Humic Acid Alleviates Low-Temperature Stress by Regulating Nitrogen Metabolism and Proline Synthesis in Melon (Cucumis melo L.) Seedlings
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Experimental Design
2.2. Growth Index Measurement and Root Architecture
2.3. Total Chlorophyll Content, Fv/Fm, REL, MDA, and Antioxidant Enzyme Activity Measurement
2.4. NO3−-N and NH4+-N Content Measurement
2.5. Proline, Soluble Protein, and Free Amino Acid Content Measurement
2.6. Nitrogen Metabolism Enzyme Activity Measurement
2.7. Proline Metabolism Enzyme Activity Measurement
2.8. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) Analysis
2.9. Statistical Analysis
3. Results
3.1. Effects of HA on Growth Parameters, the Chlorophyll Content, and Fv/Fm Under Cold Stress
3.2. Effects of HA on Root Architecture Under Cold Stress
3.3. Effects of HA on Antioxidant Enzyme Activity, REL, and MDA Content Under Cold Stress
3.4. Effects of HA on the Content of NO3−-N, NH4+-N, Free Amino Acids, Proline, and Soluble Protein Under Cold Stress
3.5. Effects of HA on Nitrogen Metabolism Enzyme Activity and Relative Expression Levels of Genes Under Cold Stress
3.6. Effects of HA on Proline Metabolism Enzyme Activity and Relative Expression Levels of Genes Under Cold Stress
4. Discussion
5. Conclusions
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Liu, T.; Han, Y.Q.; Shi, J.L.; Liang, A.D.; Xu, D.D.; Ye, X.L.; Qi, H.Y. Abscisic acid involved in trehalose improved melon photosynthesis via regulating oxidative stress tolerance and cell morphology structure under cold stress. Environ. Exp. Bot. 2022, 202, 105042. [Google Scholar] [CrossRef]
- Li, M.; Zhao, W.L.; Du, Q.J.; Xiao, H.J.; Li, J.Q.; Wang, J.Q.; Shang, F.D. Abscisic acid and hydrogen peroxide regulate proline homeostasis in melon seedlings under cold stress by forming a bidirectional closed loop. Environ. Exp. Bot. 2023, 205, 105102. [Google Scholar] [CrossRef]
- Liu, T.; Shi, J.L.; Li, M.; Ye, X.L.; Qi, H.Y. Trehalose triggers hydrogen peroxide and nitric oxide to participate in melon seedlings oxidative stress tolerance under cold stress. Environ. Exp. Bot. 2021, 184, 104379. [Google Scholar] [CrossRef]
- Kidokoro, S.; Shinozaki, K.; Yamaguchi-Shinozaki, K. Transcriptional regulatory network of plant cold-stress responses. Trends Plant Sci. 2022, 27, 922–935. [Google Scholar] [CrossRef] [PubMed]
- Shi, Y.T.; Ding, Y.L.; Yang, S.H. Molecular regulation of CBF signaling in cold acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.Y.; Zhang, H.Q.; Lou, X.; Tang, M. Mycorrhizal and non-mycorrhizal Medicago truncatula roots exhibit differentially regulated NADPH oxidase and antioxidant response under Pb stress. Environ. Exp. Bot. 2019, 164, 10–19. [Google Scholar] [CrossRef]
- Liu, G.Y.; Du, Q.J.; Li, J.M. Interactive effects of nitrate-ammonium ratios and temperatures on growth, photosynthesis, and nitrogen metabolism of tomato seedlings. Sci. Hortic. 2017, 214, 41–50. [Google Scholar] [CrossRef]
- Yang, Y.T.; Dong, J.Q.; Gu, R.; Shi, R.R.; Shi, F.L. Effects of low temperature on distribution and metabolism enzyme activity of carbon and nitrogen of Medicago ruthenica (L.). Grassl. Sci. 2022, 69, 42–50. [Google Scholar] [CrossRef]
