. For the CaUBP3 gene, there were no significant differences among F1, F2, F5, and F6, and their expression levels were significantly higher than those in F3, F4, F7, F8, and F9. There were no significant differences between F8 and F9. For the CaUBP17 gene, the expression level in F1 was significantly higher than that in other periods. F2 had significant differences in some periods. There were no significant differences between F3 and F5, and there were also no significant differences between F8 and F9. For the CaUBP27 gene, F1 was significantly higher than other periods, and F2 was also relatively high. There were no significant differences between F6 and F7 or among F4, F8, and F9. For the CaUBP32 gene, there were no significant differences between F1 and F6, and their expression levels were significantly higher than those in most other periods. There were no significant differences among F2, F5, and F7 or among F4, F8, and F9. For the CaUBP35 gene, F2 was significantly higher than other periods, and there were no significant differences among F4–F9. For the CaUBP38 gene, there were no significant differences among F1, F2, and F5, and their expression levels were significantly higher than those in F3, F4, and other periods. There were no significant differences among F3, F7, and F9.

4. Discussion

UBPs and deubiquitinating enzymes share analogous biological roles, being integral to the regulation of plant growth and development, stress responses, and the mediation of various signal transduction pathways. Currently, the literature is lacking on the functions of plant deubiquitinating enzymes, with the known physiological functions primarily encompassing hormone regulation and stress response [15]. UBPs are engaged in the modulation of plant morphogenesis, the transduction of immune stress signals, and programmed cell death in plants. In contrast, there is a relatively extensive body of research in the field of animal (medical) studies, which mainly focuses on topics such as tumor and cancer development [16], neural and germ cell differentiation, and DNA damage repair, among others. However, the specific functions and roles of UBPs in pepper remain unconfirmed. Research has demonstrated that UBP3/UBP4 double mutants display a distinct lethal phenotype in Arabidopsis, yet there is no significant phenotypic difference observed between the two single mutants and the controls, suggesting that UBP3 and UBP4 may play a role in the regulation of plant gamete formation and pollen germination [17]. JINFENG [18] pointed out that AtUBP24 is a negative regulator of abscisic acid signaling and salt stress tolerance in Arabidopsis, and the absence of the AtUBP24 gene may enhance the sensitivity of Arabidopsis to drought stress.
In this study, bioinformatics approaches were employed to identify 40 CaUBP members, a number surpassing that of Arabidopsis, which has 27 members. This discrepancy suggests a degree of numerical variation within the UBP family across different species, implying potential functional divergence among them. Physicochemical analyses revealed significant differences in amino acid length, molecular weight, and isoelectric point among CaUBPs, indicating functional, structural, and expression pattern diversity. Examination of the gene structure and conserved motifs of CaUBPs demonstrated that genes within the same subfamily shared similarities in structure and motifs, suggesting conserved roles in pepper growth and development. However, pronounced differences in gene structure and conserved motifs were observed among distinct subfamilies, indicating their distinct physiological roles in pepper. Phylogenetic analysis results indicated high homology between most CaUBP and AtUBP sequences, suggesting analogous functions. The distribution of UBPs across different taxa within the same species highlights the evolutionary diversity of UBPs among species.
The promoter’s cis-acting elements are pivotal regulators in the initiation of gene transcription and are essential for understanding gene regulation [18]. The CaUBP family’s enrichment in light-responsive and stress-responsive elements suggests that UBP genes are implicated in the abiotic stress response of pepper and may be involved in pepper growth and development through photoregulation and stress response mechanisms. Gene duplication is crucial for plants to adapt to environmental changes and is necessary for gene evolution and amplification [19,20]. There are significant differences in the types and numbers of promoters among the 40 CaUBP genes. For example, the ARE element appears in the promoters of many CaUBP genes, suggesting that the ARE element may have a certain degree of conservation in the promoters of the gene family and play an important role in gene expression regulation. It may be involved in the response process of pepper to various stresses. Syntenic analysis results revealed tandem duplications in two groups of genes within the pepper genome alignment. Additionally, 12 groups of duplications were identified in the comparison of UBP genes between pepper and Arabidopsis. Both species possess chromosomes devoid of UBP genes, suggesting an uneven distribution of UBP family members across chromosomes and the potential significance of these transcription factors in pepper gene amplification.