- Rehman, A.U.; Bashir, F.; Ayaydin, F.; Kóta, Z.; Pali, T.; Vass, I. Proline is a quencher of singlet oxygen and superoxide both in in vitro systems and isolated thylakoids. Physiol. Plant. 2021, 172, 7–18. [Google Scholar] [CrossRef]
- Fichman, Y.; Gerdes, S.Y.; Kovács, H.; Szabados, L.; Zilberstein, A.; Csonka, L.N. Evolution of proline biosynthesis: Enzymology, bioinformatics, genetics, and transcriptional regulation. Biol. Rev. 2015, 90, 1065–1099. [Google Scholar] [CrossRef]
- Alvarez, M.E.; Savouré, A.; Szabados, L. Proline metabolism as regulatory hub. Trends Plant Sci. 2022, 27, 39–55. [Google Scholar] [CrossRef] [PubMed]
- Primo-Capella, A.; Martínez-Cuenca, M.R.; Gil-Muñoz, F.; Forner-Giner, M.A. Physiological characterization and proline route genes quantification under long-term cold stress in Carrizo citrange. Sci. Hortic. 2020, 276, 109744. [Google Scholar] [CrossRef]
- Yang, S.L.; Lan, S.S.; Deng, F.F.; Gong, M. Effects of Calcium and Calmodulin Antagonists on Chilling Stress-Induced Proline Accumulation in Jatropha curcas L. J. Plant Growth Regul. 2016, 35, 815–826. [Google Scholar] [CrossRef]
- Duan, W.X.; Li, G.H.; Zhang, H.Y.; Wang, Q.M.; Xie, B.T.; Zhang, L.M. The impact of humic acid compound fertilizer on sweet potato variety Jishu 25: A comprehensive study on dry matter, root yield, and starch properties. Sci. Hortic. 2023, 327, 112822. [Google Scholar] [CrossRef]
- Cha, J.Y.; Kang, S.H.; Ali, I.; Lee, S.C.; Ji, M.G.; Jeong, S.Y.; Shin, G.I.; Kim, M.G.; Jeon, J.R.; Kim, W.Y. Humic acid enhances heat stress tolerance via transcriptional activation of Heat-Shock Proteins in Arabidopsis. Sci. Rep. 2020, 10, 15042. [Google Scholar] [CrossRef]
- Canellas, L.P.; Canellas, N.O.A.; Irineu, L.E.S.D.; Olivares, F.L.; Piccolo, A. Plant chemical priming by humic acids. Chem. Biol. Technol. Ag. 2020, 7, 12. [Google Scholar] [CrossRef]
- Saidimoradi, D.; Ghaderi, N.; Javadi, T. Salinity stress mitigation by humic acid application in strawberry (Fragaria x ananassa Duch.). Sci. Hortic. 2019, 256, 108594. [Google Scholar] [CrossRef]
- Wadas, W.; Dziugieł, T. Changes in assimilation area and chlorophyll content of very early potato (Solanum tuberosum L.) Cultivars as Influenced by Biostimulants. Agronomy 2020, 10, 387. [Google Scholar] [CrossRef]
- Roomi, S.; Masi, A.; Conselvan, G.B.; Trevisan, S.; Quaggiotti, S.; Pivato, M.; Arrigoni, G.; Yasmin, T.; Carletti, P. Protein profiling of arabidopsis roots treated with humic substances: Insights into the metabolic and interactome networks. Front. Plant Sci. 2018, 9, 1812. [Google Scholar] [CrossRef] [PubMed]
- Xia, H.; Liu, X.L.; Wang, Y.M.; Lin, Z.Y.; Deng, H.H.; Wang, J.; Lin, L.J.; Deng, Q.X.; Lv, X.L.; Xu, K.F.; et al. 24-Epibrassinolide and nitric oxide combined to improve the drought tolerance in kiwifruit seedlings by proline pathway and nitrogen metabolism. Sci. Hortic. 2022, 297, 110929. [Google Scholar] [CrossRef]
- Arnon, D.I. Copper enzymes in isolated chloroplasts. polyphenoloxidase in Beta Vulgaris. Plant Physiol. 1949, 24, 1–15. [Google Scholar] [CrossRef] [PubMed]