Utilizing TBtools, we analyzed the expression patterns of the CaUBP family members and discovered that a subset of CaUBP genes exhibited tissue-specific expression in pepper. For instance, CaUBP35 showed a significant change in expression under heat stress; it was notably absent in leaves but exhibited higher expression levels in other tissues. To ascertain how environmental conditions influence the expression of UBP genes in pepper, we scrutinized the expression pattern of CaUBP35 under heat stress using RT-qPCR. Our findings indicated that the expression peaked at 1 h and subsequently declined. In other plant species, such as Arabidopsis, UBP16 is induced by salt stress, preventing cell death and activating plasma membrane Na+/H+ reverse transport by reducing ROS accumulation. This suggests that UBP16 may have a particularly significant role in the salt stress response [21]. ZmUBP14, found in maize, is highly expressed in roots, stems, and leaves and shows a positive response to drought, low temperature, heat stress, IAA, and SA [22]. In summary, the UBP gene may serve a regulatory function in the response to exogenous hormones and abiotic stresses, highlighting its potential importance in plant adaptation and stress tolerance mechanisms.
A multitude of studies have demonstrated the involvement of UBPs in the control of growth. For instance, research on yeast has uncovered processes that are partially regulated by UBPs, encompassing stress response, energy metabolism, nutrient utilization, and sexual reproduction [10,23,24]. In the plant kingdom, UBPs have been implicated in a range of cellular processes, including cell proliferation [25,26], endoreduplication [11], root hair elongation [8], root differentiation [27], regulation of flowering time [28], pollen development and dispersal [29], resistance to canavanine [30], modulation of MYC2 levels in response to jasmonic acid [31], abscisic acid (ABA)-mediated resistance to salt and drought stress [32], and defense against pathogens [33,34]. Concurrent with these findings, the transcriptome data from this study indicated significant expression of CaUBP17, CaUBP34, and CaUBP35 under heat stress, with noticeable changes observed. The RT-qPCR validation results were in alignment with the transcriptome expression patterns, suggesting that the expression of the antioxidant system in pepper cells may be altered under heat stress, consequently affecting the expression of CaUBP genes. Furthermore, the study revealed that the expression level of the maize ZmUBP37 gene showed the most significant upregulation under high-temperature stress [10], demonstrating the crucial role of UBP genes in responding to heat stress. The downregulation of CaUBP17, CaUBP27, and CaUBP35 during flower development implies that the CaUBP gene family may fulfill specific functions related to stress response, growth, and developmental processes. In addition, cis—acting elements are closely related to gene expression results. For example, under heat stress, the expression of the CaUBP35 gene is rapidly upregulated. It is likely that the stress-responsive elements in its promoter sense the heat signal and promote transcriptional transcription, thus participating in the plant’s response to heat stress and protecting plant cells from damage. During flower development, the expression of some genes such as CaUBP3, CaUBP17, CaUBP27, CaUBP32, CaUBP35, and CaUBP38 changes. This may be the result of the regulatory effect of growth—and development—related elements in the promoter at specific developmental stages. Although this study concluded that the CaUBP gene has a regulatory role in flower development based on its expression changes during the process, this conclusion has limitations. Since the experiments only focused on gene expression changes, the influence of indirect effects cannot be entirely ruled out. To further investigate the mechanism of the CaUBP gene in flower development, follow-up studies could employ gene-editing technologies, such as the CRISPR/Cas9 system, to knockout or overexpress specific CaUBP genes and directly observe their effects on flower development.

5. Conclusions

In the present study, we identified a total of 40 CaUBP genes within the entire genome of peppers and conducted a comprehensive analysis of their physicochemical properties, chromosomal localization, gene structure, promoter cis-acting elements, collinearity, GO annotations, protein–protein interactions, responses to abiotic stress, and expression patterns in various tissues and organs. RT-qPCR analysis revealed that the CaUBP genes may play a role in the response to heat stress as well as in the development of flowers and fruits. This research establishes a foundation for further investigation into the functional roles and stress response mechanisms of the CaUBP genes in pepper, while also expediting functional studies related to their involvement in pepper growth, development, and stress responses.

Supplementary Materials

The following supporting information can be downloaded at https://www.mdpi.com/article/10.3390/horticulturae11050458/s1: Table S1: Basic information on the whole genome of CaUBP.