- Cao, Y.; Du, P.H.; Ji, J.H.; He, X.L.; Zhang, J.R.; Shang, Y.W.; Liu, H.T.; Xu, J.Z.; Liang, B.L. Ionomic combined with transcriptomic and metabolomic analyses to explore the mechanism underlying the effect of melatonin in relieving nutrient stress in apple. Int. J. Mol. Sci. 2022, 23, 9855. [Google Scholar] [CrossRef]
- Jambunathan, N. Determination and detection of reactive oxygen species (ros), lipid peroxidation, and electrolyte leakage in plants. Methods Mol. Biol. 2010, 639, 292–298. [Google Scholar] [CrossRef] [PubMed]
- Wang, F.; Yang, Q.Z.; Zhao, Q.F.; Zhang, X.P. Roles of antioxidant capacity and energy metabolism in the maturity-dependent chilling tolerance of postharvest kiwifruit. Postharvest Biol. Tec. 2020, 168, 111281. [Google Scholar] [CrossRef]
- Chakraborty, K.; Singh, A.L.; Kalariya, K.A.; Goswami, N.; Zala, P.V. Physiological responses of peanut (Arachis hypogaea L.) cultivars to water deficit stress: Status of oxidative stress and antioxidant enzyme activities. Acta Bot. Croat. 2015, 74, 123–142. [Google Scholar] [CrossRef]
- Cataldo, D.A.; Maroon, M.; Schrader, L.E.; Youngs, V.L. Rapid colorimetric determination of nitrate in plant tissue by nitration of salicylic acid. Commun. Soil. Sci. Plan. 1975, 6, 71–80. [Google Scholar] [CrossRef]
- Molins-Legua, C.; Meseguer-Lloret, S.; Moliner-Martinez, Y.; Campíns-Falcó, P. A guide for selecting the most appropriate method for ammonium determination in water analysis. TrAC Trends Anal. Chem. 2006, 25, 282–290. [Google Scholar] [CrossRef]
- Bates, L.S.; Waldren, R.P.; Teare, I.D. Rapid determination of free proline for water-stress studies. Plant Soil. 1973, 39, 205–207. [Google Scholar] [CrossRef]
- Liang, D.; Ni, Z.Y.; Xia, H.; Xie, Y.; Lv, X.L.; Wang, J.; Lin, L.J.; Deng, Q.X.; Luo, X. Exogenous melatonin promotes biomass accumulation and photosynthesis of kiwifruit seedlings under drought stress. Sci. Hortic. 2019, 246, 34–43. [Google Scholar] [CrossRef]
- Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
- Sun, S.W.; Lin, Y.C.; Weng, Y.M.; Chen, M.J. Efficiency improvements on ninhydrin method for amino acid quantification. J. Food Compos. Anal. 2006, 19, 112–117. [Google Scholar] [CrossRef]
- Cui, M.; Pham, M.D.; Hwang, H.; Chun, C. Flower development and fruit malformation in strawberries after short-term exposure to high or low temperature. Sci. Hortic. 2021, 288, 110308. [Google Scholar] [CrossRef]
- Song, Q.P.; Wang, X.P.; Li, J.; Chen, T.H.H.; Liu, Y.; Yang, X.H. CBF1 and CBF4 in Solanum tuberosum L. differ in their effect on low-temperature tolerance and development. Environ. Exp. Bot. 2021, 185, 104416. [Google Scholar] [CrossRef]
- El-Hoseiny, H.M.; Helaly, M.N.; Elsheery, N.I.; Alam-Eldein, S.M. Humic acid and boron to minimize the incidence of alternate bearing and improve the productivity and fruit quality of mango trees. Hortscience 2020, 55, 1026–1037. [Google Scholar] [CrossRef]
- Sarabi, B.; Ghaderi, N.; Ghashghaie, J. Light-emitting diode combined with humic acid improve the nutritional quality and enzyme activities of nitrate assimilation in rocket (Eruca sativa (Mill.) Thell.). Plant Physiol. Bioch. 2022, 187, 11–24. [Google Scholar] [CrossRef]
- Akladious, S.A.; Mohamed, H.I. Ameliorative effects of calcium nitrate and humic acid on the growth, yield component and biochemical attribute of pepper (Capsicum annuum) plants grown under salt stress. Sci. Hortic. 2018, 236, 244–250. [Google Scholar] [CrossRef]