Author Contributions

Conceptualization, J.W.; methodology, X.C., T.W., and J.W.; software, X.C.; writing—original draft preparation, X.C. and T.W.; writing—review and editing, X.C., T.W., and J.W.; visualization, X.C., T.W., J.H., J.X., Y.R., and J.W.; supervision, J.W.; project administration, Y.L.; funding acquisition, Y.L. and J.W. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Shanxi Province Science Foundation for Youths (202203021212451), Shanxi Key Laboratory of Germplasm Resources Innovation and Utilization of Vegetable and Flower (SCHHZDSYS2024-6), Key Project of the Key Research and Development Program of Shanxi Province (202202140601006), and Shanxi Science and Technology Innovation Talent Team (202304051001018).

Data Availability Statement

The data used for the analysis in this study are available in the article and the Supplementary Materials.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

The following abbreviations are used in this manuscript:
DUBsDeubiquitinating Enzymes
UBPUbiquitin-specific Protease UBP
USPsubiquitin-specific proteases
OTUsovarian tumor proteases
UCHsubiquitin carboxy-terminal hydrolases
JAMMsenzymes with JAB1/MPN/Mov34 motifs
MJDsMachado–Joseph disease protein domain proteases
GRAVYgrand average of hydropathicity

References

  1. Kalinowska, K.; Nagel, M.K.; Goodman, K.; Cuyas, L.; Anzenberger, F.; Alkofer, A.; Paz-Ares, J.; Braun, P.; Rubio, V.; Otegui, M.S.; et al. Arabidopsis ALIX is required for the endosomal localization of the deubiquitinating enzyme AMSH3. Proc. Natl. Acad. Sci. USA 2015, 112, E5543–E5551. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Avvakumov, G.V.; Walker, J.R.; Xue, S.; Finerty, P.J., Jr.; Mackenzie, F.; Newman, E.M.; Dhe-Paganon, S. Amino-terminal dimerization, NRDP1-rhodanese interaction, and inhibited catalytic domain conformation of the ubiquitin-specific protease 8 (USP8). J. Biol. Chem. 2006, 281, 38061–38070. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Hu, M.; Li, P.; Song, L.; Jeffrey, P.D.; Chenova, T.A.; Wilkinson, K.D.; Cohen, R.E.; Shi, Y. Structure and mechanisms of the proteasome-associated deubiquitinating enzyme USP14. EMBO J. 2005, 24, 3747–3756. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Hu, M.; Li, P.; Li, M.; Li, W.; Yao, T.; Wu, J.W.; Gu, W.; Cohen, R.E.; Shi, Y. Crystal structure of a UBP-family deubiquitinating enzyme in isolation and in complex with ubiquitin aldehyde. Cell 2002, 111, 1041–1054. [Google Scholar] [CrossRef] [Scilit]
  5. Haq, S.; Ramakrishna, S. Deubiquitylation of deubiquitylases. Open Biol. 2017, 7, 17700116. [Google Scholar] [CrossRef] [Scilit]
  6. Komander, D.; Clague, M.J.; Urbé, S. Breaking the chains: Structure and function of the deubiquitinases. Nat. Rev. Mol. Cell Biol. 2009, 10, 550–563. [Google Scholar] [CrossRef] [Scilit]
  7. Cao, Y.; Li, Y.; Wang, L.; Zhang, L.; Jiang, L. Evolution and function of ubiquitin-specific proteases (UBPs): Insight into seed development roles in plants. Int. J. Biol. Macromol. 2022, 221, 796–805. [Google Scholar] [CrossRef] [Scilit]
  8. Liu, Y.; Wang, F.; Zhang, H.; He, H.; Ma, L.; Deng, X.W. Functional characterization of the Arabidopsis ubiquitin-specific protease gene family reveals specific role and redundancy of individual members in development. Plant J. Cell Mol. Biol. 2008, 55, 844–856. [Google Scholar] [CrossRef] [Scilit]
  9. Xu, M.; Jin, P.; Liu, T.; Gao, S.; Zhang, T.; Zhang, F.; Han, X.; He, L.; Chen, J.; Yang, J. Genome-wide identification and characterization of UBP gene family in wheat (Triticum aestivum L). PeerJ 2021, 9, e11594. [Google Scholar] [CrossRef] [Scilit]
  10. Fu, W.; Fan, D.; Liu, S.; Bu, Y. Genome-wide identification and expression analysis of Ubiquitin-specific protease gene family in maize (Zea mays L). BMC Plant Biol. 2024, 24, 4. [Google Scholar] [CrossRef] [Scilit]
  11. Yan, N.; Doelling, J.H.; Falbel, T.G.; Durski, A.M.; Vierstra, R.D. Vierstra. The ubiquitin-specific protease family from Arabidopsis. AtUBP1 and 2 are required for the resistance to the amino acid analog canavanine. Plant Physiol. 2000, 124, 1828–1843. [Google Scholar] [CrossRef] [Scilit]
  12. Xu, Y.; Jin, W.; Li, N.; Zhang, W.; Liu, C.; Li, C.; Li, Y. Ubiquitin-specific protease14 interacts with ultraviolet-b insensitive4 to regulate endoreduplication and cell and organ growth in Arabidopsis. Plant Cell 2016, 28, 1200–1214. [Google Scholar] [PubMed]
  13. Liu, F.; Yu, H.; Deng, Y.; Zheng, J.; Liu, M.; Ou, L.; Yang, B.; Dai, X.; Ma, Y.; Feng, S.; et al. PepperHub, an Informatics Hub for the Chili Pepper Research Community. Mol. Plant 2017, 10, 1129–1132. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  15. Kraft, K.H.; Brown, C.H.; Nabhan, G.P.; Luedeling, E.; de Luna Ruiz, J.J.; Coppens d’ Eeckenbrugge, G.; Hijmans, R.J.; Gepts, P. Multiple lines of evidence for the origin of domesticated chili pepper, Capsicum annuum, in Mexico. Proc. Natl. Acad. Sci. USA 2014, 111, 6165–6170. [Google Scholar] [CrossRef] [Scilit]
  16. Yi, P.; Xia, W.; Wu, R.C.; Lonard, D.M.; Hung, M.C.; O’ Malley, B.W. SRC-3 coactivator regulates cell resistance to cytotoxic stress via TRAF4-mediated p53 destabilization. Genes Dev. 2013, 27, 274–287. [Google Scholar] [CrossRef] [Scilit]
  17. Oh, K.H.; Yang, S.W.; Park, J.M.; Seol, J.H.; Iemura, S.; Natsume, T.; Murata, S.; Tanaka, K.; Jeon, Y.J.; Chung, C.H. Control of AIF-mediated cell death by antagonistic functions of CHIP ubiquitin E3 ligase and USP2 deubiquitinating enzyme. Cell Death Differ. 2011, 18, 1326–1336. [Google Scholar] [CrossRef] [Scilit]
  18. Zhao, J.; Zhou, H.; Zhang, M.; Gao, Y.; Li, L.; Gao, Y.; Li, M.; Yang, Y.; Guo, Y.; Li, X. Ubiquitin-specific protease 24 negatively regulates abscisic acid signalling in Arabidopsis thaliana. Plant Cell Environ. 2016, 39, 427–440. [Google Scholar] [CrossRef] [Scilit]
  19. Hernandez-Garcia, C.M.; Finer, J.J. A novel cis-acting element in the GmERF3 promoter contributes to inducible gene expression in soybean and tobacco after wounding. Plant Cell Rep. 2016, 35, 303–316. [Google Scholar] [CrossRef] [Scilit]
  20. Gu, Z.; Steinmetz, L.M.; Gu, X.; Scharfe, C.; Davis, R.W.; Li, W.H. Role of duplicate genes in genetic robustness against null mutations. Nature 2003, 421, 63–66. [Google Scholar] [CrossRef] [Scilit]
  21. Bowers, J.E.; Chapman, B.A.; Rong, J.; Paterson, A.H. Unravelling angiosperm genome evolution by phylogenetic analysis of chromosomal duplication events. Nature 2003, 422, 433–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  22. Zhou, H.; Zhao, J.; Yang, Y.; Chen, C.; Liu, Y.; Jin, X.; Chen, L.; Li, X.; Deng, X.W.; Schumaker, K.S.; et al. Ubiquitin-specific protease16 modulates salt tolerance in Arabidopsis by regulating Na+/H+ antiport activity and serine hydroxymethyltransferase stability. Plant Cell 2012, 24, 5106–5122. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Auesukaree, C.; Damnernsawad, A.; Kruatrachue, M.; Pokethitiyook, P.; Boonchird, C.; Kaneko, Y.; Harashima, S. Genome-wide identification of genes involved in tolerance to various environmental stresses in Saccharomyces cerevisiae. J. Appl. Genet. 2009, 50, 301–310. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Dudley, A.M.; Janse, D.M.; Tanay, A.; Shamir, R.; Church, G.M. A global view of pleiotropy and phenotypically derived gene function in yeast. Mol. Syst. Biol. 2005, 1, 2005.0001. [Google Scholar] [CrossRef] [Scilit]