- Bayat, H.; Shafie, F.; Aminifard, M.H.; Daghighi, S. Comparative effects of humic and fulvic acids as biostimulants on growth, antioxidant activity and nutrient content of yarrow (Achillea millefolium L.). Sci. Hortic. 2021, 279, 109912. [Google Scholar] [CrossRef]
- Castro, T.A.V.T.; Berbara, R.L.L.; Tavares, O.C.H.; da Graça Mello, D.F.; Pereira, E.G.; de Souza, C.D.C.B.; Espinosa, L.M.; García, A.C. Humic acids induce aeustress state via photosynthesis and nitrogen metabolism leading to a rootgrowth improvement in rice plants. Plant Physiol. Biochem. 2021, 162, 171–184. [Google Scholar] [CrossRef] [PubMed]
- Liu, T.; Ye, X.L.; Li, M.; Li, J.M.; Qi, H.Y.; Hu, X.H. H2O2 and NO are involved in trehalose-regulated oxidative stress tolerance in cold-stressed tomato plants. Environ. Exp. Bot. 2019, 171, 103961. [Google Scholar] [CrossRef]
- Silva, V.M.; Tavanti, R.F.R.; Gratao, P.L.; Alcock, T.D.; Reis, A.R.D. Selenate and selenite affect photosynthetic pigments and ROS scavenging through distinct mechanisms in cowpea (Vigna unguiculata (L.) walp) plants. Ecotox Environ. Safe. 2020, 201, 110777. [Google Scholar] [CrossRef]
- Irani, H.; ValizadehKaji, B.; Naeini, M.R. Biostimulant-induced drought tolerance in grapevine is associated with physiological and biochemical changes. Chem. Biol. Technol. Ag. 2021, 8, 5. [Google Scholar] [CrossRef]
- Hegab, R.H.; Fawy, E.A.; Habib, A.A.M. Evaluates effect of amino acids, humic acid and antioxidants as foliar application on the biochemical content and productivity of wheat under north sinai soils conditions. Am. J. Agric. For. 2020, 8, 167–174. [Google Scholar] [CrossRef]
- Zhao, Y.; Zhou, M.; Xu, K.; Li, J.H.; Li, S.S.; Zhang, S.H.; Yang, X.Y. Integrated transcriptomics and metabolomics analyses provide insights into cold stress response in wheat. Crop J. 2019, 7, 857–866. [Google Scholar] [CrossRef]
- Wang, F.; Yang, Q.Z.; Zhao, Q.F.; Li, X. Cold shock treatment with oxalic acid could alleviate chilling injury in green bell pepper by enhancing antioxidant enzyme activity and regulating proline metabolism. Sci. Hortic. 2022, 295, 110783. [Google Scholar] [CrossRef]
- Szepesi, Á.; Szőllősi, R. Chapter17-Mechanism of proline biosynthesis and role of proline metabolism enzymes under environmental stress in plants. In Plant Metabolites and Regulation Under Environmental Stress, 1st ed.; Ahmad, P., Ahanger, M.A., Singh, V.P., Tripathi, D.K., Alam, P., Alyemeni, M.N., Eds.; Academic Press: Salt Lake City, UT, USA, 2018; pp. 337–353. [Google Scholar] [CrossRef]
- Yan, L.; Zeng, Y.; Riaz, M.; Cheng, J.; Jiang, C.C. Exogenous proline triggered internal tolerance mechanism in trifoliate orange (Poncirus trifoliata) acclimated to boron-deficiency. Sci. Hortic. 2021, 288, 110412. [Google Scholar] [CrossRef]
- Talaat, N.B. Polyamine and nitrogen metabolism regulation by melatonin and salicylic acid combined treatment as a repressor for salt toxicity in wheat (Triticum aestivum L.) plants. Plant Growth Regul. 2021, 95, 315–329. [Google Scholar] [CrossRef]