  25. Du, L.; Li, N.; Chen, L.; Xu, Y.; Li, Y.; Zhang, Y.; Li, C.; Li, Y. The ubiquitin receptor DA1 regulates seed and organ size by modulating the stability of the ubiquitin-specific protease UBP15/SOD2 in Arabidopsis. Plant Cell 2014, 26, 665–677. [Google Scholar] [CrossRef] [Scilit]
  26. Kahana, A. The deubiquitinating enzyme Dot4p is involved in regulating nutrient uptake. Biochem. Biophys. Res. Commun. 2001, 282, 916–920. [Google Scholar] [CrossRef] [Scilit]
  27. Doelling, J.H.; Yan, N.; Kurepa, J.; Walker, J.; Vierstra, R.D. The ubiquitin-specific protease UBP14 is essential for early embryo development in Arabidopsis thaliana. Plant J. Cell Mol. Biol. 2001, 27, 393–405. [Google Scholar] [CrossRef] [Scilit]
  28. An, Z.; Liu, Y.; Ou, Y.; Li, J.; Zhang, B.; Sun, D.; Sun, Y.; Tang, W. Regulation of the stability of RGF1 receptor by the ubiquitin-specific proteases UBP12/UBP13 is critical for root meristem maintenance. Proc. Natl. Acad. Sci. USA 2018, 115, 1123–1128. [Google Scholar] [CrossRef] [Scilit]
  29. Derkacheva, M.; Liu, S.; Figueiredo, D.D.; Gentry, M.; Mozgova, I.; Nanni, P.; Tang, M.; Mannervik, M.; Köhler, C.; Hennig, L. H2A deubiquitinases UBP12/13 are part of the Arabidopsis polycomb group protein system. Nat. Plants 2016, 2, 16126. [Google Scholar] [CrossRef] [Scilit]
  30. Wu, R.; Shi, Y.; Zhang, Q.; Zheng, W.; Chen, S.; Du, L.; Lu, C. Genome-Wide Identification and Characterization of the UBP Gene Family in Moso Bamboo (Phyllostachys edulis). Int. J. Mol. Sci. 2019, 20, 4309. [Google Scholar] [CrossRef] [Scilit]
  31. Nassrallah, A.; Rougée, M.; Bourbousse, C.; Drevensek, S.; Fonseca, S.; Iniesto, E.; Ait-Mohamed, O.; Deton-Cabanillas, A.F.; Zabulon, G.; Ahmed, I.; et al. DET1-mediated degradation of a SAGA-like deubiquitination module controls H2Bub homeostasis. Elife 2018, 7, e37892. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Doelling, J.H.; Phillips, A.R.; Soyler-Ogretim, G.; Wise, J.; Chandler, J.; Callis, J.; Otegui, M.S.; Vierstra, R.D. The ubiquitin-specific protease subfamily UBP3/UBP4 is essential for pollen development and transmission in Arabidopsis. Plant Physiol. 2007, 145, 801–813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Zhou, H.; Zhao, J.; Cai, J.; Patil, S.B. Ubiquitin-Specific Proteases function in plant development and stress responses. Plant Mol. Biol. 2017, 94, 565–576. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Jeong, J.S.; Jung, C.; Seo, J.S.; Kim, J.K.; Chua, N.H. The Deubiquitinating Enzymes UBP12 and UBP13 Positively Regulate MYC2 Levels in Jasmonate Responses. Plant Cell 2017, 29, 1406–1424. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Distribution of the CaUBP gene family on 12 chromosomes in pepper.
Figure 1. Distribution of the CaUBP gene family on 12 chromosomes in pepper.
Horticulturae 11 00458 g001
Figure 2. Conserved protein motif (A) and gene structure analysis (B) of CaUBP genes.
Figure 2. Conserved protein motif (A) and gene structure analysis (B) of CaUBP genes.
Horticulturae 11 00458 g002
Figure 3. Phylogenetic tree of UBP protein in pepper and Arabidopsis.
Figure 3. Phylogenetic tree of UBP protein in pepper and Arabidopsis.
Horticulturae 11 00458 g003
Figure 4. Cis-acting elements in the promoter regions of the pepper UBP gene family.
Figure 4. Cis-acting elements in the promoter regions of the pepper UBP gene family.
Horticulturae 11 00458 g004
Figure 5. The inter-genomic collinearity of CaUBP genes in peppers. The innermost circle, Chr00-12, represents the chromosomes of pepper, with the yellow band indicating gene density across each chromosome. The outermost circle displays the chromosomal distribution of the 40 CaUBP genes. The gray and red lines represent the gene duplications of all genes and 40 CaUBP genes in the pepper genome during evolution, respectively.
Figure 5. The inter-genomic collinearity of CaUBP genes in peppers. The innermost circle, Chr00-12, represents the chromosomes of pepper, with the yellow band indicating gene density across each chromosome. The outermost circle displays the chromosomal distribution of the 40 CaUBP genes. The gray and red lines represent the gene duplications of all genes and 40 CaUBP genes in the pepper genome during evolution, respectively.
Horticulturae 11 00458 g005
Figure 6. Synteny analysis of UBP genes between peppers and Arabidopsis. The grey line represents the gene duplication that occurred between all genes in the pepper genome and all genes in the Arabidopsis genome during evolution. The red line represents the gene duplication between the UBP gene of peppers and the UBP gene of peppers that appeared during evolution. The green column and yellow column represent the chromosomes of peppers and Arabidopsis.
Figure 6. Synteny analysis of UBP genes between peppers and Arabidopsis. The grey line represents the gene duplication that occurred between all genes in the pepper genome and all genes in the Arabidopsis genome during evolution. The red line represents the gene duplication between the UBP gene of peppers and the UBP gene of peppers that appeared during evolution. The green column and yellow column represent the chromosomes of peppers and Arabidopsis.
Horticulturae 11 00458 g006
Figure 7. GO functional classifications of the pepper UBP family.
Figure 7. GO functional classifications of the pepper UBP family.
Horticulturae 11 00458 g007
Figure 8. Prediction of the CaUBP protein interactions network in pepper. The same color represents proteins with similar functions or similar structures; Q8H148_ARATH: Ubiquitin C-terminal hydrolase superfamily proteins; F4JCR1_ARATH, F4JCR3_ARATH: Ubiquitin carboxy-terminal hydrolase-associated proteins.
Figure 8. Prediction of the CaUBP protein interactions network in pepper. The same color represents proteins with similar functions or similar structures; Q8H148_ARATH: Ubiquitin C-terminal hydrolase superfamily proteins; F4JCR1_ARATH, F4JCR3_ARATH: Ubiquitin carboxy-terminal hydrolase-associated proteins.
Horticulturae 11 00458 g008
Figure 9. The expression profile of CaUBP genes under different treatments. The 40-day-old seedlings were treated under different stresses, and the leaves of pepper were sampled at 0 h, 1 h, 1.5 h, 3 h, 6 h, 12 h, and 24 h. ABA: 30 μM Cold: 10 °C GA3: 2 µM H2O2: 30 mM Heat: 40 °C IAA: 2 µM NaCl: 200 mM.
Figure 9. The expression profile of CaUBP genes under different treatments. The 40-day-old seedlings were treated under different stresses, and the leaves of pepper were sampled at 0 h, 1 h, 1.5 h, 3 h, 6 h, 12 h, and 24 h. ABA: 30 μM Cold: 10 °C GA3: 2 µM H2O2: 30 mM Heat: 40 °C IAA: 2 µM NaCl: 200 mM.
Horticulturae 11 00458 g009