- Cao, L.; Qin, B.; Gong, Z.P.; Zhang, Y.X. Melatonin improves nitrogen metabolism during grain filling under drought stress. Physiol. Mol. Biol. Plants 2022, 28, 1477–1488. [Google Scholar] [CrossRef]
- Wang, Y.; Wang, Y.M.; Lu, Y.T.; Qiu, Q.L.; Fan, D.M.; Wang, X.C.; Zheng, X.Q. Influence of different nitrogen sources on carbon and nitrogen metabolism and gene expression in tea plants (Camellia sinensis L.). Plant Physiol. Bioch. 2021, 167, 561–566. [Google Scholar] [CrossRef] [PubMed]
- Trevisan, S.; Francioso, O.; Quaggiotti, S.; Nardi, S. Humic substances biological activity at the plant-soil interface from environmental aspects to molecular factors. Plant Signal. Behav. 2010, 5, 635–643. [Google Scholar] [CrossRef] [PubMed]
- Tavares, O.C.H.; Santos, L.A.; Araújo, O.J.L.D.; Bucher, C.P.C.; García, A.C.; Arruda, L.N.; Souza, S.R.D.; Fernandes, M.S. Humic acid as a biotechnological alternative to increase N-NO3− or N-NH4+ uptake in rice plants. Biocatal. Agric. Biotechnol. 2019, 20, 101226. [Google Scholar] [CrossRef]
- Zanin, L.; Tomasi, N.; Zamboni, A.; Sega, D.; Varanini, Z.; Pinton, R. Water-extractable humic substances speed up transcriptional response of maize roots to nitrate. Environ. Exp. Bot. 2018, 147, 167–178. [Google Scholar] [CrossRef]
- Francis, B.; Aravindakumar, C.T.; Brewer, P.B.; Simon, S. Plant nutrient stress adaptation: A prospect for fertilizer limited agriculture. Environ. Exp. Bot. 2023, 213, 105431. [Google Scholar] [CrossRef]
Gene | Forward (5′-3′) | Reverse (5′-3′) |
---|---|---|
NR | CAACTCAACTCACGGAGCCT | GCACATCGTGTGAGATTGCG |
GS | TGGCCTTCGTTACCACCTTC | CTTCCGAAAGCGATTGAGGC |
GOGAT | TGGCCTTCGTTACCACCTTC | CTTCCGAAAGCGATTGAGGC |
GDH | GCTGCAACCCAAGGGAGTTA | GTCTGTGCATTTGTGCCCAT |
P5CS | GCATGGAAGTGCACACACTG | AGCACCCAGACCAAATCGAG |
OAT | TCCCTTGTTGCCTGGACATC | TAACCCCTGCCTCTCCTTGA |
P5CR | AGTTGCTGCAGGTCTACCAC | TGGTAGTCCCACCAGGTGAT |
ProDH | ATATGCCGATGACGAAGCGT | AACTCGCAGAACCAGATGGG |
β-actin | GGCAGTGGTGGTGAACATG | TTCTGGTGATGGTGTGAGTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhu, L.; Liu, H.; Zhang, Y.; Cao, Y.; Hu, Y.; Wang, Y.; Zheng, H.; Liu, M. Humic Acid Alleviates Low-Temperature Stress by Regulating Nitrogen Metabolism and Proline Synthesis in Melon (Cucumis melo L.) Seedlings. Horticulturae 2025, 11, 16. https://doi.org/10.3390/horticulturae11010016
Zhu L, Liu H, Zhang Y, Cao Y, Hu Y, Wang Y, Zheng H, Liu M. Humic Acid Alleviates Low-Temperature Stress by Regulating Nitrogen Metabolism and Proline Synthesis in Melon (Cucumis melo L.) Seedlings. Horticulturae. 2025; 11(1):16. https://doi.org/10.3390/horticulturae11010016
Chicago/Turabian StyleZhu, Libao, Haihe Liu, Yanping Zhang, Yanxia Cao, Yiwen Hu, Yalun Wang, Haiqiang Zheng, and Mengze Liu. 2025. "Humic Acid Alleviates Low-Temperature Stress by Regulating Nitrogen Metabolism and Proline Synthesis in Melon (Cucumis melo L.) Seedlings" Horticulturae 11, no. 1: 16. https://doi.org/10.3390/horticulturae11010016
APA StyleZhu, L., Liu, H., Zhang, Y., Cao, Y., Hu, Y., Wang, Y., Zheng, H., & Liu, M. (2025). Humic Acid Alleviates Low-Temperature Stress by Regulating Nitrogen Metabolism and Proline Synthesis in Melon (Cucumis melo L.) Seedlings. Horticulturae, 11(1), 16. https://doi.org/10.3390/horticulturae11010016