Figure 10. Expression profiles of CaUBP genes in different organs. F1–F9: After the appearance of flower buds; G1–G11:Fruits 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; ST1, ST2: Fruits 10, 15 days after pollination; S3–S11: Fruits 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; T3–T11: Fruits 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; L1–L9: 2, 5, 10, 15, 20, 25, 30, 40, 50, 60 days after the emergence of new leaves.
Figure 10. Expression profiles of CaUBP genes in different organs. F1–F9: After the appearance of flower buds; G1–G11:Fruits 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; ST1, ST2: Fruits 10, 15 days after pollination; S3–S11: Fruits 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; T3–T11: Fruits 20, 25, 30, 35, 40, 45, 50, 55, 60 days after pollination; L1–L9: 2, 5, 10, 15, 20, 25, 30, 40, 50, 60 days after the emergence of new leaves.
Horticulturae 11 00458 g010
Figure 11. The relative expression levels and RNA-Seq data of seven representative genes in the UBP gene family in pepper. Relative expression of CaUBP17/CaUBP34/CaUBP35 under heat stress. Relative expression of CaUBP3/CaUBP17/CaUBP27/CaUBC32/CaUBC35/CaUBC38 during flower development. The orange-red line represents RNA-Seq (FPKM) data, while the blue columns indicates relative expression levels. The orange-red and blue error bars represent the standard error (SE).
Figure 11. The relative expression levels and RNA-Seq data of seven representative genes in the UBP gene family in pepper. Relative expression of CaUBP17/CaUBP34/CaUBP35 under heat stress. Relative expression of CaUBP3/CaUBP17/CaUBP27/CaUBC32/CaUBC35/CaUBC38 during flower development. The orange-red line represents RNA-Seq (FPKM) data, while the blue columns indicates relative expression levels. The orange-red and blue error bars represent the standard error (SE).
Horticulturae 11 00458 g011
Table 1. The primer sequences used in the experiment.
Table 1. The primer sequences used in the experiment.
Gene NameForward Primers (5’→3’)Reverse Primers (5’→3’)
CaUBP3AGAATCTACCCTCGGCGAATTGCTGGACATGAGAACTTGC
CaUBP17ACCCTGACATGGTTGAAAGCCAAAAGCAAGACCCTGAAGC
CaUBP27GATGCTCGAATCATGGGAGTAGAACAACCATTGCCTCCAC
CaUBP32GACAAGACCTACGGGAGCAGAAGCCAGTTCACCAACCATC
CaUBP34AGAAGACGTTCCAACCACGTCGCCGTCCAGCTCGACCAG
CaUBP35CAGCGGTCCTTGATGAATTTCAGCATCCCCATGAATCTCT
CaUBP38CAGCGGTCCTTGATGAATTTCAGCATCCCCATGAATCTCT
β-ActinCCACCTCTTCACTCTCTGCTCTACTAGGAAAAACAGCCCTTGGT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Chang, X.; Wang, T.; Huang, J.; Xu, J.; Ruan, Y.; Liang, Y.; Wang, J. Genome-Wide Identification and Expression Analysis of UBP Genes in Peppers (Capsicum annuum L.). Horticulturae 2025, 11, 458. https://doi.org/10.3390/horticulturae11050458

AMA Style

Chang X, Wang T, Huang J, Xu J, Ruan Y, Liang Y, Wang J. Genome-Wide Identification and Expression Analysis of UBP Genes in Peppers (Capsicum annuum L.). Horticulturae. 2025; 11(5):458. https://doi.org/10.3390/horticulturae11050458

Chicago/Turabian Style

Chang, Xuerui, Tiantian Wang, Jiaxin Huang, Jia Xu, Yangyang Ruan, Yanping Liang, and Jing Wang. 2025. "Genome-Wide Identification and Expression Analysis of UBP Genes in Peppers (Capsicum annuum L.)" Horticulturae 11, no. 5: 458. https://doi.org/10.3390/horticulturae11050458

APA Style

Chang, X., Wang, T., Huang, J., Xu, J., Ruan, Y., Liang, Y., & Wang, J. (2025). Genome-Wide Identification and Expression Analysis of UBP Genes in Peppers (Capsicum annuum L.). Horticulturae, 11(5), 458. https://doi.org/10.3390/horticulturae11050458

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop